Nucleotide Sequences Of Internal Transcribed Spacer Research Articles

Amanita glarea, a new species in section Vaginatae from Pakistan

A new species, Amanita glarea, is described and illustrated from Pakistan. Molecular phylogenetic data derived from internal transcribed spacer (ITS) and nuclear ribosomal large subunit (LSU) regions along with morphological characters make it distinct from other currently known Amanita species. Amanita glarea is characterized by a grayish brown, slightly umbonate, pileus having universal veil remnants and striate margins, a long ringless stipe with a saccate volva bearing yellowish brown patches on the verrucose surface, inamyloid globose to subglobose basidiospores, and a filamentous pileipellis with some inflated round to elongated cells. Phylogenetic analysis of nuclear ribosomal ITS and LSU nucleotide sequences resolve A. glarea with other taxa in Amanita section Vaginatae.

Molecular Authentication of the Traditional Medicinal Plant "Lakshman Booti" (Smithia conferta Sm.) and Its Adulterants through DNA Barcoding.

Background:Smithia conferta Sm. is an annual herb widely used in Indian traditional medical practice and commonly known as “Lakshman booti” in Sanskrit. Morphological resemblance among the species of genus Smithia Aiton. leads to inaccurate identification and adulteration. This causes inconsistent therapeutic effects and also affects the quality of herbal medicine.Aim:This study aimed to generate potential barcode for authentication of S. conferta and its adulterants through DNA barcoding technique.Materials and Methods:Genomic DNA extracted from S. conferta and its adulterants was used as templates for polymerase chain reaction amplification of the barcoding regions. The amplicons were directed for sequencing, and species identification was conducted using BLASTn and unweighted pair-group method with arithmetic mean trees. In addition, the secondary structures of internal transcribed spacer (ITS) 2 region were predicted.Results:The nucleotide sequence of ITS provides species-specific single nucleotide polymorphisms and sequence divergence (22%) than psbA-trnH (10.9%) and rbcL (3.1%) sequences. The ITS barcode indicates that S. conferta and Smithia sensitiva are closely related compared to other species.Conclusion:ITS is the most applicable barcode for molecular authentication of S. conferta, and further chloroplast barcodes should be tested for phylogenetic analysis of genus Smithia.SUMMARY The present investigation is the first effort of utilization of DNA barcode for molecular authentication of S. conferta and its adulterants. Also, this study expanded the application of the ITS2 sequence data in the authentication. The ITS has been proved as a potential and reliable candidate barcode for the authentication of S. conferta. Abbreviations used: BLASTn: Basic Local Alignment Search Tool for Nucleotide; MEGA: Molecular Evolutionary Genetic Analysis; EMBL: European Molecular Biology Laboratory; psbA-trnH: Photosystem II protein D1- stuctural RNA: His tRNA gene; rbcL: Ribulose 1,5 bi-phosphate carboxylase/oxygenase large subunit gene.

Chemical Composition of the Essential Oil from Aerial Parts of Javanian Pimpinella pruatjan Molk. and Its Molecular Phylogeny

The species-rich and diverse genus Pimpinella is mainly distributed in Europe and Asia; a few species occur in Africa. Yet, the Javanian Pimpinella, P. pruatjan, which has been used as an aphrodisiac in Indonesian traditional medicine, was studied for the first time in the context of chemical composition, as well as phylogeny analysis and antimicrobial activity. We examined the chemical composition of the essential oil (EO) from aerial parts of P. pruatjan by gas liquid chromatography-mass spectrometry (GLC-MS). The main component of EO was (Z)-γ-bisabolene. Several oxygenated monoterpenes, oxygenated sesquiterpenes, and sesquiterpenes were also detected. The genetic relationship of Pimpinella pruatjan Molk. to other Pimpinella species was reconstructed using nucleotide sequences of the nuclear DNA marker ITS (Internal Transcribed Spacer). P. pruatjan clusters as a sister group to the African Pimpinella species. The EO did not exhibit an apparent antimicrobial activity.

