Isolates In GenBank Research Articles

First Report of Colletotrichum gloeosporioides Causing Anthracnose of Banana (Musa spp.) in Malaysia.

Banana is the second largest cultivated fruit crop in Malaysia, and is cultivated for both the domestic market and also for export. Anthranose is a well-known postharvest disease of banana and with high potential for damaging market value, as infection commonly occurs during storage. Anthracnose symptoms were observed on several varieties of banana such as mas, berangan, awak, nangka, and rastali in the states of Perak and Penang between August and October 2011. Approximately 80% of the fruits became infected with initial symptoms characterized as brown to black spots that later became sunken lesions with orange or salmon-colored conidial masses. Infected tissues (5 × 5 mm) were surface sterilized by dipping in 1% sodium hypochlorite (NaOCl) for 3 to 5 min, rinsed with sterile distilled water, and plated onto potato dextrose agar (PDA). Direct isolation was done by transferring the conidia from conidial masses using an inoculation loop and plating onto PDA. For both methods, the PDA plates were incubated at 27 ± 1°C with cycles of 12 h light and 12 h darkness. Visible growth of mycelium was observed after 4 to 5 days of incubation. Twenty isolates with conidial masses were recovered after 7 days of incubation. The isolates produced grayish white to grayish green and grey to moss dark green colony on PDA, pale orange conidial masses, and fusiform to cylindrical and hyaline conidia with an average size of 15 to 19 × 5 to 6 μm. Appresoria were ovate to obovate, dark brown, and 9 to 15 × 7 to 12 μm and setae were present, slightly swollen at the base, with a tapered apex, and brown. The cultural and morphological characteristics of the isolates were similar to those described for C. gleosporioides (1,2,3). All the C. gloeosporioides isolates were deposited in culture collection at Plant Pathology Lab, University Sains Malaysia. For confirmation of the identity of the isolates, ITS regions were sequenced using ITS4 and ITS5 primers. The isolates were deposited in GenBank with accessions JX163228, JX163231, JX163201, JX163230, JX163215, JX163223, JX163219, JX163202, JX163225, JX163222, JX163206, JX163218, JX163208, JX163209, JX163210, JX431560, JX163212, JX163213, JX431540, and JX431562. The resulting sequences showed 99% to 100% similarity with multiple C. gloeosporioides isolates in GenBank. Pathogenicity tests were conducted using mas, berangan, awak, nangka, and rastali bananas. Fruit surfaces were sterilized with 70% ethanol and wounded using a sterile scalpel. Two inoculation techniques were performed separately: mycelia plug and conidial suspension. Mycelial disc (5 mm) and a drop of 20 μl spore suspension (106 conidia/ml) were prepared from 7-day-old culture and placed on the fruit surface. The inoculated fruits were incubated at 27 ± 1°C for 10 days at 96.1% humidity. After 3 to 4 days of inoculation, brown to black spotted lesions were observed and coalesced to become black sunken lesions. Similar anthracnose symptoms were observed on all banana varieties tested. C. gloeosporioides was reisolated from the anthracnose lesions of all the inoculated fruit in which the cultural and morphological characteristics were the same as the original isolates. To our knowledge, this is the first report of C. gloeosporioides causing anthracnose of Musa spp. in Malaysia.

First Report of Stem and Leaf Anthracnose on Blueberry Caused by Colletotrichum gloeosporioides in China.

Blueberry (Vaccinium spp.) is becoming increasingly popular in China as a nutritional berry crop. With the expansion of blueberry production, many diseases have become widespread in different regions of China. In August of 2012, stem and leaf spots symptomatic of anthracnose were sporadically observed on highbush blueberries in a field located in Liaoning, China, where approximately 15% of plants were diseased. Symptoms first appeared as yellow to reddish, irregularly-shaped lesions on leaves and stems. The lesions then expanded, becoming dark brown in the center and surrounded by a reddish halo. Leaf and stem tissues (5 × 5 mm) were cut from the lesion margins and surface-disinfected in 70% ethanol for 30 s, followed by three rinses with sterile water before placing on potato dextrose agar (PDA). Plates were incubated at 28°C. Colonies were initially white, becoming grayish-white to gray with yellow spore masses. Conidia were one-celled, hyaline, and cylindrical with rounded ends, measuring 15.0 to 25.0 × 4.0 to 7.5 μm. No teleomorph was observed. The fungus was tentatively identified as Colletotrichum gloeosporioides (PenZ.) PenZ & Sacc. (teleomorph Glomerella cingulata (Stoneman) Spauld. & H. Schrenk) based on morphological characteristics of the colony and conidia (1). Genomic DNA was extracted from isolate XCG1 and the internal transcribed spacer (ITS) region of the ribosomal DNA (ITS1-5.8S-ITS2) was amplified with primer pairs ITS1 and ITS4. BLAST searches showed 99% identity with C. gloeosporioides isolates in GenBank (Accession No. AF272779). The sequence of isolate XCG1 (C. gloeosporioides) was deposited into GenBank (JX878503). Pathogenicity tests were conducted on 2-year-old potted blueberries, cv. Berkeley. Stems and leaves of 10 potted blueberry plants were wounded with a sterilized needle and sprayed with a suspension of 105 conidia per ml of sterilized water. Five healthy potted plants were inoculated with sterilized water as control. Dark brown lesions surrounded by reddish halos developed on all inoculated leaves and stems after 7 days, and the pathogen was reisolated from lesions of 50% of inoculated plants as described above. The colony and conidial morphology were identical to the original isolate XCG1. No symptoms developed on the control plants. The causal agent of anthracnose on blueberry was identified as C. gloeosporioides on the basis of morphological and molecular characteristics, and its pathogenicity was confirmed with Koch's postulates. Worldwide, it has been reported that blueberry anthracnose might be caused by C. acutatum and C. gloeosporioides (2). However, we did not isolate C. acutatum during this study. To our knowledge, this is the first report of stem and leaf anthracnose of blueberry caused by C. gloeosporioides in China.

