Island-wide Survey Research Articles

Identification Of Rastrococcus Rubellus Williams (Hemipte Ra: Pseudococcidae) on Mango: A New Record to Sri Lanka

An island-wide survey of mealybugs (Hemiptera: Pseudococcidae) conducted in 2008/09 helped identify two species of Rastrococcus from Sri Lanka. R. invadens Williams was identified from samples collected on Plumeria sp. and Ficus arnottiana, while R. rubellus Williams was found on Plumeria sp. Although R. invadens has been recorded in Sri Lanka before, this is the first record of the oriental mealybug, R. rubellus , from the country. R. rubellus was found in mixed colonies with R. invadens; so far, the infesta-tions have not been associated with any severe crop losses. The survey revealed that R . rubellus is con-fined to a limited area in Colombo District. This restricted distribution suggested that it may be a new introduction to the country. Diagnostic characters to aid recognition of R. rubellus , and details of its distribution and host range within Sri Lanka are given. Tropical Agricultural Research and Extension 15(1): 2012: page 7-10 DOI: http://dx.doi.org/10.4038/tare.v15i2.5242

Children and Adolescents with Chronic Constipation: How Many Seek Healthcare and What Determines it?

This island-wide cross-sectional survey was conducted to assess the healthcare consultations in Sri Lankan children with constipation. Children aged 10-16 years were randomly selected from five randomly selected schools in three randomly selected provinces of Sri Lanka. Data were collected using a pre-tested questionnaire based on Rome III criteria. Of the 2770 questionnaires distributed, 2694 (97.3%) properly filled questionnaires were included in the analysis. From 416 (15.4%) children with chronic constipation, only 16 (3.8%) had sought medical advice during the previous 12 months. Younger children and those with a similar family history were more likely to seek healthcare. The majority of children with symptoms indicating severe constipation such as painful defecation, large volume stool, faecal incontinence and blood stained stools had not sought medical help for their symptoms. Parents should pay more attention to bowel habits of their children to identify and treat constipation early to prevent complications.

Spatial analysis of scrub typhus infection and its association with environmental and socioeconomic factors in Taiwan

We analyzed the spatial distribution of human cases of scrub typhus on the main island of Taiwan from 2003 to 2008 and implemented an island-wide survey of scrub typhus vectors (trombiculid chiggers) in 2007 and 2008. The standardized incidence rate ‘SIR’ incorporating inter-district variations in population, gender and age was correlated with environmental and socioeconomic variables. Higher incidence and SIR rates were clustered in the less developed, mountainous regions of central and eastern Taiwan. Higher SIRs were also associated with a higher proportion of dry-field farmers in the population, a higher normalized difference vegetation index (NDVI) and lower mean annual temperature, but was not associated with rainfall. Small mammal hosts in high-SIR districts harbored more chiggers and had higher rates of seropositivity against Orientia tsutsugamushi Hyashi, the etiologic agent of scrub typhus, compared to low-SIR districts. The concurrence of a higher proportion of dry-field farmers and higher NDVI has likely led to the clustering of scrub typhus in the mountainous regions of Taiwan. Further individual-level study of the risk factors associated with scrub typhus, and a better understanding of the effect of environmental factors on chigger abundance, should help to prevent scrub typhus in Taiwan.

First Report of Tomato yellow leaf curl virus in Tomato in Mauritius.

