Iris Yellow Spot Virus Research Articles

Population dynamics of iris yellow spot virus in onion fields and lisianthus greenhouses in Japan

Iris yellow spot virus (IYSV, genus Tospovirus) mainly occurs on onion and lisianthus plants (Eustoma grandiflorum) in Japan. The virus is genetically diverse and is classified based on its nucleocapsid protein sequence into two genotypes, IYSVNL (NL) and IYSVBR (BR), first isolated in the Netherlands and Brazil, respectively. Both genotypes are present in Japan, and they are sometimes found in the same field. Furthermore, the two genotypes are occasionally detected in a single necrotic lesion of an infected plant (designated as a ‘mosaic’ genotype). In this study, the population structures of these two genotypes and their dynamics in onion fields and lisianthus greenhouses from 2004 to 2006 were analysed using reverse transcription-PCR-restriction length polymorphism analysis (RT-PCR-RFLP). In onion fields the two genotypes were detected in all three years, and the BR genotype predominated within a year. On the other hand, both genotypes were detected at the first outbreak each year in almost all lisianthus greenhouses; however, the BR genotype was more widespread than the NL genotype. These results suggest that the incidence of IYSV disease in lisianthus during each year was triggered by the invasion of viruliferous Thrips tabaci that have acquired one or both genotypes from nearby onion fields. Although the BR genotype predominated in the last stages of cultivation, IYSV disease might be expanded by monocyclic patterns but may occasionally spread secondarily in lisianthus greenhouses.

Iris yellow spot virus (Tospovirus: Bunyaviridae): from obscurity to research priority.

Iris yellow spot virus (IYSV) is in the genus Tospovirus, family Bunyaviridae, with a single-stranded, tri-segmented RNA genome with an ambisense genome organization. Members of the other genera in the family infect predominantly vertebrates and insects. IYSV is present in most Allium-growing regions of the world. Virions are pleomorphic particles of 80-120 nm in size. The particle consists of RNA, protein, glycoprotein and lipids. IYSV shares the genomic features of other tospoviruses: a segmented RNA genome of three RNAs, referred to as large (L), medium (M) and small (S). The L RNA codes for the RNA-dependent RNA polymerase (RdRp) in negative sense. The M RNA uses an ambisense coding strategy and codes for the precursor for the GN /GC glycoprotein in the viral complementary (vc) sense and a non-structural protein (NSm) in the viral (v) sense. The S RNA also uses an ambisense coding strategy with the coat protein (N) in vc sense and a non-structural protein (NSs) in the v sense. The virus is transmitted by Thrips tabaci Lindeman (Order: Thysanoptera; Family: Thripidae; onion thrips) and with less efficiency by Frankliniella fusca Hinds (tobacco thrips). HOST: IYSV has a relatively broad host range, including cultivated and wild onions, garlic, chives, leeks and several ornamentals. Some weeds are naturally infected by IYSV and may serve as alternative hosts for the virus. IYSV symptoms in Allium spp. are yellow- to straw-coloured, diamond-shaped lesions on leaves and flowering scapes. Diamond-shaped lesions are particularly pronounced on scapes. As the disease progresses, the lesions coalesce, leading to lodging of the scapes. In seed crops, this could lead to a reduction in yield and quality. Early to mid-season infection in bulb crops results in reduced vigour and bulb size. Resistant varieties are not available, but a limited number of accessions with field tolerance have been identified. Integrated disease management tactics, including sanitation, crop rotation, thrips management, maintenance of optimal plant vigour, soil fertility, irrigation and physical separation of bulb and seed crops, can mitigate the effect of the disease. Virus code: 00.011.0.85.009 Useful link: http://www.alliumnet.com/.

Development of a PCR Diagnostic System for Iris yellow spot tospovirus in Quarantine.