Molecular characterization of Trypanosoma evansi isolates from water buffaloes (Bubalus bubalis) in the Philippines

Trypanosoma evansi infection in the Philippines is frequently reported to affect the country's livestock, particularly, the buffaloes. To assess the prevalence and intraspecific diversity of T. evansi in the country, blood samples from water buffaloes in different geographical regions were collected during an outbreak. T. evansi was detected in all 79 animals tested using PCR targeting the RoTat 1.2 VSG gene. Sequencing of the rDNA complete internal transcribed spacer (ITS) region including the 5.8S subunit showed high similarity (99-100%) between Philippine isolates and known T. evansi isolates in Genbank. Tree construction based on the same region confirmed the close relationship between Philippine and reported Thai isolates as compared to Egyptian isolates separated by relatively small genetic distances, 47 polymorphisms, despite the clustering in four branches. Overall, the results of this study prove genetic diversity within T. evansi species despite previous reports on limited heterogeneity among isolates worldwide.

Calosphaeria canker of almond caused by Calosphaeria pulchella in Iran

Trunk diseases are a potential threat for the almond industry in Northern Iran. In a survey on fungal agents associated with almond die back and decline in East Azerbaijan province, located in Northwest of Iran, acremonium-like hyphomycete isolates with hyaline and simple conidiophores and hyaline cylindrical phialides with a finely pigmented apical region and deep, flaring collarettes were repeatedly recovered from symptomatic tissues. Fungal isolates were identified as Calosphaeria pulchella based on cultural and morphological characteristics. The identity of the species was further confirmed based on the sequence data from LSU and ITS rDNA regions. A phylogeny inferred using ITS sequence data, clustered the Calosphaeria isolates together with Calosphaeria pulchella isolates in GenBank known from Prunus persica and Prunus avium. The results of pathogenicity assay using an excised shoot method showed that Calosphaeria pulchella is highly pathogenic on almond. The distribution and host range of this new pathogen on almond and the impact of the disease on almond industry in this region remain to be studied.

First Report of Rhizoctonia solani AG4 HG-II Infecting Potato Stems in Idaho.

The fungus Rhizoctonia solani is the causal agent of stem canker and black scurf of potato (Solanum tuberosum). R. solani is a species complex consisting of 13 anastomosis groups (AGs) designated AG1 to 13 (2, 3). Stems of potato (cv. Russet Norkotah) with brown lesions were recovered from one field in Kimberley, Idaho, in August 2011. Using previously described methods (3), R. solani was recovered from the symptomatic stems and one representative isolate (J15) was selected for further characterization. Sequencing of the rDNA ITS region of isolate J15 was undertaken as previously described (3) and the resulting rDNA ITS sequence (HE667745) was 99% identical to sequences of other AG4 HG-II isolates in GenBank (AF354072 and AF354074). Pathogenicity of the isolate was determined by conducting the following experiment. Mini-tubers of cv. Santé were planted individually in 1-liter pots containing John Innes Number 3 compost (John Innes Manufacturers Association, Reading, UK). Pots were either inoculated with J15, an isolate of AG3-PT (Rs08), or were not inoculated. Each treatment was replicated four times. Inoculum consisted of five 10-mm-diameter potato dextrose agar plugs, fully colonized by the appropriate isolate, placed in the compost approximately 40 mm above each seed tuber. Pots were held in a controlled environment room at 21°C with 50% relative humidity and watered as required. After 21 days, plants were assessed for disease. No symptoms of the disease were present in non-inoculated plants. In the Rs08 (AG3-PT) inoculated plants, all stems displayed large brown lesions and 20% of the stems had been killed. No stem death was observed in J15 (AG4 HG-II) inoculated plants. However, brown lesions were observed in three of the four J15 (AG4 HG-II) inoculated plants. These lesions were less severe than in plants inoculated with the Rs08(AG3-PT) inoculated plants and were present in 40% of the main stems. In the J15 (AG4 HG-II) inoculated pots, R. solani AG4 HG-II was reisolated from the five symptomatic stems, thereby satisfying Koch's postulates. To our knowledge, this is the first report of AG4 HG-II causing disease on potatoes in Idaho. AG4 has been isolated from potato previously from North Dakota, although the subgroup was not identified (1). The only previous report where AG4 HG-II was specifically determined to cause disease on potato was in Finland, but the isolate could not be maintained and Koch's postulates were not completed (3). The present study shows that AG4 HG-II can cause stem disease in potatoes, although disease does not develop as severely or as consistently as for AG3-PT. However, as demonstrated with isolates of AG2-1 and AG5, even mild stem infection can reduce tuber yield by as much as 12% (4). AG4 HG-II is a pathogen of sugar beet in Idaho, which was grown previously in this field. This history may have contributed to high levels of soilborne inoculum required to produce disease on potato.