Tomato is a food crop of economic importance in Mauritius. It is grown in open fields and in greenhouses by more than 4,500 small- and large-scale growers throughout the island. Open-field tomatoes are mostly a cooking type, while those produced in greenhouses are salad types. Acreage under production is approximately 900 ha with an annual production of approximately 11,500 tons. In September 2009, plants with reduced leaf size, leaf curling, and yellow margins associated with plant dwarfism were observed in open-field tomato crops in the southern part of the island. Whitefly populations were observed in these fields. These symptoms were suggestive of infection with a leaf curl-causing begomovirus such as Tomato yellow leaf curl virus (TYLCV) (family Geminiviridae, genus Begomovirus). Similar symptoms caused by TYLCV were reported in neighboring Reunion Island in 1997 (1). In October 2009, 3.15 ha of tomato were surveyed in the south at la Flora, Camp diable, L'escalier, Plein Bois, and Plaine Magnien to monitor the disease. Symptomatic plants were observed in all areas surveyed and disease incidence ranged from 5 to 50%. The disease was more prevalent in tomato 'Swaraksha' and 'Epoch', which are widely cultivated. Seventeen symptomatic leaf samples from La flora, Camp Diable, L'escalier, Plein Bois, and Plaine Magnien areas were collected for begomovirus detection by PCR. Total DNA was extracted and tested using AV494 (5'-GCC YAT RTA YAG RAA GCC MAG-3') and AC1048 (5'-GGR TTD GAR GCA TGH GTA CAT G-3') primers from the core region of the coat protein that detect most begomoviruses (2). Seventeen of 17 samples (100%) gave an amplicon of expected size. PCR amplicons from selected samples were cloned and sequenced. The consensus sequence was assembled, and the sequence (GenBank Accession no. HM448447) had 100% identity with nucleotides 458 to 1,036 of the Almeria isolate (GenBank Accession no. AJ489258), an isolate from the Netherlands (FJ439569), Morocco (EF060196), and Spain (AJ519441), and nucleotides 451 to 1,029 of the RE4 isolate from Reunion Island (AM409201). On the basis of the initial sequence obtained, specific primers (RM-TYLCV 583C: 5'-CCA CGA GTA ACA TCA CTA ACA-3' and RM-TYLCV 895F: 5'-GGA ACA GGC ATT AGT TAA GAG-3') were designed to amplify the remainder of the genomic sequence by PCR followed by cloning and sequencing of the amplicons. At least three clones were sequenced to arrive at the consensus sequence. Sequence comparisons showed that the TYLCV isolate from Mauritius had the greatest sequence identity (95 to 100%) with the above isolates. To our knowledge, this is the first report of TYLCV in tomato in Mauritius. In view of the economic importance of leaf curl disease in tomato in many parts of the world, an island-wide survey needs to be carried out to monitor the disease and assess its impact on tomato production.

Detection and characterization of Citrus tristeza virus stem pitting isolates in Jamaica

An island wide survey for Citrus tristeza virus (CTV) in citrus orchards across Jamaica (13 regions) was conducted over 2 years. Trees (1, 885) showing virus-like symptoms as well as asymptomatic trees were randomly sampled for testing by ELISA and 55 samples from the 6 major citrus growing regions were graft inoculated on indicator plants. Most samples (74%) reacted to polyclonal antibodies against CTV in ELISA, while 20% were positive in tests using monoclonal antibodies specific to severe CTV strains. Samples collected from the 6 major citrus growing regions produced vein clearing and stem pitting symptoms on Mexican lime indicator plants (87%). In addition, stem pitting symptoms were induced on Duncan grapefruit, sweet orange, sour orange or sweet orange grafted on sour orange. Nucleotide sequencing of the coat protein gene sequences isolated from these samples indicated high identities (88 to 95.5%) among the Jamaican isolates and previously reported stem pitting strains from Central and North America and Eurasia (88 to 100%). The results suggest a shared ancestry with isolates from other geographical locations, rather than geographical speciation, and presumably separate CTV introductions into Jamaica.

First Report of Carrot red leaf virus and Carrot mottle virus, Causal Agents of Carrot Motley Dwarf, in Carrot in Mauritius.