Iris yellow spot virus (IYSV) is a plant pathogenic virus which has been reported to continuously occur in onion bulbs, allium field crops, seed crops, lisianthus, and irises. In South Korea, IYSV is a “controlled” virus that has not been reported, and inspection is performed when crops of the genus Iris are imported into South Korea. In this study, reverse-transcription polymerase chain reaction (RT-PCR) and nested PCR inspection methods, which can detect IYSV, from imported crops of the genus Iris at quarantine sites, were developed. In addition, a modified positive plasmid, which can be used as a positive control during inspection, was developed. This modified plasmid can facilitate a more accurate inspection by enabling the examination of a laboratory contamination in an inspection system. The inspection methods that were developed in this study are expected to contribute, through the prompt and accurate inspection of IYSV at quarantine sites to the plant quarantine in South Korea.

Thrips tabaci(Thysanoptera: Thripidae) andIris yellow spot virusAssociated with Onion Transplants, Onion Volunteers, and Weeds in Colorado

Abstract. Infestation by onion thrips, Thrips tabaci Lindeman, was determined on transplants of onion (Allium cepa L.) received in Colorado during March and April from out-of-state sources (Imperial Valley, CA; near Phoenix, AZ; and southern Texas) during 2004 to 2008. In the 5 years of the study, 50 to 100% of the transplant lots sampled arrived infested with thrips. Among infested transplant lots, the overall number of thrips averaged 0.15 to 0.63 per plant, with as many as four per plant in some lots. T. tabaci was the dominant thrips species in all seasons and locations of transplant origin. In addition, 19 of 83 (23%) tested lots had plants positive for Iris yellow spot virus. Iris yellow spot virus and T. tabaci were detected in volunteer onion plants as early as 1 May, a few weeks after the summer onion crop was planted, suggesting a possible role of infected volunteer plants in perennation of the virus between onion crops. Iris yellow spot virus and T. tabaci were detected in many common weeds inc...

Occurrence of iris yellow spot virus from onion crops in Egypt.

Iris yellow spot virus (IYSV) is a infects onion bulb and seed crops in many countries including Egypt. Results of the mechanical inoculation reveled that, small chlorotic lesions and systemic necrosis were observed on both Nicotiana benthamiana and Datura stramonium after 10days, while there were no symptoms were appeared on the onion plant. The viral biological transmission with Thrips tabaci was highly reported to be efficiently for virus transmitted. Our results confirmed the presentence of virus-like particles of a Tospovirus infected onion leaf using transmission electron microscopy. Both of sequence and phylogenetic analysis of N gene revealed that our viral isolate is IYSV with 95% identity with reported Israel isolate. The sequence of N gene had three motifs: casein kinase II Phosphorylation site, N-myristoylation site and protein kinase C phosphorylation site. These motifs are involved in regulation, activity and stability of IYSV. To our knowledge, this is the first molecular characterization of IYSV in Egypt.

Virové patogeny mečíků, kosatců a tulipánů v České republice

The occurrence of Bean yellow mosaic virus (BYMV), Cucumber mosaic virus (CMV) Tobacco rattle virus (TRV) in gladiolus, iris, tulip and Iris yellow spot virus (IYSV) in iris was investigated by examining the plants by the means of serological techniques (ELISA). ELISA was applied to determine the presence of BYMV, CMV, TRV infections in both aerial and underground parts of gladiolus, iris, and tulip, and IYSV on the aerial parts of iris, respectively. 262 gladiolus plants were tested. 63.7% was infected by BYMV, 29.4 % by CMV, and 2.7 % by TRV. Out of 180 plants of iris, 1.1% was infected by BYMV, 6.7% by CMV, 2.8% by TRV, and 0% by IYSV. Out of 28 plants of tulip, 28.6% was infected by CMV, and 7.1% by TRV. ELISA proved to be a suitable method for detection of viruses in leaves of these ornamental plants, but it often failed to detect viruses in flowers and corms. A high transmission of BYMV by gladiolus cormlets was also found.

First Report of Iris yellow spot virus Infecting Allium tuberosum in India.

