Interspersed Repetitive Sequence Polymerase Chain Reaction Research Articles

LINE-1 Insertion Dimorphisms Identification by PCR

Differentiating between recent LINE-1 (L1) insertion dimorphisms (LIDs) is predominantly useful for studying not only the transposition mechanism but also population genet-ics or evolution based on polymorphic markers where the ancestral state is known (i.e., absence of the insertion) (1–5). Previous techniques such as L1 display (1) or ATLAS (2) have identi-fied new LIDs from distinct popula-tions. To improve both efficiency and simplicity, we designed a PCR-based approach, LID identification by PCR (LIDSIP), by combining and modify-ing ligation-mediated PCR (LMPCR) (6) and interspersed repetitive sequence PCR (IRSPCR) (7). This method requires only a small amount of DNA, a limited and specific number of PCRs to provide a genome-wide scan within a PCR range of an appropriate restriction site, conventional molecular genetic techniques such as agarose gel elec-trophoresis devoid of radioactive label, and in addition, this method yields clear, easily distinguishable, specific results. The aim of applying LIDSIP was to globally map active L1 in the human genome by amplifying the 3′ untrans-lated region (UTR) end of the L1-Ta subset up to its next specific restric-tion enzyme recognition sequences. First, 500 ng human genomic DNA were digested with BstYI (New Eng-land Biolabs, Beverly, MA, USA) and purified with phenol-chloroform extraction and ethanol precipitation. Second, the DNA was ligated to 20 pmol each of LIDSIP-LINK (5′-AGG-TAACGAGTCAGACCACCGACTC-GTGGACGT-3′) and BstYI-LINK (5′-GATCACGTCCACGAG-3′) using T4 DNA ligase (New England Biolabs) at 16°C overnight. Finally 50 ng of the purified ligated DNA were subjected to nested PCR. The first PCR (50 µL total volume) contained 200 µM each of the four dNTPs, 1× PCR buffer (contains 1.5 mM MgCl

Technology development at the interface of proteome research and genomics: mapping nonpolymorphic proteins on the physical map of mouse chromosomes.

Data obtained from protein spots by peptide mass fingerprinting are used to identify the corresponding genes in sequence databases. The relevant cDNAs are obtained as clones from the Integrated Molecular Analysis of Genome Expression (I.M.A.G.E.) consortium. Mapping of I.M.A.G.E. clones is performed in two steps: first, cDNA clones are hybridized against a 10-hit genomic mouse bacterial artificial chromosome (BAC) library. Second, interspersed repetitive sequence polymerase chain reaction (IRS-PCR) using a single primer directed against the mouse B1 repeat element is performed on BACs. As each cDNA detects several BACs, and each individual BAC has a 50% chance to recover an IRS-PCR fragment, the majority of cDNAs produce at least a single IRS-PCR fragment. Individual IRS fragments are hybridized against high-density spotted filter grids containing the three-dimensional permutated pools of yeast artificial chromosome (YAC) library resources that are currently being used to construct a physical map of the mouse genome. IRS fragments that hybridize to YAC clones already placed into contigs immediately provide highly precise map positions. This technology therefore is able to draw links between proteins detected by 2-D gel electrophoresis and the corresponding gene loci in the mouse genome.

Construction of a whole-genome radiation hybrid panel for high-resolution gene mapping in pigs

We have developed a panel of 152 whole-genome radiation hybrids by fusing irradiated diploid pig lymphocytes or fibroblasts with recipient hamster permanent cells. The number and size of the porcine chromosome fragments retained in each hybrid clone were checked by fluorescence in situ hybridization with a SINE probe or by primed in situ labeling (PRINS) with SINE-specific primers. A strategy based on the interspersed repetitive sequence polymerase chain reaction (IRS-PCR) was developed for selected clones to determine if the large fragments painted by the SINE probe corresponded to one pig chromosome or to different fragments of several chromosomes. This strategy was buttressed by a double PRINS approach using primers specific for α-satellite sequences of two different groups of swine chromosomes. Genome retention frequency was estimated for each clone by PCR with 32 markers localized on different porcine chromosomes. Of the 152 hybrids produced, 126 were selected on the basis of cytogenetic content and chromosome retention frequency to construct a radiation hybrid map of swine chromosome 8. Our initial results for this chromosome indicate that the resolution of the radiation hybrid map is 18 times higher than that obtained by linkage analysis.