Carrot motley dwarf (CMD) affects carrot and other apiaceous plants by causing leaf yellowing or reddening as well as plant stunting and leads often to serious economic losses wherever these crops are grown (2). CMD has been reported from Australia, Europe, Japan, Israel, and North America and is known to result from a mixed infection by at least two viruses, the polerovirus, Carrot red leaf virus (CtRLV), and one of the umbraviruses, Carrot mottle virus (CMoV) or Carrot mottle mimic virus (CMoMV). The viruses are transmitted in a circulative persistent manner by aphid species (Cavariella spp.). In November of 2008, symptoms typical of CMD were observed in carrot (Daucus carota) and coriander (Coriandrum sativum) plantations in the region of Henrietta in the central part of Mauritius. Carrot cultivars affected were Victoria, Sigma, and Namdhari. Incidences of up to 50% were recorded in some fields. Symptoms were observed mainly on plants near the edges of fields and were initially attributed to physiological factors. However, following RNA extraction from affected carrot plants and reverse transcription (RT)-PCR, fragments of the expected sizes (CtRLV; 377 bp: CMoV; 549 bp) were obtained. For CtRLV, a pair of degenerate primers (S2/AS3 [1]) for poleroviruses, and for the above mentioned umbraviruses, a universal primer pair (UmbraCS: CTTTGGAGTACACAACAACTCC and UmbraCAS: GCA/GTCIAGICCIACACAA/GACTGG, I = Inosin; unpublished) was used. Direct sequencing of one PCR product for each virus (Eurofins MWG Operon GmbH, Martinsried, Germany) and comparison with sequences retrieved from GenBank resulted in nucleotide and amino acid sequence identities of 93 and 90% (coat protein) to the CtRLV strain UK-1 (Accession No. AY695933) and 86 and 96% (replicase) to the German CMoV isolate (Accession No. FJ188473), respectively. Carrot samples also tested CtRLV-positive in triple-antibody sandwich-ELISA using polyclonal IgGs to CtRLV for trapping and a mixture of two CtRLV-specific monoclonal antibodies (CtRLV-2-3A9 and CtRLV 3-4B9) as detecting antibodies (all from the stock of the Julius Kuehn Institute; H. J. Vetten, Braunschweig, Germany). The presence of CMoV was confirmed by sap transmission to Nicotiana benthamiana and N. occidentalis 'P1', which resulted in vein yellowing/etching symptoms. In addition, agarose gel electrophoresis of the dsRNA extract of a primary infected carrot sample revealed major dsRNAs of approximately 4.2 and 1.4 kbp, which represent the genomic and subgenomic RNAs of an umbravirus. Thus, sequence analysis, as well as serological and biological data, demonstrates that CMD-affected carrot plants from Mauritius were infected with CtRLV and CMoV isolates closely related to those from Europe. The sequences obtained in this study for CtRLV and CMoV have been deposited in GenBank under Accession Nos. FJ969849 and FJ969848, respectively. To our knowledge, this is the first report of CMD in Mauritius and the Indian Ocean Region. Future works comprise an island wide survey across carrot-growing regions to determine the incidence of the virus complex and the natural host range of the viruses in Mauritius.

Community-associated Methicillin-resistant Staphylococcus aureus Disease in Children in Taiwan: The Importance of Antibiotic Stewardship

Since it was first reported in the 1960s, methicillinresistant Staphylococcus aureus (MRSA) has been a major cause of a variety of infectious syndromes in patients exposed to the healthcare environment.1 In Taiwan, MRSA was first documented in the early 1980s and increased rapidly in the 1990s.1 Nowadays, MRSA is endemic in most hospitals in Taiwan and accounts for 53–83% of all S. aureus isolates.1 However, from the late 1990s, community-associated (CA) MRSA has become a major concern worldwide.2 CA-MRSA causes a variety of diseases, ranging from skin or soft tissue infection to severe invasive diseases, such as sepsis, necrotizing pneumonia, and necrotizing fasciitis.1,2 CA-MRSA strains worldwide are thought to have unique microbiological characteristics such as limited antibiotic resistance (except to β-lactam antimicrobial agents), different exotoxin gene profiles (e.g. Panton–Valentine leukocidin; PVL), and smaller staphylococcal cassette chromosome mec (SCCmec) variants: either SCCmec type IV, or less frequently, type V or a variant, type VT. In Taiwan, CA-MRSA infections have been reported increasingly in pediatric patients since 2002. The rate of MRSA was estimated as 44% in pediatric cases of CA S. aureus infections, after pooling the data from retrospective studies with similar designs between 1997 and 2001.1 Currently, the CA-MRSA strains that cause infection in Taiwan are characterized by multiple antibiotic resistance (including clindamycin, erythromycin, tetracycline and chloramphenicol), which differs from those in the United States,4 with skin and superficial soft tissue infections being the major clinical manifestations. However, significant morbidity and mortality from CA-MRSA infections have been reported increasingly in pediatric cases.1,5 They have common pulsed-field gel electrophoresis (PFGE) patterns that differ from those of the major pandemic clones of hospitalacquired MRSA isolates. Also, the genotype has been identified as sequence type (ST) 59 by multilocus sequencing typing; they possess PVL and staphylococcal enterotoxin B and may have acquired SCCmec type VT (now designated type VII), or less frequently, type IV.4,6,7 The importance of antibiotic stewardship for CA-MRSA disease in Taiwan can be demonstrated in four different ways. Several previous community-based studies and the latest islandwide survey have assessed the extent of MRSA in the community, and have revealed a high prevalence of colonization with multidrug-resistant MRSA.3,6,8 Compared with that among healthy children during the period 2001–2002, the prevalence of nasal MRSA colonization among healthy