Allium tuberosum L., commonly known as garlic chives, is an important spice in northeastern India as well as in many other parts of the world. Iris yellow spot virus (IYSV; genus Tospovirus, family Bunyaviridae) is an important pathogen of onion (4) and other related Alliums such as garlic (3) and leek (2). During April 2013, symptoms potentially induced by IYSV such as chlorotic and straw-colored spindle-like lesions were observed on leaves of A. tuberosum accession Hanzong Winter (CGN 20779) plants in the wild species garden at the Directorate of Onion and Garlic Research (DOGR), Rajgurunagar, Pune, Maharashtra, India. Ten plant samples of A. tuberosum were randomly collected from the wild species garden and the upper, middle, and lower portions of the leaves were pooled and tested by double-antibody sandwich (DAS)-ELISA using a commercially available kit (Agdia Inc., Elkhart, IN) for IYSV. All of them showed positive results for IYSV incidence. Total RNA from the ELISA positive leaf samples of A. tuberosum was extracted using the RNeasy Plant Mini kit (Qiagen GmbH, Hilden, Germany). The primer pair IYSV-F (5'-TCAGAAATCGAGAAACTT-3') and IYSV-R (5'-TAATTATATCTATCTTTCTTGG-3') (1) was used for RT-PCR. The primer pair was specific to amplify 797 bp of the nucleocapsid (N) gene of IYSV. The amplified product derived from A. tuberosum isolate was purified by QIAquick PCR Purification Kit (Qiagen) and cloned using the vector pDrive (Qiagen). The recombinant clone was sequenced (Accession No. KF624624). Sequence analysis performed on CLC Main Workbench Version 6.8.4 confirmed that the fragment was of IYSV. Nucleotide sequence comparison of our virus with other IYSV isolates revealed that the highest nucleotide identity (99%) was with the IYSV garlic isolate (HM173691) from India. Further, maximum 96% protein identity was with IYSV onion isolate (ACA09432) and garlic isolate (ADK56108) from India. To our knowledge, this is the first report of IYSV naturally occurring on A. tuberosum in India. It is evident from previous studies that IYSV causes significant losses in onions (1) and from this study, that its symptoms have direct impact on quality of garlic chives. Further detailed studies are required to assess the magnitude of the impact of IYSV infection on yield and quality of A. tuberosum.

VIRUS FITOPATÓGENOS EN INSECTOS ASOCIADOS AL AJO

Vegetative propagation of garlic (Allium sativum) is the main route of virus transmission for this crop. However, insectvector spread should not be ruled out. The aim of this study was to detect, by means of the ELISA test, the presence of five viruses in insects collected in garlic plants. The experiment was conducted during the fall-winter (2008-2009) cycle. Insect samples were taken on three dates: 45, 110 and 140 days after garlic sowing. Insect species identification was performed using a Zeiss (30X) stereomicroscope and the O’Brien and Wilson (1985) and Mound and Kibby (1998) taxonomy keys. The serology test for virus detection was the DAS-ELISA technique. Coat-protein virus antibodies were applied for the potyviruses: Leek yellow spot virus (LYSV) and Onion yellow dwarf virus (OYDV); for the carlaviruses: Garlic common latent virus (GCLV) and Shallot latent virus (SLV); and for the tospovirus: Iris yellow spot virus (IYSV). Of the 19 insect species identified, Thrips tabaci Lindeman tested positive in 18 samples for GCLV and in 2 samples for IYSV, and Collops quadrimaculatus tested positive in one sample for GCLV.

Global analysis of population structure, spatial and temporal dynamics of genetic diversity, and evolutionary lineages of Iris yellow spot virus (Tospovirus: Bunyaviridae).