First Report of Ilyonectria macrodidyma Causing Root Rot of Olive Trees (Olea europaea) in California.

The California olive industry produces 99% of the U.S. olive crop, which represented a value of over $113 million in 2010. During the 2008 and 2009 growing seasons, decline of young super-high-density olive cvs. Arbequina, Arbosana, and Koroneiki trees (<4 years old) was observed in orchards throughout Glenn, Yolo, and San Joaquin Counties. Symptomatic trees showed stunted growth and chlorotic leaves with roots having black, sunken, necrotic lesions, which frequently prolonged into the base and crown of the tree. Twenty-five trees were collected from different orchards and necrotic roots as well as infected trunk tissue were plated onto potato dextrose agar amended with 0.01% tetracycline hydrochloride. Cultures were incubated at room temperature (23 ± 2°C) until fungal colonies were observed. In 17 out of 25 trees collected (68%), light yellow fungal colonies were observed from the symptomatic tissue after 7 to 10 days. Colonies turned dark yellow to orange with age and showed an orange-dark brown reverse. Both microconidia (hyaline, ellipsoidal to ovoidal and aseptate (n = 60) (6.5) 11.5 to 13.5 (17.1) × (3) 3.4 to 4.5 (5.6) μm) and macroconidia (hyaline, cylindrical, straight and/or slightly curved with one, two or three septa (n = 60) (12.5) 26.5 to 38.5 (44.1) × (4) 5.5 to 7.5 (8.5) μm) were observed. Culture and conidial morphology were in concordance with previous published description of Ilyonectria macrodidyma (Halleen, Schroers & Crous) P. Chaverri & C. Salgado (1,3,4). Identification to species level was confirmed by sequence comparison of four Californian isolates (UCCE958, UCCE959, UCCE960, and UCCE961) with sequences available in GenBank using the internal transcribed spacer region (ITS1-5.8S-ITS2) of the rDNA (primers ITS1/ITS4), a portion of the β-tubulin gene (BT1a/BT1b), and a partial sequence of the mitochondrial small subunit rDNA (NMS1/NMS2) (4). Fungal sequences of isolates from olive from California (GenBank JQ868543 to JQ868554) showed 99 to 100% homology with previously identified and deposited I. macrodidyma isolates in Genbank for all three genes. Pathogenicity of I. macrodidyma in olive cvs. Arbequina, Arbosan, and Koroneiki was investigated using two fungal isolates (UCCE958 and UCCE960) as reported by Petit and Gubler (4). The roots of 10 1-year-old trees per fungal isolate for each olive cultivar were individually inoculated with 25 ml of a 106 conidia/ml spore suspension and placed in a lath house at the UC Davis field station. Additionally, 10 trees per cultivar were inoculated with sterile water as controls. Six months after inoculation, most of the inoculated olive plants showed chlorotic leaves similar to those observed in commercial orchards. Root necrosis for each cv. was expressed as the percentage of root length having lesions (2). No significant difference was observed between isolates and average root necrosis was 29.4, 35.6, and 38.3% in Koroniki, Arbosana, and Arbequina, respectiveley. I. macrodidyma was recovered from symptomatic roots in each of the cvs. and identified based on morphology. No root rot symptoms were observed in the controls. To our knowledge, this is the first report of I. macrodidyma causing root rot of olive trees not only in California but anywhere in the world.

First Report of Leaf Spot Caused by Alternaria alternata on Switchgrass in Tennessee.