PATTERNS OF SEXUAL VULNERABILITY AMONG ADOLESCENTS AND YOUTHS IN SRI LANKA

To elucidate the level of sexual awareness, behaviour and vulnerability experienced by adolescents and youths in Sri Lanka, data were collected from an island-wide survey of 4004 unmarried and married persons aged 10–24. Most 10–14-year-olds do not possess sufficient knowledge on sexual behaviour, or hesitate to acknowledge it due to prevailing cultural barriers. Females show less knowledge on sexual behaviour, while those in the estate sector indicate the lowest awareness. Respondents aged 15–17 did not report a sound knowledge on sexuality. Of the unmarried urban males aged 18–24, nearly half believed that their peers had already experienced sexual intercourse, while the corresponding proportion of females was only 19 per cent. These estimates are significantly higher than the figures reported for the 15–17 age group of urban males (31 per cent) and females (12 per cent). Among those who had premarital sex, the majority had it with their lover; nevertheless, a substantial proportion of adolescents and youths may be vulnerable to contracting sexually transmitted infection (STI), including HIV/AIDS as they had potentially high-risk persons as sex partners. Comprehensive awareness programmes on sexual health are needed in order to lower their vulnerability.

Precolumbian Settlements on Carriacou, West Indies

The first systematic archaeological investigation of Precolumbian sites on the island of Carriacou in the West Indies provides a rich source of information regarding Amerindian settlement in the southern Caribbean. Herein, we report results from an island-wide survey and subsequent excavation at two large village sites—Grand Bay and Sabazan—that provide evidence for an intensive late Ceramic Age occupation dating between CAL. A.D. 400–1200. Results from four seasons of excavation at Grand Bay and two at Sabazan indicate that inhabitants colonized the island later than larger nearby islands (although an earlier settlement is possible); were engaged in inter-island and South American interactions as evidenced through analysis of pottery, stylistic artifacts, and faunal remains; exploited a variety of marine and terrestrial foods, including several animals rarely found in the Antilles that were translocated to the island from elsewhere; and buried their dead in and around shell middens and, at least once, under a habitable structure.

A long-term study (1949-2005) of experimental introductions to an island; freshwater amphipods (Crustacea) in the Isle of Man (British Isles)

Aim Using data from field introduction experiments with Gammarus spp. conducted in the rivers of a small island, commencing in 1949, with resampling in the 60s, 70s, 80s, 90s and finally in 2005, we aimed to examine the long-term interaction of the native freshwater amphipod Gammarus duebeni celticus with the introduced G. pulex. Using physico-chemical data from a 2005 island-wide survey, we also aimed to find what environmental factors could influence the distribution of the two species. Location The Isle of Man, British Isles. Methods We used species distribution data from 10 river sites from a field introduction study in 1949–69, resampling of these sites in 1974/5, 1988, 1995 and 2005. We sampled a further 82 sites in 2005, where physico-chemical characteristics of each site were obtained. ANOVA was used to ascertain significant differences in environmental variables between native and introduced amphipod assemblages. Multiple discriminant analysis was used to relate Gammarus distribution to environmental gradients in rivers. Results Field introductions of G. pulex into previously G. d. celticus dominated sites failed, despite the large propagule pressure in terms of numbers of individuals released and repeated introductions. The island-wide survey revealed that G. d. celticus was found in areas of higher water quality than G. pulex. Sites where the two species co-occurred also tended to be of lower water quality than native only sites. Continuing metal pollution from past mining activity may be a major factor excluding all amphipods from many rivers. The North American amphipod Crangonyx pseudogracilis, which was first discovered on the Isle of Man in one river site in 1995, was found in a further five sites. Main conclusions This ecological experiment, through long-term monitoring, thus continues to elucidate factors influencing the distributions of introduced and native species. Under some physicochemical regimes, G. d. celticus is able to withstand its usual displacement by G. pulex, whereas increased river pollution could promote replacement of the native by the introduced species.