Thrips-transmitted Iris yellow spot virus is an economically important viral pathogen of Allium crops worldwide. A global analysis of known IYSV nucleocapsid gene (N gene) sequences was carried out to determine the comparative population structure, spatial and temporal dynamics with reference to its genetic diversity and evolution. A total of 98 complete N gene sequences (including 8 sequences reported in this study) available in GenBank and reported from 23 countries were characterized by in-silico RFLP analysis. Based on RFLP, 94% of the isolates could be grouped into NL or BR types while the rest belonged to neither group. The relative proportion of NL and BR types was 46% and 48%, respectively. A temporal shift in the IYSV genotypes with a greater incremental incidence of IYSVBR was found over IYSVNL before 2005 compared to after 2005. The virus population had at least one evolutionarily significant recombination event, involving IYSVBR and IYSVNL. Codon substitution studies did not identify any significant differences among the genotypes of IYSV. However, N gene codons were minimally positively selected, moderately negatively selected denoting the action of purifying selection, thus rejecting the theory of neutral mutation in IYSV population. However, one codon position (139) was found to be positively selected in all the genotypes. Population selection statistics in the IYSVBR, IYSVNL genotypes and in the population as a whole also revealed the action of purifying selection or population expansion, whereas IYSVother displayed a decrease in population size. Genetic differentiation studies showed inherent differentiation and infrequent gene flow between IYSVBR and IYSVNL genotypes corroborating the geographical confinement of these genotypes. Taken together the study suggests that the observed diversity in IYSV population and temporal shift in IYSVBR genotype is attributable to genetic recombination, abundance of purifying selection, insignificant positive selection and population expansion. Restricted gene flow between the two major IYSV genotypes further emphasizes the role of genetic drift in modeling the population architecture, evolutionary lineage and epidemiology of IYSV.

Onion Thrips (Thysanoptera: Thripidae) and Their Management in the Treasure Valley of the Pacific Northwest

Onion thrips, Thrips tabaci Lindeman and thrips-transmitted Iris yellow spot virus are the most significant pest complex affecting onion production in the Treasure Valley of eastern Oregon and southwestern Idaho. Thrips feeding damage and virus infection significantly reduce onion bulb size and economic returns for this high value crop. The high concentration of onion fields in the Treasure Valley and the long, hot, dry growing season present a number of challenges for managing onion thrips and Iris yellow spot virus (IYSV). Insecticides are the primary tool that growers have to manage this pest complex. With the long growing season, growers need to exercise good insecticide resistance management programs to maintain the effectiveness of currently available insecticides. To do this, growers need to rotate among available products and use as few applications as practical. A challenge for researchers is to determine not only which insecticides are effective but also to determine when during the season different products may be most effectively used. Techniques for analyzing field trial data are discussed, including comparing changes in pest populations before and after various insecticide applications are made. These comparisons can be made through the use of linear estimates and contrasts as part of analyses of variance, and they can aid in determining efficacy of different treatments by accounting for pre-application populations. These techniques will help researchers in developing sound sequence of insecticide applications for onion thrips management.

Evaluation of Onion Germplasm for Resistance to Iris Yellow Spot (Iris yellow spot virus) and Onion Thrips,Thrips tabaci

Abstract. Onion (Allium cepa L.) is the most economically important monocot besides grasses. The crop suffers severe damage from onion thrips, Thrips tabaci Lindeman, a cosmopolitan and polyphagous insect pest. In addition to causing direct feeding damage, onion thrips is the principal vector of the economically important Iris yellow spot virus (Tospovirus sp., family Bunyaviridae). Any attempt to manage this pathosystem will require a multifaceted approach based on integrated pest management. Host plant resistance is an important foundation to the success of such approaches. A multi-state, multi-disciplinary research project was established to identify, validate, and deliver resistance to this pathosystem for use by the onion industry. As part of the project, diverse onion plant introduction (PI) accessions from the USDA germplasm collection, advanced breeding lines, and commercial cultivars were evaluated from 2009 through 2011 in fields in Colorado. Sixteen, 15, and 10 better performing onion genotypes...