Toward the construction of integrated physical and genetic maps of the mouse genome using interspersed repetitive sequence PCR (IRS-PCR) genomics.

Using two recently developed techniques, IRS-PCR YAC walking and IRS-PCR genotyping, a framework-integrated physical and genetic map of the mouse genome was constructed. The map consists of 821 contigs, containing 7746 YAC clones originating from three different YAC libraries. Three hundred eighty of the contigs have been anchored to the genetic map. Approximately 16% of the physical length of the mouse genome is estimated to be represented.

A somatic cell hybrid panel for pig regional gene mapping characterized by molecular cytogenetics

A panel of 27 pig x rodent somatic cell hybrids was produced and characterized cytogenetically. The first step of this study consisted of hybridizing a SINE probe to GTG-banded metaphases of each hybrid clone in order to count and identify the normal pig chromosomes and to detect rearranged ones. The second step consisted of using the DNA of each clone as a probe after pIRS-PCR (porcine interspersed repetitive sequence-polymerase chain reaction) amplification to highly enrich it in pig sequences. These probes, hybridized to normal pig metaphase chromosomes, enabled the identification of the complete porcine complement in the hybrid lines. Whole chromosomes and fragments were characterized quickly and precisely, and results were compared. In addition to this cytogenetic characterization, molecular verification was also carried out by using primers specific to six microsatellites and to one gene previously mapped to pig chromosomes. The results obtained allow us to conclude that we have produced a panel that is informative for all porcine chromosomes. This panel constitutes a highly efficient tool to establish not only assignments of genes and markers but also regional localizations on pig chromosomes.

Efficient high-resolution genetic mapping of mouse interspersed repetitive sequence PCR products, toward integrated genetic and physical mapping of the mouse genome.

The ability to carry out high-resolution genetic mapping at high throughput in the mouse is a critical rate-limiting step in the generation of genetically anchored contigs in physical mapping projects and the mapping of genetic loci for complex traits. To address this need, we have developed an efficient, high-resolution, large-scale genome mapping system. This system is based on the identification of polymorphic DNA sites between mouse strains by using interspersed repetitive sequence (IRS) PCR. Individual cloned IRS PCR products are hybridized to a DNA array of IRS PCR products derived from the DNA of individual mice segregating DNA sequences from the two parent strains. Since gel electrophoresis is not required, large numbers of samples can be genotyped in parallel. By using this approach, we have mapped > 450 polymorphic probes with filters containing the DNA of up to 517 backcross mice, potentially allowing resolution of 0.14 centimorgan. This approach also carries the potential for a high degree of efficiency in the integration of physical and genetic maps, since pooled DNAs representing libraries of yeast artificial chromosomes or other physical representations of the mouse genome can be addressed by hybridization of filter representations of the IRS PCR products of such libraries.

3 Mapping of Mammalian Genomes with Radiation (Goss and Harris) Hybrids

Publisher Summary This chapter describes the use of radiation hybrids for constructing high-resolution maps of the human genome. Radiation hybrids have recently been implemented for mouse mapping and have been found to have a higher level of resolution compared to that of interspecies meiotic mapping panels. The chapter presents the advantages and disadvantages of the two different types of radiation hybrid panels. One advantage of the chromosome-specific panels is their reduced complexity. Because the human component in the hybrids is derived from a single chromosome or a reduced number of chromosomes, the hybrid can be used as a resource for chromosome-specific marker isolation. Using methods, such as interspersed repetitive sequence-polymerase chain reaction (IRS-PCR) to obtain the human sequences has greatly improved their usefulness. Moreover, the hybrids are easier to analyze with markers from multigenic families due to their reduced complexity. As radiation hybrid mapping has become more popular, numerous laboratories have expressed an interest in gaining access to hybrid panels. There is a renewed interest in total genome hybrid panels because they can be used without a piori knowledge of a marker's location.

Rapid and efficient construction of yeast artificial chromosome contigs in the mouse genome with interspersed repetitive sequence PCR (IRS-PCR): Generation of a 5-cM, >5 megabase contig on mouse Chromosome 1

We have developed a new technique for the generation of YAC contigs in the mouse genome that is based on the ability to detect overlapping clones by hybridization of shared IRS-PCR products. As a demonstration of the technique, a 5-cM, > 5 megabase contig was developed on the distal half of mouse Chromosome (Chr) 1, spanning the region from Lamb2 to At3. The contig covers roughly 5% of the genetic distance of the chromosome and is comprised of more than 80 clones; 71 probes were assigned physical order to the chromosome, of which 59 were new markers generated in this study. Eight of the new probes were shown to be polymorphic between C3H/HeJ-gld and M. spretus. Three probes were mapped on a [(C3H/HeJ-gld x M. spretus) x C3H/HeJ-gld] interspecific backcross to integrate the physical map with a high-resolution genetic map of the region.