FIRST REPORT OF ALTERNARIA ARBORESCENS CAUSING LEAF SPOT OF DRACAENA MARGINATA IN PAKISTAN

Dracaena marignata (family Asparagaceae) is a common ornamental plant in Pakistan on whose leaves circular brown spots were observed in March 2015 in a private garden at Lahore. For pathogen isolation, one spot per leaf from six symptomatic leaves were cut into pieces, surface-sterilized, inoculated in 2% malt extract agar (MEA) and incubated at 25±2oC. Morphological observations were made on 7-day-old cultures grown on MEA at 25±2oC. Fungal colonies were light brown, conidia were produced in short chains, had echinulate walls, were 1-4 transversely septate and ranged from 15-40 x 812 μm. The fungus was morphologically iden- tified as Alternaria arborescens (FCBP1527) (Simmons, 2007) and this identification was confirmed by sequencing of the internal transcribed spacer (ITS) of rDNA. For this purpose, a DNA fragment of approximately 650 bp was amplified us- ing the universal primers ITS1/ITS4 and total genomic DNA as template (White et al., 1990). BLASTn results indicated that the ITS nucleotide sequence of this strain (KT072732) has 100% similarly with many other isolates of A. arborescens from GenBank (JN634832, JX241641, AF397237, KC707557, KC415812). Spores from a 7-day-old culture were scratched and suspended in sterilized saline Tween 80 solution. For pathogenicity tests 105 spores were injected in stem nodes of three young plants (Farrag and Abo-Elyousr, 2011) while control plants were injected with sterilized water. Injection places were wrapped with moistened cotton. All plants were kept at 27±2oC in a greenhouse. Necrotic spots appeared on the leaves of inoculated plants only 7 days post injection. Re- isolation of the same pathogen fulfilled Koch’s postulates. To our knowledge, this is the first report of D. marginata leaf spot in A. arborescens from Pakistan.

Multiplex PCR을 이용한 4 종류 목향(木香)의 감별

Objectives : Aucklandiae Radix (Muxiang) one of important herbal medicines in oriental medicine, is defined as the dried root of Aucklandia lappa (Asteraceae). Owing to the similarities in the morphology and name, Inulae Radix (Tu-Muxiang) and Vladimiriae Radix (Chuan-Muxiang) as well as Aristolochiae Radix (Qing-Muxiang) originated from other medicinal plants are often used as substitutes and/or adulterants of Aucklandiae Radix. Therefore, a reliable authentication of these herbal medicines is necessarily for the public health and prevention of misuse. Methods : 32 samples of medicinal plants supplying Aucklandiae Radix, Inulae Radix, Vladimiriae Radix, and Aristolochiae Radix were collected in Korea and China. The ITS (Internal transcribed spacer) nucleotide sequences of samples were determined. The PCR primers to amply DNA marker of each herbal medicine were designed basing on the specific ITS regions showing differences in the sequences among medicinal plants. Results : Primer set Al R/IS F designed in this work amplified 220 bp PCR product only in samples of Aucklandiae Radix. In contrast, primer set Ih F/IS R, Vs R/IS F, and AcR F1/Ac R amplified 250 bp product, 356 bp prouct, and 516 bp product respectively to identify Inulae Radix, Vladimiriae Radix, and Aristolochiae Radix. Conclusions : The primers designed basing on the nucleotide sequences of ITS regions appearing differenced in the sequences among medicinal plants amplified the DNA markers for the identification of Aucklandiae Radix, Inulae Radix, Vladimiriae Radix, and Aristolochiae Radix. These herbal medicines were more efficiently identified by multiplex PCR method using all primers in a single PCR process.

Use of DNA sequences for Rickettsia identification in Ixodes ricinus ticks: the first detection of Rickettsia monacensis in Poland

The cosmopolitan tick Ixodes ricinus inhabiting Europe, including Poland, is a vector for many pathogens, such as various Rickettsia species, which spread to new territories. They are present mainly in the Mediterranean countries, but have also been found in Central Europe at increasing frequency. In the present study, the gltA gene, encoding citrate synthase, and an internal transcribed spacer (ITS) were employed to detect the DNA and identify the species of tick-borne pathogens of the Rickettsia genus. The presence of bacterial DNA was detected in 9.5% of the examined I. ricinus individuals. Based on the nucleotide sequences of the analysed genomic fragments, most pathogens were identified as Rickettsia helvetica, while Rickettsia monacensis was revealed in one case. We have described for the first time, to our knowledge, the occurrence of this species in Poland. Both markers employed in the experiments were successful in species identification of R. helvetica. The newly described species R. monacensis may be identified by the protein-coding gene, but the ITS nucleotide sequences proved insufficient.