Field-grown seedlings of 'Alamo' switchgrass (Panicum virgatum L.) from Vonore, TN exhibited light brown-to-dark brown leaf spots and general chlorosis in June 2009. Symptomatic leaf tissue was surface sterilized (95% ethanol for 1 min, 20% commercial bleach for 3 min, and 95% ethanol for 1 min), air dried on sterile filter paper, and plated on 2% water agar amended with 10 mg/liter rifampicin (Sigma-Aldrich, St. Louis, MO) and 5 μl/liter miticide (2.4 EC Danitol, Valent Chemical, Walnut Creek, CA). Plates were incubated at 26°C for 4 days in darkness. An asexual, dematiaceous mitosporic fungus was isolated and transferred to potato dextrose agar. Cultures were transferred to Alternaria sporulation medium (3) to induce conidial production. Club-shaped conidia were produced in chains with branching of chains present. Conidia were 27 to 50 × 10 to 15 μm, with an average of 42.5 × 12.5 μm. Morphological features and growth on dichloran rose bengal yeast extract sucrose agar were consistent with characteristics described previously for Alternaria alternata (1). Pathogenicity studies were conducted with 5-week-old 'Alamo' switchgrass plants grown from surface-sterilized seed. Nine pots with approximately 20 plants each were prepared. Plants were wounded by trimming the tops. Eight replicate pots were sprayed with a conidial spore suspension of 5.0 × 106 spores/ml sterile water and subjected to high humidity by enclosure in a plastic bag for 7 days. One pot was sprayed with sterile water and subjected to the same conditions to serve as a control. Plants were maintained in a growth chamber at 25/20°C with a 12-h photoperiod. Foliar leaf spot symptoms appeared 5 to 10 days postinoculation for all replicate pots inoculated with A. alternata. Symptoms of A. alternata infection were not observed on the control. Lesions were excised, surface sterilized, plated on water agar, and identified in the same manner as previously described. The internal transcribed spacer (ITS) region of ribosomal DNA and the mitochondrial small sub-unit region (SSU) from the original isolate and the reisolate recovered from the pathogenicity assay were amplified with PCR, with primer pairs ITS4 and ITS5 and NMS1 and NMS2, respectively. Resultant DNA fragments were sequenced and submitted to GenBank (Accession Nos. HQ130485.1 and HQ130486.1). A BLAST search (BLASTn, NCBI) was run against GenBank isolates. The ITS region sequences were 537 bp and matched 100% max identity with eight A. alternata isolates, including GenBank Accession No. AB470838. The SSU sequences were 551 bp and matched 100% max identity with seven A. alternata isolates, including GenBank Accession No. AF229648. A. alternata has been reported from switchgrass in Iowa and Oklahoma (2); however, this is the first report of A. alternata causing leaf spot on switchgrass in Tennessee. Switchgrass is being studied in several countries as a potentially important biofuel source, but understanding of the scope of its key diseases is limited.

Identification of 23 specific nucleotide patterns in the HN gene of Newcastle disease viruses isolated from Iran

Newcastle disease is considered the most contagious poultry disease and may cause severe economic loss in the poultry industry. The present study was undertaken to focus on molecular and phylogenetic analyses of the hemagglutinin-neuraminidase (HN) gene in the Iranian isolates. The nucleotide sequence of the HN (780-903 nt) coding region of 6 Newcastle disease viruses (NDVs), isolated from various outbreaks in Iran, was determined and aligned with previously published sequences of 26 NDV isolates in GenBank; the resulting alignment was then analyzed in terms of genetic variation. The number of nucleotide sequence variations presented by each of the isolates indicated that all 6 Iranian isolates contained 23 single nucleotide polymorphisms in the HN coding region. These polymorphisms can be considered signature nucleotides in this lineage. Specific positions are as follow: T795->C, T918->C, T1230->C, T1269->C, A819->G, A990->G, A1041->G, A1293->G, A1523->G, C834->T, C1299->T, C1383->T, C1386->T, C1545->T, C1560->T, G906->T, G1134->A, G1368->A, G1251->C, C1266->A, T1344->G, A1374->T, and T1401->A. Sequence analysis of the isolates showed that the 6 Iranian isolates examined share significant similarity with 2 Russian isolates, Sterna-Astr/2755/2001 and VOL95. Interestingly, both Russian isolates have the same nucleotide pattern as the Iranian isolates in all 23 nucleotide positions, except for isolate Sterna-Astr/2755/2001, which is only different at position 1560. The results may reflect that certain migratory birds, such as Sterna albifrons Pallas, might have contributed to the distribution of NDV in Russia and Iran. These best-known migratory birds travelling between Iran and Russia play a crucial role in the transmission of NDV.

First Report of Dollar Spot Caused by Sclerotinia homoeocarpa on Switchgrass in the United States.