Degenerate oligonucleotide-primed PCR: General amplification of target DNA by a single degenerate primer

A version of the polymerase chain reaction (PCR), termed degenerate oligonucleotide-primed PCR (DOP-PCR), which employs oligonucleotides of partially degenerate sequence, has been developed for genome mapping studies. This degeneracy, together with a PCR protocol utilizing a low initial annealing temperature, ensures priming from multiple (e.g., ∼10 6 in human) evenly dispersed sites within a given genome. Furthermore, as efficient amplification is achieved from the genomes of all species tested using the same primer, the method appears to be species-independent. Thus, for the general amplification of target DNA, DOP-PCR has advantages over interspersed repetitive sequence PCR (IRS-PCR), which relies on the appropriate positioning of species-specific repeat elements. In conjunction with chromosome flow sorting, DOP-PCR has been applied to the characterization of abnormal chromosomes and also to the cloning of new markers for specific chromosome regions. DOP-PCR therefore represents a rapid, efficient, and species-independent technique for general DNA amplification.

The construction of human somatic cell hybrids containing portions of the mouse X chromosome and their use to generate DNA probes via interspersed repetitive sequence polymerase chain reaction

Interspersed repetitive sequence polymerase chain reaction (IRS-PCR) has become a powerful tool for the rapid generation of DNA probes from human chromosomes present in rodent somatic cell hybrids. We have constructed a somatic cell hybrid containing a major portion of the mouse X chromosome in a human background (clone 8.0). IRS-PCR was developed for the specific amplification of mouse DNA using either of two primers from the rodent-specific portion of the murine B1 repeat. Amplification was subsequently performed with clone 8.0 and a subclone, 8.1 1 , which retains a small murine X-chromosomal fragment including Hprt and the Gdx locus. A total of 15–20 discrete PCR products ranging in size from <500 to >3000 bp were obtained from clone 8.0 with each primer. In clone 8.1 1 , a subset of these bands plus some additional bands were observed. Nine bands amplified from clone 8.1 1 have been excised from gels and used as probes on Southern blots. All of the fragments behaved as single-copy probes and detected domesticus/spretus variation. They have been regionally mapped using an interspecific backcross. The probe locations are compatible with those of markers known to be present in clone 8.1 1 . These results demonstrate the feasibility of this method as applied to the mouse genome and the high likelihood of generating useful DNA probes from a targeted region.

Adaptation of the interspersed repetitive sequence polymerase chain reaction to the isolation of mouse DNA probes from somatic cell hybrids on a hamster background

A strategy for the rapid isolation of DNA probes from radiation-fusion Chinese hamster cell hybrids containing overlapping portions of the murine X chromosome based on the interspersed repetitive sequence polymerase chain reaction (IRS-PCR) previously used with human somatic cell hybrids has been developed. This specific amplification of mouse DNA on a hamster background depends on the use of primers directed to the B2 short interspersed repeat element family and the R repeat, from the long interspersed repeat element family, L1. Two sets of amplification conditions, which gave specific amplification of mouse DNA from either a mouse X-monochromosomal hybrid or irradiation-fusion hybrids having reduced X content, were defined. The mouse X-only chromosome hybrid yielded approximately 20 discrete reproducible bands, while the irradiation-fusion hybrids yielded between 1 and 10 discrete products. Comparison of different irradiation-fusion hybrids has allowed the definition of both specific and shared products corresponding to different regions within the overlapping X-chromosome fragments present within these hybrids. Use of such hybrids and the IRS-PCR technique has allowed the isolation of probes corresponding to the central region of the mouse X chromosome that contains the X-inactivation center. The method should be widely applicable to the isolation of mouse DNA sequences from mouse hybrid cell lines on either human or Chinese hamster backgrounds.