First Report of Target Spot of Tobacco Caused by Rhizoctonia solani AG-2.1.

In August 2010, lesions similar to those reported for target spot were observed on Nicotiana tabacum L. plants produced in float systems in Cerrillos, Salta, Argentina. Tobacco leaves with characteristic lesions were collected from different locations in Cerrillos, Salta. Symptoms ranged from small (2 to 3 mm), water-soaked spots to larger (2 to 3 cm), necrotic lesions that had a pattern of concentric rings, tears in the centers, and margins that often resulted in a shot-hole appearance. Isolation of the causal agent was made on potato dextrose agar (PDA) acidified to pH 5 with 10% lactic acid and incubated at 25 ± 2°C in darkness for 2 to 3 days. Hyphal tips were transferred to a new medium and the cultures were examined for morphological characters microscopically (3). Eight isolates were obtained. The rapid nuclear-staining procedure using acridine orange (3) was used to determine the number of nuclei in hyphal cells. Multinucleate hyphae were observed, with 4 to 9 nuclei per cell. Molecular characterization was conducted by examining the internal transcribed spacer (ITS) region from all of the isolates of the pathogen identified as Rhizoctonia solani based on morphological characteristics (1). Fragments amplified using primers ITS1 (5'TCCGTAGGTGAACCTGCGG3') and ITS4 (5'TCCTCCGCTTATTGATATGC3') (4) were sequenced and compared with R. solani anastomosis group (AG) sequences available in the NCBI GenBank database. Sequence comparison identified this new isolate as R. solani anastomosis group AG 2-1. Previous isolates of target spot were identified as AG 3 (2). The isolates that were studied were deposited in the "Laboratorio de Sanidad Vegetal" INTA-EEA-Salta Microbial Collection as Rs59c, Rs59b, Rs59, Rs66, Rs67, Rs68, Rs69, and Rs70. The ITS nucleotide sequence of isolate Rs59 has been assigned the GenBank Accession No. JF792354. Pathogenicity tests for each isolate were performed using tobacco plants grown for 8 weeks at 25 ± 2°C with a 12-h photoperiod. Ten plants were inoculated by depositing PDA plugs (0.2 cm) colonized with R. solani onto leaves; plants inoculated with the pure PDA plug without pathogen served as controls. The plants were placed in a 25 ± 2°C growth chamber and misted and covered with polyethylene bags that were removed after 2 days when plants were moved to a glasshouse. After 48 h, symptoms began as small (1 to 2 mm), circular, water-soaked spots, lesions enlarged rapidly, and often developed a pattern of concentric rings of 1 to 2 cm. After 8 days, all inoculated plants showed typical disease symptoms. Morphological characteristics of the pathogen reisolated from symptomatic plants were consistent with R. solani. Control plants remained healthy. These results correspond to the first reports of the disease in the country. Compared to other areas in the world, target spot symptoms were only observed in tobacco plants produced in float systems and were not observed in the field. The prevalence of the disease in Salta, Argentina was 7%. To our knowledge, this is the first report of R. solani AG2.1 causing target spot of tobacco.

Presence of a short repeat sequence in internal transcribed spacer (ITS) 1 of the rRNA gene of Sogatella furcifera (Hemiptera: Delphacidae) from geographically different populations in Asia