Population census of Cook's Petrel Pterodroma cookii breeding on Codfish Island (New Zealand) and the global conservation status of the species

SummaryCodfish Island is the southernmost breeding location for Cook's Petrel (Pterodroma cookii), endemic to the New Zealand archipelago. To provide a population estimate and indication of population growth following introduced predator eradications we conducted an island-wide survey of Codfish Island within two a priori defined strata. Plot surveys revealed only five burrows within forest habitats from 175 plots surveyed and the locations of these and other burrows observed incidentally were used to identify three key areas of Cook's Petrel breeding activity that were subsequently surveyed using line transects. Within these areas, 42 burrows were counted with burrow densities ranging from 0.0003 to 0.002 burrows m−2. Burrow densities in conjunction with the three-dimensional surface areas of the surveyed locations suggested a minimum of 6,194 ± 956 burrows present and equated to approximately 5,000 (95% CI 3,000–6,000) breeding pairs, using a burrow occupancy estimate of 80%. The Cook's Petrel population on Codfish Island appears to have increased markedly since Weka (Gallirallis australis ) and Pacific Rat (Rattus exulans) were eradicated in 1980 and 1998 and is consistent with a recent upwards revision of the species' world population size of approximately 1,300,000 (900,000–1,800,000) individuals. Revised population data, and ongoing protection of Cook's Petrel's major breeding sites may now qualify the species for a revised conservation status moving from Endangered to Vulnerable under IUCN criteria.

Molecular and field analyses of the fortuitous establishment of Lipolexis oregmae (Hymenoptera: Aphidiidae) in Jamaica as a natural enemy of the brown citrus aphid

The brown citrus aphid, Toxoptera citricida (Kirkaldy), is a serious pest of citrus because it efficiently transmits citrus tristeza closterovirus (CTV). The invasion of Jamaica's citrus by T. citricida resulted in serious economic losses and the importation and consideration was given to the establishment of Lipolexis oregmae Gahan (Hymenoptera: Aphidiidae) in a classical biological control program. Prior to introducing L. oregmae, we conducted a survey to determine the abundance of Lysiphlebus testaceipes Cresson (Hymenoptera: Aphidiidae) in T. citricida. A high-fidelity PCR analysis was conducted using Lysiphlebus- and Lipolexis-specific ITS2 rRNA primers on alcohol-preserved brown citrus aphids and the results were positive for both parasitoids. The fortuitous establishment of L. oregmae in Jamaica was surprising, and was confirmed by rearing adults from parasitized aphids and obtaining taxonomic confirmation based on morphology. In addition, its identity was confirmed molecularly by cloning and sequencing 16S, 12S, and COI sequences from the Florida colony of L. oregmae and from Jamaican specimens. The three DNA sequences were 100% identical for specimens from both sources. The phylogenetic analysis using 16S sequences indicated a close relationship of the Florida and Jamaica populations of L. oregmae with L. gracilis. During 2005, an island-wide survey of citrus in six parishes confirmed that both L. testaceipes and L. oregmae commonly parasitize T. citricida, but that L. oregmae was the more widely distributed and abundant parasitoid. The pathway by which L. oregmae might have entered Jamaica is discussed.