Human-specific amplification of radiation hybrid DNA fractionated by pulsed-field gel electrophoresis

Recently, a method named interspersed repetitive sequence polymerase chain reaction (IRS-PCR) was described by which, using primers directed against an IRS, human DNA sequences flanked by the IRS are selectively amplified from complex DNA mixtures such as somatic cell hybrid DNA (1,2). Hybrids containing human chromosomal fragments, such as radiation hybrids (RH) (3, 4), have been used to further reduce the complexity of the human DNA template and increase the specificity of IRS-PCR amplification (5). Here we describe a method which facilitates the isolation of specific DNA sequences from a subchromosomal region. We have developed a method to amplify human-specific DNA sequences from pulsed-field gel (PFGE) fractionated RH DNA; by amplifying a fraction of digested RH DNA containing an identifiable DNA restriction fragment, this method provides a means to selectively amplify and enrich for DNA sequences contained within a specific DNA restriction fragment. Genomic DNA from RH 128, a RH harboring about 10% of a human X chromosome including region Xpl 1.22-Xpl 1.1 (P.N.Goodfellow and J.L.Gorski, unpublished data), was prepared in agarose blocks (6) and digested with SfiI (NEB). DNA blocks were loaded into 1.2% LMP agarose gels (BRL) made with 0.5 xTBE and electrophoresed using a contourclamped homogeneous electric field (CHEF) gel system (CHEFDRII; BioRad) at 200 V with pulse times of 60s (15 hrs) and 90s (9 hrs). Horizontal 5 mm gel slices were cut; DNA was recovered by electroelution, dialyzed against TE, sequentially extracted with phenol, chloroform, and ether, precipitated using ammonium acetate, ethanol, and carrier yeast tRNA (10 gg/ml), and resuspended in 50 Al of dH2O. PCRs were 100 ,tl in volume and contained 400 ng of DNA, 50 mM KCl, 10 mM Tris-HCl, 1.6 mM MgCl2, 0.01% gelatin, 250 uM each dNTP, 1 itg RNase A, and 0.5 ,tM primer; the primer, A-517N (5' AAGTGCGGCCGCGATCTCGGCTCACTGCAA 3'), was directed against a consensus Alu repetitive sequence (1) modified to contain a 5' NotI restriction endonuclease recognition sequence. PCR reactions were incubated at 37°C for 1 hr, 94°C for 9 min, and after the addition of 5 U AmpliTaq DNA polymerase (PerkinElmer/Cetus), 36 cycles of 94°C denaturation (1 min), 55°C annealing (1 min), and 72°C extension (4 min) were performed; amplification products were fractionated on a 1.2% agarose gel and stained with ethidium bromide. No products resulted from the amplification of hamster DNA indicating that the primer was specific for human DNA (Fig. 1). Amplification of hybrid DNA containing only a human X chromosome yielded a large number of products while amplification of RH 128 DNA and RH 128 DNA digested with Sfil yielded an identical subset of products (Fig. 1); Sfil-digested RH 128 DNA isolated from LMP agarose (Fig. 1; RH 128 Sfil gp) yielded a reduced but similar pattern of products. Compared to RH 128 DNA, amplification of a fraction of RH 128 DNA (450-500 kb) recovered from a preparative CHEF gel yielded relatively fewer products consistent with a further reduction of human template DNA complexity; the pattern of products observed upon the amplification of similar

Painting of human chromosomes with probes generated from hybrid cell lines by PCR with Alu and L1 primers

Specific amplification of human sequences of up to several kb length has recently been accomplished in man-hamster and man-mouse somatic hybrid cell DNA by IRS-PCR (interspersed repetitive sequence - polymerase chain reaction). This approach is based on oligonucleotide primers that anneal specifically to human Alu- or L1-sequences and allows the amplification of any human sequences located between adequately spaced, inverted Alu- or L1-blocks. Here, we demonstrate that probe pools generated from two somatic hybrid cell lines by Alu- and L1-PCR can be used for chromosome painting in normal human lymphocyte metaphase spreads by chromosomal in situ suppression (CISS-) hybridization. The painted chromosomes and chromosome subregions directly represent the content of normal and deleted human chromosomes in the two somatic hybrid cell lines. The combination of IRS-PCR and CISS-hybridization will facilitate and improve the cytogenetic analysis of somatic hybrid cell panels, in particular, in cases where structurally aberrant human chromosomes or human chromosome segments involved in interspecies translocations cannot be unequivocally identified by classical banding techniques. Moreover, this new approach will help to generate probe pools for the specific delineation of human chromosome subregions for use in cytogenetic diagnostics and research without the necessity of cloning.