Nucleotide sequences of the internal transcribed spacer 1 (ITS1)–5.8S–ITS2 region of the nuclear ribosomal RNA gene were determined in the white-backed planthopper (WBPH) Sogatella furcifera (Horvath) to detect molecular variation among regional populations in Asia. We analyzed 932 sequences from 172 individuals (4–9 clones per individual) of 33 populations collected in 1987–2008 from six countries, Japan, China, Taiwan, Vietnam, Philippines, and Papua New Guinea. WBPH showed intra-individual variation in ITS1, which is mainly attributable to the frequency (0–10) of the 66-bp repeat sequence in ITS1. Among the examined clones, the sequences of 5.8S were mostly identical and those of ITS2 were similar. A single planthopper had a maximum of 6 different variants in the number of ITS1 repeats, suggesting highly varied repeat numbers in individual planthoppers. The ITS1 with four repeats was the most frequently (64%) detected. Such a repeat was not observed in two other economically important planthopper species, Nilaparvata lugens (Stal) and Laodelphax striatellus (Fallen). The ITS nucleotide sequences in the WBPH populations in Asia were genetically close and some variations in the sequences were not related to regional populations, indicating that the nucleotide sequences of the ITS region are not useful for geographical discrimination of the WBPH. This closeness seems to be caused by long distance migration and genetic exchange among populations.

First Report of Verticillium Wilt Caused by Verticillium dahliae on Coleus verschaffeltii in Italy.

Coleus verschaffeltii Lem. (synonym C. blumei Benth., Plectranthus scutellaroides (L.) R. Br., and Solenostemon scutellarioides (L.) Codd), a perennial plant belonging to the Lamiaceae family, is used as a bedding plant for public gardens. The most popular cultivars produce speckled leaves of various colors. In October 2010, severe outbreaks of a previously unknown wilt were observed in a public garden at Torino (northern Italy) on 50 8-month-old plants. Plants were sprinkle irrigated. Initial symptoms were withering of leaves starting from the collar and brown streaks in the vascular tissue of roots, crown, and stem. Subsequently, infected tissues wilted and plants became stunted. Early leaf drop was observed and plants appeared bare, keeping few leaves only at the end of stems. Infected plants did not die but they lost the original ornamental aspect. Seventy percent of the plants were affected. Stems of 10 plants were disinfected with 1% sodium hypochlorite. Cross-sections through symptomatic vascular tissues were plated on potato dextrose agar amended with 25 ppm of streptomycin sulfate. After 10 days at 20 to 23°C, a fungus was consistently recovered from 90% of stems. Irregular, black microsclerotia, 29 to 76 × 14 to 52 (average 49 × 28) μm, developed in hyaline hyphae after 15 days of growth. Hyaline, elliptical, single-celled conidia, 3.9 to 7.2 × 1.7 to 2.8 (average 5.1 × 2.2) μm, developed on verticillate conidiophores with three phialides at each node. On the basis of these morphological characteristics, the fungus was identified as Verticillium dahliae (3). The internal transcribed spacer (ITS) region of rDNA was amplified using the primers ITS1/ITS4 (4) and sequenced. BLASTn analysis (1) of the 491-bp segment showed a 99% homology with the sequence of V. dahliae (Accession No. GU461634). The ITS nucleotide sequence of our isolate has been assigned the GenBank Accession No. JF704205. Pathogenicity tests were performed twice using 45-day-old plants obtained from seeds of C. verschaffeltii grown in 1-liter pots containing a 50:20:20:10 steamed mix of peat moss/pumice/pine bark/clay. Roots of 10 healthy plants were immersed in a conidial suspension (1.7 × 107 ml-1) of one culture of V. dahliae isolated from infected plants. Ten plants immersed in sterile water served as controls. Plants were maintained in a glasshouse at daily average temperatures between 20 and 28°C and relative humidity between 50 and 80%. First wilt symptoms and vascular discoloration in the roots, crown, and stems developed 20 days after inoculation. V. dahliae was consistently reisolated from infected vascular tissues of crown and stems of symptomatic plants. Noninoculated plants remained healthy. To our knowledge, this is the first report of Verticillium wilt on C. verschaffeltii in Italy. Verticillium wilt had been previously reported on S. scutellaroides in the United States (2). At this time, the economic importance of Verticillium wilt on C. verschaffeltii in Italy is limited.