Sclerotinia homoeocarpa causes dollar spot on many grass species; however, it has not been described on switchgrass (Panicum virgatum L.) as a host. In August 2010, bleached, tan-to-straw-colored leaf spots with dark brown-to-reddish brown margins were found in patchy distribution in small field plots of 'Alamo' switchgrass at the East Tennessee Research and Education Center, Knoxville, TN. The plots had been planted to switchgrass for the past 21 years. Disease lesions covered 75 to 80% of leaf tissue per patch and were also evident on stems. To identify the pathogen, center portions of diseased leaves were cut into 20- to 30-cm segments, surface disinfested (95% ethanol for 30 s, 10% bleach for 1 min, and 95% ethanol for 30 s), and dried. Disinfested leaves (5-cm sections that included a leading edge of a lesion) were plated on potato dextrose agar (PDA). Plates were incubated at 22°C. Within 12 h, white, fluffy, aerial mycelium developed. Viewed from above, colonies were tan to cinnamon in color with a dark brown-to-black substratal stroma on and in the agar, which appeared brown as viewed from below the petri dish. No spores were observed. Morphological characteristics of colony and hyphal growth were identical to those of S. homoeocarpa F.T. Bennett (1). Pathogenicity studies were conducted with 6-week-old 'Alamo' switchgrass grown from scarified (2), surface-disinfested seed. Nine (9 × 9-cm2) pots with 18 plants each were inoculated with 20 mycelial plugs (6-mm diameter) per pot, taken from 3-to-5-day-old fungal cultures. Two control pots were inoculated with sterile PDA plugs and subjected to the same conditions. Plugs were placed on leaf surfaces and around the plant crowns. Plants were subjected to high humidity by enclosure in a plastic bag and incubated in a growth chamber at 25/20°C with a 12-h photoperiod. Plastic bags were removed after 48 h. Leaf spots appeared as early as 2 days postinoculation, with full symptoms after 2 weeks for eight of nine replicates. Control plants had no symptoms. The fungus was cultured from leaf spots and stem lesions of inoculated plants as described above. The same disease and fungus were observed, completing Koch's postulates. The internal transcribed spacer (ITS) regions of ribosomal DNA from the original isolate used for inoculation and from the isolate recovered from plants in the pathogenicity assay were amplified with PCR with primers ITS4 and ITS5 (4). PCR amplicons of ~565 bp were sequenced; sequences of amplicons from the original isolate and reisolate were identical and submitted to GenBank (Accession No. HQ850151). The sequence had 99% homology with several S. homoeocarpa isolates in GenBank, including three isolates from buffalograss in Oklahoma (Accession Nos. EU123800, EU123802, and EU123803). The mitochondrial small subunit region was amplified from the original isolate with primers NMS1 and NMS2 (3). The resultant 536-bp fragment was sequenced and submitted to GenBank (Accession No. HQ850152), but no S. homoeocarpa sequences were available for comparison. To our knowledge, this is the first confirmed report of switchgrass as a natural host for S. homoeocarpa, extending the known host range for the pathogen.

16S rRNA에 의한 한국 내 Chyseobacterium indologenes과 염기 서열 변화

Accurate identification for pathogenic bacterium is an essential element in the clinical microbiology laboratory. We studied molecular analysis involving the identification of Chyseobacterium indologenes and evaluated the seventeen isolates in Korea with the 16S rRNA gene of the ribosome to estimate phylogenetic relationships within the genus Chyseobacterium in GenBank. The aligned data sets for C. indologenes were 1,176 nucleotides. Sequence variation within the C. indologenes was mostly due to nucleotide substitutions. Korean C. indologenes isolates were not strikingly different from the same species found in the other countries. However, the rates of base substitution in Korean C. indologenes isolates were higher than those of other C. indologenes isolates in GenBank. C. indologenes was placed as a sister species to C. isbiliense, C. hominis, C. hispanicum, C. molle, C. hungaricum, and C. pallidum.

First Report of Spencermartinsia viticola, Neofusicoccum australe, and N. parvum Causing Branch Canker of Citrus in California.

Dothiorella gummosis and canker on citrus is generally viewed as a minor disease but can result in serious decline of trees. Symptoms, mostly found on branches, include grayish-to-brown cast on cankered bark, which can extend into the xylem. Dothiorella gummosis was earlier believed to be caused by Dothiorella gregaria (2). In a continuing survey on citrus in six California counties (Fresno, Riverside, San Diego, San Luis Obispo, Tulare, and Ventura) in 2010, branch cankers were collected. Small pieces of symptomatic tissues were plated onto potato dextrose agar amended with 0.01% tetracycline (PDA-tet) and incubated at 25°C for 4 days. Fungi most frequently isolated were initially identified as Botryosphaeriaceae based on morphological characters (1,3). Total genomic DNA was PCR amplified with primers Bt2a/2b for the β-tubulin (BT); EF1-728F/986R for the elongation factor α-1 (EF); and ITS4/5 for the internal transcribed spacer ITS1-5.8S-ITS2 regions (3). Sequences were compared in a BLAST search. Spencermartinsia viticola UCP105 was isolated from cv. Parent Washington on Sour Orange rootstock in Tulare County, Neofusicoccum australe UCR1110 from cv. Satsuma in Riverside County, and N. parvum UCR1166 from cv. Meyer Lemon on Volkameriana rootstock in Ventura County. Sequences of UCP105, UCR1110, and UCR1166 have been deposited in GenBank under Accession Nos. JF271766, JF271776, and JF271780 for BT; JF271784, JF271793, and JF271796 for EF; and JF271748, JF271758, and JF271762 for the ITS regions. The sequences matched with isolates in GenBank as follows: ITS region of strain UCP105-98% match with Accession Nos. AY905556-8; BT of strain UCR1110-99% with GU251879-80; and EF of strain UCR1166-98% with GU251238. Pathogenicity tests were conducted by inoculating green shoots of healthy citrus trees similar to cultivar/rootstock from which each isolate was obtained. Fresh wounds were made on 1-year-old citrus shoots with a 3-mm cork borer, and the freshly wounded surfaces were inoculated with 3-mm mycelial plugs from 5-day-old cultures on PDA-tet. Control shoots were inoculated with sterile agar plugs and each treatment had 10 replicates. Inoculated wounds and shoot ends were covered with petroleum jelly and wrapped with Parafilm to prevent desiccation. Shoots were incubated at 25°C in moist chambers for 4 weeks. Lesions were observed on all inoculated shoots except for the control. Mean lesion lengths were 6.4, 7.0, and 6.9 cm for UCP105, UCR1110, and UCR1166, respectively, which were significantly (P = 0.05) different from the control (0.8 cm). The three isolates were reisolated from symptomatic tissues of inoculated shoots to confirm their pathogenicity. This test was repeated and similar results were obtained. Results indicate that there are multiple species in the Botryosphaeriaceae family causing symptoms on citrus that were previously believed to be caused by D. gregaria. To our knowledge, this is the first report of S. viticola, N. australe, and N. parvum on citrus in California.