Resistance to Iris yellow spot virus and onion thrips among onion varieties grown in Kenya

Iris yellow spot virus (IYSV) vectored by Thrips tabaci threatens profitable onion production in eastern Africa. Host plant resistance is considered to be the first line of defence against insect-transmitted virus diseases. Hence, information on resistance to IYSV and T. tabaci among common onion cultivars in Kenya is crucial for the development of integrated pest management strategies. This study evaluated the resistance to thrips and IYSV among widely grown onion cultivars in Kenya, viz. Red Pinoy, Red Creole, Bombay Red, Green Bunching and Texas Grano, over two growing seasons. Straw-coloured, diamond-shaped necrotic lesions typical of IYSV infection were observed 2 weeks after transplantation. Observations on thrips numbers per plant, IYSV disease incidence and severity, and virus intensity were undertaken to assess the resistance. Varieties differed significantly with respect to both IYSV disease incidence and thrips numbers per plant from fourth week to physiological maturity. Red Pinoy, Green Bunching and Red Creole were highly susceptible to the virus and thrips, while Texas Grano and Bombay Red were moderately resistant. There were significant differences among the varieties with regard to IYSV intensity, with the highest and the least virus intensity positively correlated with disease severity being recorded in Red Pinoy and Texas Grano, respectively. Among the varieties, Texas Grano produced the highest yield in both seasons, while Red Pinoy produced the least. Hence, Texas Grano and Bombay Red could be recommended as moderately resistant cultivars to thrips and IYSV to be grown in Kenya for markets where pungency is not preferred and preferred, respectively. Regions with high levels of thrips population and IYSV infestation are not suitable for the cultivation of Red Pinoy.

Broad-spectrum transgenic resistance against distinct tospovirus species at the genus level.

Thrips-borne tospoviruses cause severe damage to crops worldwide. In this investigation, tobacco lines transgenic for individual WLm constructs containing the conserved motifs of the L RNA-encoded RNA-dependent RNA polymerase (L) gene of Watermelon silver mottle virus (WSMoV) were generated by Agrobacterium-mediated transformation. The WLm constructs included: (i) translatable WLm in a sense orientation; (ii) untranslatable WLmt with two stop codons; (iii) untranslatable WLmts with stop codons and a frame-shift; (iv) untranslatable antisense WLmA; and (v) WLmhp with an untranslatable inverted repeat of WLm containing the tospoviral S RNA 3′-terminal consensus sequence (5′-ATTGCTCT-3′) and an NcoI site as a linker to generate a double-stranded hairpin transcript. A total of 46.7–70.0% transgenic tobacco lines derived from individual constructs showed resistance to the homologous WSMoV; 35.7–100% plants of these different WSMoV-resistant lines exhibited broad-spectrum resistance against four other serologically unrelated tospoviruses Tomato spotted wilt virus, Groundnut yellow spot virus, Impatiens necrotic spot virus and Groundnut chlorotic fan-spot virus. The selected transgenic tobacco lines also exhibited broad-spectrum resistance against five additional tospoviruses from WSMoV and Iris yellow spot virus clades, but not against RNA viruses from other genera. Northern analyses indicated that the broad-spectrum resistance is mediated by RNA silencing. To validate the L conserved region resistance in vegetable crops, the constructs were also used to generate transgenic tomato lines, which also showed effective resistance against WSMoV and other tospoviruses. Thus, our approach of using the conserved motifs of tospoviral L gene as a transgene generates broad-spectrum resistance against tospoviruses at the genus level.

Iris yellow spot virus. [Distribution map

Abstract A new distribution map is provided for Iris yellow spot virus. Bunyaviridae: Tospovirus. Hosts: Onion ( Allium cepa ), Dutch iris ( Iris hollandica ), leek ( Allium porrum ) and garlic ( Allium sativum ). Information is given on the geographical distribution in Europe (Austria, Bosnia-Hercegovina, France, Germany, Greece, Italy, Netherlands, Serbia, Slovenia, Spain, UK, England and Wales), Asia (India, Gujarat, Karnataka, Madhya Pradesh, Maharashtra, Tamil Nadu, Uttar Pradesh, Indonesia, Java, Iran, Israel, Japan, Honshu, Kyushu, Pakistan, Sri Lanka and Tajikistan), Africa (Egypt, Kenya, Mauritius, Reunion, South Africa and Uganda), North America (Canada, Ontario, Mexico, USA, Arizona, California, Colorado, Georgia, Hawaii, Idaho, Michigan, Nevada, New Mexico, New York, Oregon, Pennsylvania, Texas, Utah and Washington), Central America and Caribbean (Guatemala), South America (Brazil, Pernambuco, Sao Paulo, Chile, Peru and Uruguay) and Oceania (Australia, New South Wales, Victoria, Western Australia and New Zealand).