Identification of Alternaria alternata as a Causal Agent for Leaf Blight in Syringa Species

While many isolates of Alternaria alternata are common saprophytes on trees and shrubs, this study clearly demonstrated that A. alternata is a primary pathogen in lilac (Syringa sp.), causing a leaf-blight that affects different Syringa species. Isolates of Alternaria sp. were collected from leaf blight samples of lilacs in the field. The internal transcribed spacer (ITS) region and morphological characterization were used to identify lilac blight pathogen. Based on 100% ITS nucleotide sequence identities to the Alternaria genus in the GenBank and morphological features, these isolates were identified as A. alternata. Disease symptoms were reproduced in lilac plants inoculated with A. alternata mycelial plugs and sprayed with a fungus-free culture filtrate, indicating that pathogenesis in lilac involves secondary metabolites or toxins. Diagnostic primers were developed to detect Alternaria sp. and A. alternata in lilac leaf blight based on ITS region and four known genes associated with pathogenesis in A. alternata: mixed-linked glucanase precursor, endopolygalacturonase, hsp70, and histone genes. The results from our study indicated A. alternata is a primary pathogen in lilac leaf blight, and these diagnostic primers can be used as a tool for the fast detection of A. alternata associated with lilac leaf blight.

First Report of Basal Stem Rot and Foliar Blight Caused by Pythium sylvaticum on Miscanthus sinensis in Illinois.

Miscanthus sinensis Anderss., a perennial grass, is native to eastern Asia. It has been widely grown as an ornamental in temperate regions of the world, including the United States, and recently has become an important component of public and private sector bioenergy feedstock Miscanthus selection programs. In August 2008, stem rot and blight was observed on M. sinensis plants in two irregular patches, ~2 to 2.5 × 1 to 1.5 m each in a trial plot that was preceded by corn, at the University of Illinois Energy Farm near Urbana, IL. At the time of the observation, most plants were dead and the wilted tillers had black, soft rotted basal stems. A few plants were stunted and the crowns of the tillers had black-to-brown soft rot. Some tillers' leaves were dead and others had turned light brown. Sample tissue fragments were surface disinfested in 0.5% NaOCl and plated on 1% water agar (WA). After 3 days of incubation in the dark at 23°C, colonies were transferred to corn meal agar (CMA), potato dextrose agar (PDA), or 10% V8 juice agar and incubated at 23°C under continuous white light for up to 2 weeks. Morphological characteristics of the isolates correspond to those originally described for Pythium sylvaticum W.A. Campb. & J.W. Hendrix (1). The mycelia grew and covered the 10-cm-diameter plates within 5 days. On PDA, the culture was a creamy white mycelial mat of coenocytic hyphae. The isolates produced only globose, terminal or intercalary hyphal swellings ranging from 28 to 48 μm in diameter, but no oogonia were produced on any of the three growth media. No zoospores were produced when agar blocks bearing mycelium were flooded with distilled water or 1% soil water. Sequence analysis was performed with the internal transcribed spacer (ITS) region of the rDNA amplified with primer pair ITS1/ITS4 (3) and the mitochondrially encoded cytochrome c oxydase subunit II (cox II) gene using primers FM58/FM66 (2). The resulting 871-bp ITS nucleotide sequence (Accession No. HM991706) was identical among all three isolates analyzed and 99% identical (100% coverage) to ITS sequences of multiple isolates of P. sylvaticum in GenBank. Likewise, the 544-bp cox II sequence (Accession No. HQ454429) was 99% identical (97% coverage) to cox II sequences of multiple isolates of P. sylvaticum. Six pots of M. sinensis seedlings were inoculated by placing two CMA plugs of a 2-week-old culture of isolate F71 at the crown. The control pots were mock inoculated with sterile CMA plugs. The plants were incubated at ~90% relative humidity (RH) and 25°C day and 22°C night for 3 days, and thereafter left on the greenhouse bench at ~65% RH with alternating 9 h of darkness and 15 h of light. Three weeks after inoculation, two of the inoculated seedlings wilted, others were stunted with leaves wilting from the tip downwards and the stems rotting from the crown upward. A thick mat of mycelia was seen on the rotted basal stems. No symptoms were observed in the control. P. sylvaticum was reisolated from both the rotted basal stems and the wilted foliage. To our knowledge, this is the first report of P. sylvaticum on M. sinensis. Infestation of farm soils with P. sylvaticum could limit M. sinensis biomass production significantly by limiting seedling establishment.