Widespread Occurrence and Low Genetic Diversity of Colombian datura virus in Brugmansia Suggest an Anthropogenic Role in Virus Selection and Spread.

Brugmansia (Brugmansia spp.) is a perennial shrub in the Solanaceae, originating from South America, that is a popular landscape plant in the tropics and subtropics and container plant in temperate regions. Virus-like symptoms including mosaic, rugosity, and faint chlorotic spots were first observed on leaves of Brugmansia plants in a south Florida nursery in November 2003. Colombian datura virus (CDV) was identified in these initial plants and subsequent Brugmansia and Datura metel (a Brugmansia relative also grown as an ornamental) plants obtained from Florida, Connecticut, Wisconsin, and California. Overall, 77.5% of Brugmansia and two of four D. metel plants tested were infected with CDV. Partial NIb/CP sequences of 28 Brugmansia CDV isolates from this study were compared with all 16 CDV isolates in GenBank and found to share high levels of nucleotide and amino acid identity, with negative selection estimated to be occurring. A single Brugmansia plant was also infected with a recently described tobamovirus. The low genetic diversity of CDV observed, along with negative selection pressure on NIb/CP, suggests a recent ancestry (<400 years) of the worldwide population of CDV, coinciding with anthropogenic collection and dissemination of Brugmansia plants from their center of origin.

First Report of Tomato chlorosis virus in Tomato from Hungary.

A disease of tomato (Lycopersicon esculentum Mill.) was observed in three greenhouses in Tömörkény in southern Hungary in the autumn of 2007. Thirty percent of the plants were chlorotic and stunted and had mottled leaves with interveinal yellowing and necrosis. Similar symptoms induced by Tomato chlorosis virus (ToCV) on tomato have been reported in other countries (1,2). ToCV is a Crinivirus in the Closteroviridae family, which can cause a decline in plant vigor and reduced fruit yield. ToCV is transmitted by whiteflies (Trialeurodes vaporariorum West., T. abutilonea Hald., and Bemisia tabaci Genn.) and grafting, but cannot be transmitted mechanically. Only T. vaporariorum is known to be present and widespread in Hungary. Virus presence was confirmed by reverse transcription-PCR as described by Louro et al. (2). cDNA synthesis with ToCV specific primers (ToCV-UP 5'-TCATTAAAACTCAATGGGACCGAG-3' (3) and ToCV-DW 5'-GCGACGTAAATTGAAACCC-3') was successful and electron microscopy revealed ToCV-like particles. The PCR product has been sequenced (GenBank Accession No. HQ444266) and showed 97 to 99% identity to ToCV isolates in GenBank. According to the symptoms, amplified region, sequence data, and electron microscopy, the tomato samples from Tömörkény were confirmed to be infected with ToCV. The economic losses associated with ToCV were minor. To our knowledge, this is the first report on the occurrence of ToCV in Hungary.

Characteristics of the antigenic genes of four clinical Bordetella pertussis strains

Objectives To analyze the characteristics of antigenic genes of clinical Bordetella pertussis strains recently isolated by analyzing the sequence of pertussis toxin S1 subunit(ptxS1) , pertactin (Prn) , fimbriae 2 (Fim2) and fimbriae 3 (Fim3 ) genes of four clinical isolates. Methods The 4 clinical isolates were collected in 2002 in Shijiazhuang of Hebei province. Four strains were isolated from pertussis patient's nasopharyngeal aspirate. ptxS1, Prn, Fim2 and Fim3 genes of these strains were amplified and sequenced. The sequences of those genes were compared with those of the isolates in GenBank and the isoaltes used in the production of pertussis vaccine in China. Results The results of the gene sequencing showed the four clinical isolates belonged to ptxS1 A type, which were different from those in vaccine strains. In addition, three Prn and three Fim'3 variants were observed in the four clinical isolates. Sequence analysis showed that the nucleotide sequence and deduced amino acid sequence of those strains had more than 99% identity with those in vaccine strains. The phylogenetic trees of those genes also showed these strains had a higher level of similarity with other Bordetella pertussis strains. Conclusion The four clinical isolates are different from vaccine strains in four antigenic genes, which laid a foundation for further studies on pertussis epidemiology,quality control and development of pertussis vaccine in China. Key words: Bordetella pertussis; Pertussis toxin; Bacterial outer membrane proteins; Virulence factors,bordetella; Antigens,bacterial; Fimbriae proteins; Sequence analysis