IRIS YELLOW SPOT VIRUS IN SPAIN: INCIDENCE, EPIDEMIOLOGY AND YIELD EFFECT ON ONION CROPS

Iris yellow spot virus (IYSV) is an emerging pathogen of onion and other Allium crops worldwide. This study focused on the incidence, epidemiology and yield effects of IYSV in bulb onion crops in Spain. Surveys were conducted from 2005 to 2009. Samplings were performed in 101 onion fields with 2,677 onion plants tested in total. Onion transplants, winter onion crops and potential alternative hosts were also sampled. IYSV infection showed a temporal pattern of spread, and the proportion of sites with IYSV-infected plants began to increase rapidly after August. Two early infected fields were detected, and were the only ones with severe economic losses (50-60% crop reduction) due to IYSV. In both cases, onions were grown from IYSV- infected transplants imported from another region. There was no evidence that weeds and volunteer onion can act as alternative host. The use of virus (and vector)-free transplants must play an important role in IYSV management strategies by delaying early-season infection of onion in Spain.

Seasonal Dynamics of Thrips (<I>Thrips tabaci</I>) (Thysanoptera: Thripidae) Transmitters of Iris Yellow Spot Virus: A Serious Viral Pathogen of Onion Bulb and Seed Crops

Thrips-transmitted Iris yellow spot virus (IYSV) is an important economic constraint to the production of bulb and seed onion crops in the United States and many other parts of the world. Because the virus is exclusively spread by thrips, the ability to rapidly detect the virus in thrips vectors would facilitate studies on the role of thrips in virus epidemiology, and thus formulation of better vector management strategies. Using a polyclonal antiserum produced against the recombinant, Escherichia coli-expressed nonstructural protein coded by the small (S) RNA of IYSV, an enzyme linked immunosorbent assay was developed for detecting IYSV in individual as well as groups of adult thrips. The approach enabled estimating the proportion of potential thrips transmitters in a large number of field-collected thrips collected from field-grown onion plants. Availability of a practical and inexpensive test to identify viruliferous thrips would be useful in epidemiological studies to better understand the role of thrips vectors in outbreaks of this economically important virus of onion.

Onion ipmPIPE: A Coordinated Effort to Improve the Management of Onion Thrips and Iris yellow spot virus for the U.S. Onion Industry