Diversity of thermophilic fungi in Tengchong Rehai national park revealed by ITS nucleotide sequence analyses

The geothermal sites near neutral and alkalescent thermal springs in Tengchong Rehai National Park were examined through cultivation-dependent approach to determine the diversity of thermophilic fungi in these environments. Here, we collected soils samples in this area, plated on agar media conducive for fungal growth, obtained pure cultures, and then employed the method of internal transcribed spacer (ITS) sequencing combined with morphological analysis for identification of thermophilic fungi to the species level. In total, 102 strains were isolated and identified as Rhizomucor miehei, Chaetomium sp., Talaromyces thermophilus, Talaromyces byssochlamydoides, Thermoascus aurantiacus Miehe var. levisporus, Thermomyces lanuginosus, Scytalidium thermophilum, Malbranchea flava, Myceliophthora sp. 1, Myceliophthora sp. 2, Myceliophthora sp. 3, and Coprinopsis sp. Two species, T. lanuginosus and S. thermophilum were the dominant species, representing 34.78% and 28.26% of the sample, respectively. Our results indicated a greater diversity of thermophilic fungi in neutral and alkaline geothermal sites than acidic sites around hot springs reported in previous studies. Most of our strains thrived at alkaline growth conditions.

Phylogeny of γ-proteobacteria inferred from comparisons of 3’ end 16S rRNA gene and 5’ end 16S-23S ITS nucleotide sequences

The phylogeny of γ-proteobacteria was inferred from nucleotide sequence comparisons of a short 232 nucleotide sequence marker. A total of 64 γ-proteobacterial strains from 13 Orders, 22 families, 40 genera and 59 species were analyzed. The short 232 nucleotide sequence marker used here was a combination of a 157 nucleotide sequence at the 3’ end of the 16S rRNA gene and a 75 nucleotide sequence at the 5’ end of the 16S-23S Internal Transcribed Spacer (ITS) sequence. Comparative analyses of the 3’ end of the 16S rRNA gene nucleotide sequence showed that the last 157 bp were conserved among strains from same species and less conserved in more distantly related species. This 157 bp sequence was selected as the first part in the construction of our nucleotide sequence marker. A bootstrapped neighbor-joining tree based on the alignment of this 157 bp was constructed. This 157 bp could distinguish γ-proteobacterial species from different genera from same family. Closely related species could not be distinguished. Next, an alignment of the 16S-23S ITS nucleotide sequences of alleles from same bacterial strain was performed. The first 75 bp at the 5’ end of the 16S-23S ITS was highly conserved at the intra-strain level. It was selected as the second part in the construction of our nucleotide sequence marker. Finally, a bootstrapped neighbor-joining tree based on the alignment of this 232 bp sequence was constructed. Based on the topology of the neighbour-joining tree, four major Groups, Group I to IV, were revealed with several sub-groups and clusters. Our results, based on the 232 bp sequence were, in general, in agreement with the phylogeny of γ-proteobacteria based on the 16S rRNA gene. The use of this 232 bp sequence as a phylogenetic marker presents several advantages over the use of the entire 16S rRNA gene or the generation of extensive phenotypic and genotypic data in phylogenetic analyses. First, this marker is not allele-dependant. Second, this 232 bp marker contains 157 bp from the 3’ end of the 16S rRNA gene and 75 bp from the 5’ end of the 16S-23S ITS. The 157 bp allows discrimination among distantly related species. Owing to its higher rate of nucleotide substitutions, the 75 bp adds discriminating power among closely related species from same genus and closely related genera from same family. Because of its higher percentage of nucleotide sequence divergence than the 16S rRNA gene, the 232 bp marker can better discriminate among closely related γ-proteobacterial species. Third, the method is simple, rapid, suited to large screening programs and easily accessible to most laboratories. Fourth, this marker can also reveal γ-proteobacterial species which may appear misassigned and for which additional characterization appear warranted.