Onychomycosis by Paecilomyces lilacinus in a patient with leukonychia

Paecilomyces lilacinus, a filamentous fungus living saprophytic in the environment, very rarely causes infection in immunocompetent humans, mostly ocular or cutaneous and sub-cutaneous infections.The fungal isolates usually show low susceptibility to conventional antifungal drugs in vitro and variable susceptibility to novel triazoles. During a period of 2 years, 4 cultures of nail fragments were grown from a 41 years old female on modified Sabouraud/Dextrose agar (S.D.A.) (CAF bioMerieux, CAF+CEX Biolife). Cultures were continued in suspension and the hyphae stained with lactophenole blue analysed microscopically. 2 samples were tested with molecular methods, i.e. DNA extraction, amplification of internal transcribed spacer (ITS) region 1 and 2 and automated sequencing. The sequence results were evaluated using a validated reference database for humanpathogenic fungi. Additionally the BLAST algorithm on NIH database GenBank was used. A growth of a filamentous hyaline fungus with white colonies and lila shade was observed in all samples. The presence of Penicillium like conidiophores with divergent long terminal phialides was seen with little elliptical conidia. DNA sequencing determined the species as Paecilomyces lilacinus with 99% homology with GenBank isolate AY213667. The infection of the right hallux did not improve by systemic (Lamisil/terbinafine) and local treatment (Locetar/amorolfin nail lacquer).Also change to Sporanox/itraconazol only led to deterioriation, so finally the extraction of the nail had to be performed given the known difficulties with treatment described in the literature. This case highlights the usefulness of molecular techniques, especially use of the highly discriminative ITS region for fungal typing.

The presence of embedded bacterial pure cultures in agar plates stimulate the culturability of soil bacteria

Traditional methods for bacterial cultivation recover only a small fraction of bacteria from all sorts of natural environments, and attempts have been made to improve the bacterial culturability. Here we describe the development of a cultivation method, based on the embedment of pure bacterial cultures in between two layers of agar. Plates containing either embedded Pseudomonas putida or Arthrobacter globiformis resulted in higher numbers of CFUs of soil bacteria (21% and 38%, respectively) after 833 h of incubation, compared to plates with no embedded strain. This indicates a stimulatory effect of the bacterial pure cultures on the cultivation of soil bacteria. Analysis of partial 16S rRNA gene sequences revealed a phylogenetical distribution of the soil isolates into 7 classes in 4 phyla. No difference was observed at the phylum or class level when comparing isolates grouped according to embedded strain. The number of isolates belonging to the same class as the embedded strain was reduced in comparison to that of plates with no embedded strain, indicating that intercellular signalling was unlikely to cause the observed stimulatory effect. Significantly higher fractions of isolates with less than 97% sequence homology to known sequenced isolates in GenBank were recovered from plates with embedded strains than from those without, which indicate a higher number of potential novel soil isolates. This approach for cultivation is therefore a feasible alternative or supplement to traditional cultivation on agar plates in order to enhance bacterial culturability.

Molecular characterization of full-length genome of Japanese encephalitis virus isolated in Liaoning Province in 2008.

To sequence and analyze the whole genome of Japanese encephalitis virus (JEV) isolated from mosquitoes in Liaoning province in 2008. Using RT-PCR to amplify fragments with genome sequencing primer. The full-length genome was obtained by sequencing and splicing. The differentiation analysis for nucleotides, deduced amino acid sequence and phylogenetic tree was performed by the software of Clustal X (1.83), ATGC (V4), DNAStar, GENEDOC (3.2) and Mega (4.0). The whole genome of strain LN0828 possesses 10 965 nucleotides. An open reading frame from 97 to 10 392 including 10 296 nucleotides is capable of coding for a 3432 amino acid polyprotein. Comparison of strain LN0828 genomic sequence with those of 32 JEV isolates in GenBank showed that nucleotide sequence divergence ranges from 1.6% to 16.4%, which resulted in amino acid sequence divergence from 0.3% to 5.1%. In comparison with live attenuated vaccine stain SA14-14-2 in open reading frame, strain LN0828 has a total of 1186 nucleotide substitutions, 86 amino acid divergences. Based on phylogenetic analysis, the strain LN0828 belongs to the genotype I JEV. The whole genome of strain LN0828 is close to those of isolates from Liaoning in 2002 and 2007, which were grouped into genotype I JEV.