Breeding habitat of the Cook's Petrel (Pterodroma cookii) on Little Barrier Island (Hauturu): implications for the conservation of a New Zealand endemic

Cook's Petrel (Pterodroma cookii), a trans-equatorial migrant endemic to the New Zealand archipelago, is today endangered and restricted to island habitats at the northern and southern extents of its former range. To improve the limited knowledge of the breeding habitat of this species, we combined an island-wide survey, the mapping capabilities of geographic information systems, and logistic and autologistic analyses to examine burrow distribution and habitat use of the world's largest population of Cook's Petrel, on Little Barrier Island (Hauturu). Our results show that, on this island, Cook's Petrel breeds predominantly above 300 m above sea level, on steeper slopes, closer to ridge tops, and in unmodified forest habitats with low and open canopies and greater numbers of large stems compared to the available terrain and habitat. Within these habitats above 300 m, densities of burrows are 0.04 burrows m−2. Through comparisons with habitat data from two low-altitude colonies, we conclude that the current distribution of this population is a result of habitat selection and historical human-mediated impacts. We suggest that mature forest habitats, close proximity to ridge tops, and steep slopes are key habitat requirements for this species. A large amount of suitable habitat is available for Cook's Petrel on Little Barrier Island and the recent removal of introduced predators is expected to result in an expansion of this population. The results of the current study provide useful information to aid in the restoration of former colony sites on other islands and the New Zealand mainland.

Blood lead levels of Jamaican children island-wide

An island-wide survey of 1081 basic school children, mainly in the age group 2-6 years, is reported. The range of blood lead levels (BLLs) was 1.4 to 202 microg/dL with arithmetic and geometric means of 7.3 microg/dL (standard deviation, 13 microg/dL) and 4.35 microg/dL respectively. Two hundred and thirty children were identified with blood lead levels above 10 microg/dL and among these, 80 were provided with medical attention and of eleven who received chelation, six children were desperately ill from acute lead poisoning necessitating repeated sessions of chelation therapy. The higher blood lead values were found mainly in poor areas of the urban Kingston and St. Andrew Corporate Area, and in St. Catherine where there remain observable though reduced effects from a lead-contaminated area. Environmental interventions, including building an increased national awareness, have also been carried out to reduce the immediate and future dangers of lead poisoning. The most important source of the lead exposure is the recovery of lead from old automobile batteries and even a quite small smelter can contaminate a significant area. Further work is in progress to identify and examine historical and active smelter sites, their possible effects on childhood health, and their remediation.

Coastal Pollution and Potential Biomonitors of Metals in Mauritius

Contaminant metals are potentially toxic, accumulate in the sediment, are bioconcentrated by organisms and may cause health problems to humans via the food chain. Discharge of industrial wastewaters and untreated sewage pose a particularly serious threat to the coastal environment of Mauritius, but very little information exists on contaminant metals. This study aimed principally to assess such contamination by (i) reviewing available data, (ii) examining the results of metal (Cd, Cu, Cr, Pb and Zn) analysis in (a) seawater, sediment and biota from an island-wide survey of 20 sites in 1999–2000, (b) seawater from a water quality survey (high tide and low tide) in 2003 of a 10 km stretch of sewage-impacted coast.

The endemic Bawean Serpent-eagle Spilornis baweanus: habitat use, abundance and conservation

The Bawean Serpent-eagle Spilornis baweanus is endemic to the 190 km2 island of Bawean in the Java Sea (Indonesia) where it is the only resident diurnal raptor. A 15 day study in 2002 revealed that the species is present in small numbers throughout the island. The eagle's abundance was assessed by an island-wide survey and by sampling 28 1 km2 plots covering five habitat types. There was a strong positive correlation between abundance and contact time in plots. Compared with other habitat types, the number of, and contact time with, serpent-eagles was higher in tall forest. The species was not recorded in mangrove and coastal forest. There was no correlation between the eagle's abundance and the nearest distance to villages. Based on the distribution of forest and the abundance of adult pairs within these forests, the available habitat totals 92 km2, in which some 60–75 adult serpent-eagles remain. Semi-structured interviews with the islanders revealed that recreational hunting poses the largest threat to the survival of the Bawean Serpent-eagle, and that the increase in recreational hunting was a relatively recent phenomenon. The forest on Bawean, including that in two reserves, is poorly protected and illegal logging and burning are widespread. The low degree of habitat protection, the severe threat posed by hunting and the very small population size of the eagle qualify the species to be included in the IUCN Red List as Critically Endangered. In order to safeguard the Bawean Serpent-eagle hunting must be stopped immediately and the remaining habitat needs to be better protected. This is probably best achieved by a conservation body in which local and regional authorities and NGOs cooperate.