Phylogeny of the Order Bacillales inferred from 3’ 16S rDNA and 5’ 16S-23S ITS nucleotide sequences

A short 220 bp sequence was used to study the taxonomic organization of the bacterial Order Bacillales. The nucleotide sequences of the 3’ end of the 16S rDNA and the 16S-23S Internal transcribed spacer (ITS) were determined for 32 Bacillales species and strains. The data for 40 additional Bacillales species and strains were retrieved directly from Genbank. Together, these 72 Bacillales species and strains encompassed eight families and 21 genera. The 220 bp se- quence used here covers a conserved 150 bp sequence located at the 3’ end of the 16S rDNA and a conserved 70 bp sequence located at the 5’ end of the 16S-23S ITS. A neighbor-joining phylogenetic tree was inferred from comparative analyses of all 72 nucleotide sequences. Eight major Groups were revealed. Each Group was sub-divided into sub-groups and branches. In general, the neighbor-joining tree presented here is in agreement with the currently accepted phylogeny of the Order Bacillales based on phenotypic and genotypic data. The use of this 220 bp sequence for phylogenetic analyses presents several advantages over the use of the entire 16S rRNA genes or the generation of extensive phenotypic and genotypic data. This 220 bp sequence contains 150 bp at the 3’ end of the 16S rDNA which allows discrimination among distantly related species and 70 bp at the 5’ end of the 16S-23S ITS which, owing to its higher percentage of nucleotide sequence divergence, adds discriminating power among closely related species from same genus and closely related genera from same family. The method is simple, rapid, suited to large screening programs and easily accessible to most laboratories.

Intraspecies variation of Brugia spp. in cat reservoirs using complete ITS sequences

The internal transcribed spacer (ITS) region was used to study the intraspecies variation of Brugia spp. in cat reservoirs. Blood specimens from seven naturally infected cats were collected from two different geographical brugian-endemic areas in Thailand. The DNAPAR tree of these Brugia spp. was constructed using a maximum likelihood approach based on ITS nucleotide sequences and was compared to those of Brugia malayi, Brugia pahangi, and Dirofilaria immitis that were previously reported in GenBank. The phylogenetic trees inferred from ITS1, ITS2, and complete ITS sequences indicated that B. malayi and B. pahangi were separated into two clades, and subgroups were generated within each clade. The data revealed that ITS2 sequences were less informative than ITS1 for studying intraspecies variation of Brugia spp. Our results are primary data for intraspecies variation of B. malayi and B. pahangi in cat reservoirs. The information could be applicable for studying the molecular epidemiology and the dynamic nature of the parasites.

Phylogenetic analysis of the internal transcribed spacer (ITS) region in Menyanthaceae using predicted secondary structure

Sequences of the nuclear internal transcribed spacer (ITS) regions ITS1 and ITS2 have been used widely in molecular phylogenetic studies because of their relatively high variability and facility of amplification. For phylogenetic applications, most researchers use sequence alignments that are based on nucleotide similarity. However, confidence in the alignment often deteriorates at taxonomic levels above genus, due to increasing variability among sequences. Like ribosomal RNA (rRNA) and other RNA molecules, the ITS transcripts consist in part of conserved secondary structures (‘stems’ and ‘loops’) that can be predicted by mathematical algorithm. Researchers have long considered the evolutionary conservation of rRNA secondary structure, but until recently few phylogenetic analyses of the ITS regions specifically incorporated structural data. We outline a novel method by which to derive additional phylogenetic data from ITS secondary structure in order to evaluate support for relationships at higher taxonomic levels. To illustrate the method, we describe an example from the plant family Menyanthaceae. Using predicted ITS secondary structure data, we obtained a well-resolved and moderately supported phylogeny, in which most topological relationships were congruent with the tree constructed using ITS nucleotide sequence data. Furthermore, the explicit encoding of ITS structural data in a phylogenetic framework allowed for the reconstruction of putative ancestral states and structural evolution in the functional but highly variable ITS region.

Analysis of nucleotide sequence polymorphism of internal transcribed spacers of ribosomal genes in diploid Aegilops (L.) species

The nucleotide sequence of the fragment of the internal transcribed spacer (ITS) of rDNA comprising the full-length ITS1, the gene encoding 5.8S rRNA, and part of the ITS2 sequence was determined in 22 samples of five diploid Aegilops species. The full alignment length of compared sequences was 524 bp. Species-specific substitutions were found in the ITS nucleotide sequence of rDNA of different Aegilops species. Intraspecific differences in ITS structure in diploid Aegilops species were detected for the first time. Polymorphism of the ITS nucleotide sequence within the same sample was revealed, which might be due either to differences between the genomes of individual plants comprising the sample or to the presence of several types of ribosomal genes in the genome of one plant. In general, both interspecific and intraspecific variability of the ITS nucleotide sequences of rDNA is extremely low. In total, 26 variable sites, twelve of which were informative, were identified.