Collar Rot on Italian Alder Trees in California Caused by Phytophthora siskiyouensis

In November 2006, trees of Italian alder (Alnus cordata) were observed declining in association with bleeding trunk cankers in a commercial landscape in Foster City, CA. A species of Phytophthora was isolated on PARP selective medium from the leading edge of the cankers. The Phytophthora species was homothallic with primarily paragynous antheridia and had oospores that were mostly globose and aplerotic. Sporangia were produced from mycelia on plugs of carrot piece agar in soil extraction solution and were semi-papillate and ovoid to ellipsoid in shape. The intergenic transcribed spacer region of rDNA from an alder isolate matched with 100% identity to isolates in GenBank of Phytophthora siskiyouensis, a recently described species associated with tanoak and found in the soil and waterways of coastal Oregon. Pathogenicity was tested on young alder trees growing in pots. Pathogenicity was confirmed on Italian alder trees and potential pathogenicity was demonstrated on red and white alder trees. Accepted for publication 11 March 2009. Published 13 April 2009.

Occurrence of Hibiscus chlorotic ringspot virus in Hibiscus spp. in New Zealand

Hibiscus spp. are popular ornamental plants in New Zealand. The genus is susceptible to Hibiscus chlorotic ringspot virus (HCRSV), a member of the genus Carmovirus, which has been reported in Australia, El Salvador, Singapore, the South Pacific Islands, Taiwan, Thailand, and the United States (1-4). In May of 2004, chlorotic spotting and ringspots were observed on the leaves of two H. rosa-sinensis plants in a home garden in Auckland, New Zealand. When inoculated with sap from symptomatic leaves, Chenopodium quinoa and C. amaranticolor developed faint chlorotic local lesions 12 to 15 days later. Phaseolus vulgaris exhibited small necrotic local spots 10 days postinoculation. No symptoms were observed on inoculated plants of Cucumis sativus, Gomphrena globosa, Nicotiana Clevelandii, N. tabacum, or N. sylvestris. Plants of H. rosa-sinensis and the three symptomatic indicator species tested positive for HCRSV using polyclonal antiserum (Agdia Inc., Elkhart, IN) in a double antibody sandwich (DAS)-ELISA. Forward (5'-GGAACCCGTCCTGTTACTTC-3') and reverse (5'-ATCACATCCACATCCCCTTC-3') primers were designed on the basis of a conserved region in the coat protein gene (nt 2722-3278) of HCRSV isolates in GenBank (Accession Nos. X86448 and DQ392986). A product of the expected size (557 bp) was amplified by reverse transcription (RT)-PCR with total RNA extracted from the four infected species. Comparison of the sequence of the amplicon from H. rosa-sinensis (GenBank Accession No. EU554660) with HCRSV isolates from Singapore and Taiwan (GenBank Accession Nos. X86448 and DQ392986) showed 99 and 94% nucleotide identity, respectively. From 2006 to 2008, samples from a further 25 symptomatic hibiscus plants were collected from different locations in the Auckland region. Nineteen, including plants of H. diversifolius, H. rosa-sinensis, and H. syriacus, tested positive for HCRSV by RT-PCR. To our knowledge, this is the first report of HCRSV in New Zealand and of the virus in H. diversifolius and H. syriacus. HCRSV is considered to be widespread in New Zealand.

First Report of Tomato chlorosis virus Infecting Tomato in Single and Mixed Infections with Tomato yellow leaf curl virus in Cuba

Whitefly-transmitted viruses have caused severe losses in tomato crops (Solanum lycopersicum) in Cuba. In 2006 and 2007, tomato greenhouses across eastern Cuba exhibited high levels of Bemisia tabaci (B biotype) infestation. Some plants showed interveinal chlorosis and a severe yellow mosaic, combined with leaf brittleness. These symptoms were different from those induced by Tomato yellow leaf curl virus (TYLCV-IL(CU)). Only 12 of 31 symptomatic samples resulted in positive PCR assays with TYLCV-specific primers (CTGAATGTTTGGATGGAAATGTGC and GCTCGTAAGTTTCCTCAACGGAC). A reverse transcription (RT)-PCR analysis for Tomato chlorosis virus (ToCV) with generic (HS-11/HS-12) and specific primers (ToC-5/ToC-6) was also carried out (2). Sequence analysis of the cloned RT-PCR products (463 bp) confirmed the presence of ToCV in Cuba. The fragment had 97 to 98% identity with GenBank isolates from Spain (DQ136146), Florida (AY903448), and Reunion Island, France (AJ968396). Cloned TYLCV and ToCV amplicons were used as probes to reanalyze the selected 31 samples by a dot-blot hybridization assay in search of mixed infections (1). The assay showed 16 samples to be positive for ToCV, 4 for TYLCV, 8 for both, and 3 samples were negative. To our knowledge, this is the first report of ToCV and TYLCV/ToCV mixed infections in Cuba.