Examining the Scalability of Intimacy Permissiveness in Taiwan

This paper examines the scalability of intimacy permissiveness measures in Taiwan by using island-wide survey data. Among models for scaling analysis, the Guttman scaling model and two latent class models – the latent-distance model and Goodman’s scale model – were employed to examine the scalability of the scale measures. The data were drawn from the 2002 Taiwan Social Change Survey (Questionnaire No. 2), conducted by Academia Sinica. A total of 1983 completed interviews were obtained. This study found that the measures of intimacy permissiveness scale (IPS) were able to form a reasonable Guttman-type scale based on three scaling models. In order to understand whether the attitudinal patterns of Taiwanese toward premarital intimacy permissiveness, particularly the existence of sexual double standards, are consistent with those suggested by the previous literature, we conducted multinomial logistic regression of socio-demographic variables on the scale. Gender and age differences were found consistent with previous studies and mostly reconfirmed the appropriateness of the measures of IPS designed for the Taiwan Social Change Survey.

Education participation in Sri Lanka—Why all are not in school

Despite Sri Lanka's 1990 commitment to provide 10–11 years of free education to all, only 93% of children in the 5–14-year-old age group were in school by the year 2000. Moreover, the education participation rates are not equitable across the country, varying by socio-economic groups. This paper examines the determinants of school non-participation of 5–14-year olds in Sri Lanka using household, community and school-level information obtained from an island-wide survey. The study finds that demand side problems such as poverty, direct and indirect costs of schooling, and cultural factors as well as supply side shortcomings such as quality of education seem to affect schooling behavior of children. Policies facilitating compulsory education in the country at present gives prominence to awareness building, monitoring and improvements in education delivery. The results show that these efforts need to be complemented by other supply side improvements and income transfer measures, especially for the poorest, to achieve universal school attendance.

The influence of early conditions on health status among elderly Puerto Ricans

The demographic origins of aging in Puerto Rican and other Latin American and Caribbean (LAC) countries may have important implications for the profile of health status and mortality of elderly people. For this article we tested a general conjecture about the relation between early childhood conditions and adult health status among Puerto Rican elderly using a rich data set recently collected through an island-wide survey (N = 4,293). We examined the association between markers of early nutritional status, self-reports of health and on socioeconomic conditions during early childhood, and the prevalence of 3 conditions during adult ages: obesity, diabetes, and cardiovascular diseases. Although we found that obesity and diabetes are associated with markers of early malnutrition, that heart disease is associated with early deprivations and selected early childhood conditions, the evidence we were able to tease out from the data provides only fragile support for the conjecture.

Population trends of Mariana Crow Corvus kubaryi on Rota, Commonwealth of the Northern Mariana Islands

Endemic to the islands of Guam and Rota in the Mariana Islands, Mariana Crow Corvus kubaryi is the only corvid in Micronesia. Currently, it survives on Guam only because of translocation of individuals from Rota (1999–2003). Island-wide surveys in 1982 and 1995 on Rota yielded population estimates of 1,348 and 592 respectively, indicating a 56% decrease in only 13 years. A sharp decline in the only viable Mariana Crow population has serious implications for conservation efforts on Rota and for efforts to re-establish the Guam population. However, the validity of the apparent decline has been debated among scientists and government management agencies. We augmented the 1982 and 1995 island-wide VCP surveys with (1) an additional island-wide survey conducted in 1998, and (2) roadside surveys conducted during 1991–1993 and again during 1999–2002. We also outline historical changes in Rota's limestone forest based on aerial photographs and historical information. Data from all surveys indicate a significant decline in the Mariana Crow population. Declines occurred especially along the north-central coast and in the area east of the airport known as As Dudo in the 1990s, but the data indicate an island-wide decline over the entire span of the surveys. Introduced predators, human persecution, and habitat loss and degradation by anthropogenic and natural causes have all contributed to the decline. Long-term preservation of this species will require effective brown treesnake Boiga irregularis control, habitat protection, continued monitoring and research, and increased public education and awareness of Rota's rare and endangered species.