Identification of Pythium oligandrum using species-specific ITS rDNA PCR oligonucleotides

Pythium oligandrum is a parasite of cultivated Agaricus bisporus. Infection results in significant yield reductions and a disease referred to as 'black compost'. In this study, P. oligandrum isolates were isolated from New Zealand mushroom composts, and their ribosomal DNA internal transcribed spacer (ITS) regions were amplified using the polymerase chain reaction (PCR). ITS nucleotide sequences obtained from New Zealand P. oligandrum isolates were compared with those previously identified P. oligandrum isolates and 23 described Pythium species. Although New Zealand P. oligandrum isolates had high ITS nucleotide identity with internationally identified P. oligandrum, the order of nucleotides in some regions varied when compared with other Pythium species. These varied nucleotides within the ITS region were used to design PCR primers (P.OLIG.F1 and P.OLIG.R04) for the specific amplification of a 384-bp fragment from P. oligandrum DNA. P.OLIG.F1 and P.OLIG.R04 were used to identify a major source of P. oligandrum inoculation on a New Zealand mushroom farm. Application of this diagnostic test will assist farming strategies implemented to prevent future P. oligandrum outbreaks. Furthermore, results presented identify a need for species resolution between P. oligandrum and P. hydnosporum.

Emended descriptions of Tilletiopsis washingtonensis, Tilletiopsis cremea and Tilletiopsis lilacina.

For species discrimination, DNA relatedness, nuclear DNA (nDNA) base compositions and internal transcribed spacer (ITS) regions were studied in strains of the 'washingtonensis group' consisting of the type strains of Tilletiopsis washingtonensis, Tilletiopsis cremea and Tilletiopsis lilacina as wells as nine strains previously identified as any one of the three species. T. washingtonensis is the neotype of the genus Tilletiopsis while T. cremea and T. lilacina are currently recognized as conspecific with T. washingtonensis. The G + C content of the DNA of the strains examined in this study was 66-68 mol%. The type strains of T. washingtonensis, T. cremea and T. lilacina were clearly discriminated on the basis of DNA complementarity. These genospecies should be treated as species. Moreover, an unrooted dendrogram constructed from ITS nucleotide sequences showed that the 'washingtonensis group' was divided into three clusters, corresponding to the three species T. washingtonensis, T. cremea and T. lilacina, respectively. The species descriptions of T. washingtonensis, T. cremea and T. lilacina are emended accordingly.

Phylogenetic relationships among Hepatozoon species from snakes, frogs and mosquitoes of Ontario, Canada, determined by ITS-1 nucleotide sequences and life-cycle, morphological and developmental characteristics

The molecular biological characteristics of Hepatozoon species infecting various species of snakes, frogs and mosquitoes were investigated by determining the nucleotide sequences of the first internal transcribed spacer region. A phylogenetic analysis was performed on seven isolates of Hepatozoon infecting snakes, including Hepatozoon sipedon and four morphologically similar but not identical forms, and two isolates of Hepatozoon catesbianae infecting Green frogs ( Rana clamitans melanota). This analysis, which utilised data from first internal transcribed spacer nucleotide sequences, morphological and morphometric features of gamonts, oocysts and sporocysts, and previously determined life-cycle and host-specificity characteristics, revealed that H. sipedon is a polymorphic species with a wide host and geographic range. Four synapomorphies, including two nucleotide substitutions and two morphological character state changes, supported a monophyletic group of six isolates of H. sipedon from the central region of Ontario which was the sister group for an isolate (HW1) from the southern part of the province. Based on the results of this study, an evaluation of which criteria are useful for describing species of Hepatozoon is presented, with the intent of curtailing the practice of naming species based on morphological features of gamonts or on incomplete life-cycle data.