Onion (Allium cepa) is an economically important vegetable crop in the United States, generating nearly $900 million annually in farm receipts. Pests such as onion thrips (Thrips tabaci) and a thrips-transmitted virus disease, Iris yellow spot (IYS), caused by Iris yellow spot virus (IYSV), have emerged in recent years as high priority, invasive, or potential threats to sustainable onion production throughout the United States and the world. The long-term goal of a recent United States Department of Agriculture (USDA)-National Institute of Food and Agriculture (NIFA)-Specialty Crop Research Initiative (SCRI) funded project was to optimize sound pest management decision making in onion through the development and deployment of a sustainable online information management platform called the Onion ipmPIPE (Onion integrated pest management Pest Information Platform for Extension and Education). Project participants in seven states generated an average of 500 reports annually on the occurrence of 20 priority insect pests and plant diseases, and enhanced the timeliness and effectiveness of IPM strategies implemented by the growers and industry locally and regionally in response to these reports. Thrips populations are generally greatest at all locations during July and August of each year, which compounds plant responses to environmental stresses such as temperature and limited or lower quality (e.g., saline) irrigation water. The increase in numbers of thrips (majority being T. tabaci) also aggravates problems with the onion thrips-transmitted virus IYSV (mentioned above) and IYS, which generally increases in incidence and severity during this same period. A comprehensive website (http//:www.alliumnet.com/IPMPipe.html) and educational materials (bulletin, diagnostic cards, videos) were developed in response to the insect and disease threats, and have been shared with onion stakeholders throughout the United States and elsewhere. The project is also developing risk assessment models, a smartphone app, onion growing-degree-day review for efficacy of the current model based on 5.5°C from planting, and enhanced pathogen diagnostic tools for future testing and validation by onion stakeholders. Visiting the Onion ipmPIPE website was estimated by respondents to increase onion yields by 280 kg/hectare and reduce pesticide costs by $910/hectare on average. The Onion ipmPIPE platform is scale neutral, and supports a range of organic and conventional growers producing onions on small plots to large-scale commercial fields. Increased participation of stakeholders, including consumers, in a national educational project such as Onion ipmPIPE will better serve current and future interests in sustainability and profitability of critical food crops for the U.S. marketplace. Accepted 25 September 2014. Published 12 November 2014.

First Report of Iris yellow spot virus Infecting Green Onion in Indonesia.

Green onion (Allium fistulosum L.) is an important vegetable crop for small-holder farmers for domestic consumption in Indonesia. Iris yellow spot virus (IYSV; family Bunyaviridae, genus Tospovirus) transmitted by Thrips tabaci is an economically important viral pathogen of bulb and seed onion crops in many onion-growing areas of the world (1,3). In Asia, IYSV has been reported in India and Sri Lanka (2,4). In April 2013, symptoms suspected to be caused by IYSV were observed on a 1-month-old green onion crop grown for their leaves in a farmer's field in Cipendawa, Pacet, Cianjur District, West Java. Symptoms consisted of elliptical to spindle-shaped, straw colored, irregular, chlorotic lesions with occasional green islands on the leaves. Approximately 25% of the field had plants with these symptoms. The presence of the virus was confirmed with an IYSV-specific Agdia Flash kit. IYSV infection was confirmed by RT-PCR with primers specific to the nucleoprotein (N) gene of IYSV. Primers 465c: 5'-AGCAAAGTGAGAGGACCACC-3' and IYSV-239f: 5' TGAGCCCCAATCAAGACG3' (3) were used as forward and reverse primers, respectively, using total nucleic acids eluted from FTA cards that were previously coated with freshly prepared sap extracts from field samples. Amplicons of approximately 240 bp were obtained from four symptomatic plants tested but not from healthy and water controls. The amplicons were cloned and sequenced. Consensus sequence was derived from three clones. Comparison with IYSV N gene sequences available in GenBank showed sequence identity of 95 to 99% confirming the identity of the virus as IYSV. To our knowledge, this is the first report of IYSV infecting onion in Indonesia. The finding in Java underscores the need for conducting surveys in Java as well as other onion-growing regions of Indonesia to gain a better understanding of its incidence, distribution, and potential impact.

First Report of Iris yellow spot virus Infecting Onion in Pakistan.

Onion (Allium cepa L.) is an important vegetable crop in Pakistan. According to the Food and Agricultural Organization (FAO), Pakistan is the world's fifth largest onion producer. The area and production is 127.8 thousand hectares and 1.7 million tons, respectively, with a yield of 13.8 tons per hectare during 2012. The agro-ecological diversity in the country enables onion production almost year round. Iris yellow spot virus (IYSV; family Bunyaviridae, genus Tospovirus), transmitted principally by Thrips tabaci, is an economically important viral pathogen of bulb and seed onion crops in many onion-growing areas of the world (1,3). In Asia, IYSV has been reported in India and Sri Lanka (2,4). During March to May 2012, as part of a survey for tospoviruses in vegetables, symptoms suspected to be caused by IYSV were observed on bulb and seed onions grown in farmers' fields in Faisalabad, Nankana, Sheikhupura, and Sialkot districts of Punjab. Symptoms consisted of spindle-shaped, straw colored, irregular chlorotic lesions with occasional green islands on the leaves. Approximately 60% of the fields surveyed had about 30% of the plants with these symptoms. The presence of the virus was confirmed with an IYSV-specific ELISA kit (Bioreba). IYSV infection was verified by RT-PCR with primers IYSV-F (TAAAACAAACATTCAAACAA) and IYSV-R (CTCTTAAACACATTTAACAAGCA) as forward and reverse primers, respectively. Amplicons of approximately 1,100 bp were obtained from the symptomatic samples, but not from healthy and water controls. The amplicons were cloned and sequenced. The IYSV-Pakistan isolates (GenBank Accession Nos. KF171103, KF171104, and KF171105) had the highest nucleotide sequence identity of 99% with the corresponding region of an IYSV isolate from Chile (DQ150107). To our knowledge, this is the first report of IYSV infecting onion in Pakistan. The relatively widespread occurrence of IYSV underscores the need for systematic surveys to assess its incidence and impact on onion bulb and seed crops so that appropriate management tactics can be developed.

First Report of a Natural Occurrence of Tomato yellow fruit ring virus on Pepper in Iran.

Tospoviruses are considered one of the most devastating viruses in different crops and ornamentals worldwide. There have been increasing records of the natural occurrence of Tomato yellow fruit ring virus (TYFRV) in Iran (e.g., 1,2,3), a recently proposed species in the genus Tospovirus (4). During the growing seasons 2010 to 2011, surveys were conducted in pepper fields (Capsicum annum) in Tehran province, one of the main vegetable producing areas of Iran, to detect the presence of tospovirus species infecting this crop, including Groundnut ringspot virus (GRSV), Impatiens necrotic spot virus (INSV), Iris yellow spot virus (IYSV), Tomato chlorotic spot virus (TCSV), Tomato spotted wilt virus (TSWV), TYFRV, and Watermelon silver mottle virus (WSMoV). Overall, 14 fields were surveyed and 119 pepper leaf samples from plants showing tospovirus-like symptoms of yellow mosaic, chlorosis, and necrosis were collected. Each leaf sample was tested by double-antibody sandwich (DAS)-ELISA using specific antisera (Bioreba, Reinach, Switzerland; Loewe, Sauerlach, Germany; DSMZ, Braunschweig, Germany) for the presence of the aforementioned tospoviruses. Based on the results, TYFRV were found in 21 samples (17.6%) collected from five fields surveyed. None of the samples had a positive reaction in ELISA to GRSV, INSV, IYSV, TCSV, TSWV, and WSMoV. To confirm testing, six leaf samples that were found positive for TYFRV in ELISA tests were mechanically inoculated on Petunia × hybrid and Nicotiana rustica; for all the samples studied, the inoculated plants showed typical necrotic local lesions of tospoviruses, and chlorotic or necrotic spots followed by systemic infection, respectively; their infection was subsequently confirmed by ELISA. Four out of the six samples also were tested by reverse transcription (RT)-PCR technique using previously described specific primers (2). The PCR reaction, in agreement with ELISA tests, resulted in the specifically amplification of a ~1.2-kb fragment of TYFRV RNAs. Using the PCR amplification primers mentioned above, the nucleotide sequences of nucleoprotein (N) genes of two isolates, namely TY-PepT43 and TY-PepT74, were determined (GenBank Accession Nos. KC354692 and KC354693, respectively); BLAST search results confirmed the presence of TYFRV and showed high nucleotide identities (99.0%) to TY-PF36 isolate of the virus. The virus has been previously reported on potato, tomato, ornamental plants, and some weed species in Tehran Province (1,3,4). This coupled with the presence of TYFRV vector, i.e., Thrips tabaci, in the same region (1), may have resulted in the occurrence of the virus on pepper plants. To our knowledge, this is the first report of the natural occurrence of TYFRV from pepper plants in Iran.