Internal Transcribed Spacer Genotypes Research Articles

Dermatomycoses: topical and systemic antifungal treatment

Topical antifungals with activity against dermatophytes include amorolfine, allylamines, azoles, ciclopiroxolamine, and tolnaftate. Polyene antimycotics, such as amphotericinB and nystatin, alternatively, miconazole are suitable for yeast infections of the skin and mucous membranes. For severe yeast infections of the skin and mucous membranes, oral triazole antimycotics, such as fluconazole and itraconazole, are used. Pityriasis versicolor is treated topically with antimycotics, and in severe forms also orally with itraconazole, alternatively fluconazole. Terbinafine, itraconazole and fluconazole are currently available for the systemic treatment of severe dermatophytoses, tinea capitis and onychomycosis. In addition to proven therapeutic regimens, unapproved (off-label use) intermittent low-dose therapies are increasingly being used, particularly in onychomycosis. Oral antimycotics for the treatment of tinea capitis and onychomycosis in children and adolescents can only be used off-label in Germany. In general, any oral antifungal treatment should always be combined with topical antifungal therapy. In tinea corporis and tinea cruris caused by Trichophyton (T.) mentagrophytes ITS (internal transcribed spacer) genotype VIII (T.indotineae), there is usually terbinafine resistance. Identification of the species and genotype of the dermatophyte and resistance testing are required. The drug of choice for T.mentagrophytes ITS genotype VIII dermatophytoses is itraconazole. In individual cases, treatment-refractory onychomycosis may be due to terbinafine resistance of T.rubrum. Here too, resistance testing and alternative treatment with itraconazole should be considered. Therapy monitoring should be carried out culturally and, if possible, using molecular methods (polymerase chain reaction). Alternative treatment options include laser application, and photodynamic therapy (PDT).

Comprehensive Taxonomical Analysis of Trichophyton Mentagrophytes/Interdigitale Complex of Human and Animal Origin from India

Taxonomic delineation of etiologic agents responsible for recalcitrant dermatophytosis causing an epidemic in India is still debated. The organism responsible for this epidemic is designated as T. indotineae, a clonal offshoot of T. mentagrophytes. To evaluate the real identity of the agent causing this epidemic, we performed a multigene sequence analysis of Trichophyton species isolated from human and animal origin. We included Trichophyton species isolated from 213 human and six animal hosts. Internal transcribed spacer (ITS) (n = 219), translational elongation factors (TEF 1-α) (n = 40), ß-tubulin (BT) (n = 40), large ribosomal subunit (LSU) (n = 34), calmodulin (CAL) (n = 29), high mobility group (HMG) transcription factor gene (n = 17) and α-box gene (n = 17) were sequenced. Our sequences were compared with Trichophyton mentagrophytes species complex sequences in the NCBI database. Except for one isolate (ITS genotype III) from animal origin, all the tested genes grouped our isolates and belonged to the "Indian ITS genotype", currently labeled as T. indotineae. ITS and TEF 1-α were more congruent compared to other genes. In this study, for the first time, we isolated the T mentagrophytes ITS Type VIII from animal origin, suggesting the role of zoonotic transmission in the ongoing epidemic. Isolation of T. mentagrophytes type III only from animal indicates its niche among animals. Outdated/inaccurate naming for these dermatophytes in the public database has created confusion in using appropriate species designation.

Prevalence and molecular characterization of Enterocytozoon bieneusi and a new Enterocytozoon sp. in pet hairless guinea pigs (Cavia porcellus) from China.

Enterocytozoon bieneusi, the most common microsporidian species, has been detected in humans and a variety of animals worldwide. However, limited information is available on the prevalence and molecular characterization of this parasite in guinea pigs. In this study, we conducted the first investigation of E. bieneusi infection in hairless guinea pigs recently introduced into China as new exotic pets. A total of 324 fecal samples were collected from hairless guinea pigs from a pet market and four breeding facilities in China. Sequence alignment of the internal transcribed spacer (ITS) revealed an infection rate of 14.2% (46/324) and two known ITS genotypes, S7 and PGP. Genotype S7 was the dominant genotype in these animals (42/46, 91.3%). Due to significant ITS sequence divergence, four and two PGP isolates from hairless and regular guinea pigs, respectively were further identified by PCR and phylogenetic analysis based on the small subunit (SSU) rRNA gene, as well as phylogenetic analysis of the ITS locus using E. hepatopenaei and two related genera Enterospora and Nucleospora as the outgroup. Three out of the six PGP isolates were successfully sequenced and generated the same sequences. Phylogenetic analysis of SSU rRNA and ITS loci revealed that PGP isolates formed a separate clade that was distinct and far away from E. bieneusi, suggesting that they represent a new species of Enterocytozoon. These findings indicate the dominance of zoonotic E. bieneusi genotype S7 in hairless guinea pigs and the existence of a cryptic Enterocytozoon species in guinea pigs.

Molecular detection and public health risk assessment of Cryptosporidium spp., Giardia duodenalis, Enterocytozoon bieneusi, and Blastocystis sp. of animals in a tropical wildlife park of Hainan Island, China

Objective: To detect the prevalence and characterize of Cryptosporidium spp., Giardia (G.) duodenalis, Enterocytozoon (E.) bieneusi and Blastocystis sp. of animals at a tropical wildlife park in Hainan Province, China, and to assess zoonotic risks and the potential threat of public health. Methods: Fecal specimens were collected from animals of 27 species at the wildlife park in Hainan Province, China, and detected these pathogens using polymerase chain reaction (PCR) amplifications and sequencing of gene fragments based on small subunit ribosomal RNA (SSU rRNA) gene, glutamate dehydrogenase (GDH), internal transcribed spacer (ITS) and SSU rRNA gene, respectively. Results: A total of 99 animals were studied, and 33 (33.3%) animals were found to harbor intestinal parasite, and the prevalence of Cryptosporidium spp., G. duodenalis, E. bieneusi and Blastocystis sp. were 9.1%, 2.0%, 5.1%, and 25.3%, respectively. Five Cryptosporidium species (C. parvum, C. ubiquitum, C. scrofarum, C. xiaoi and C. parvum-like), one G. duodenalis assemblages (E), four E. bieneusi ITS genotypes (CM1, HLJD-I, HNR-III and 1 novel genotype HNED-III) were detected, and seven subtypes of Blastocystis sp. (ST1, ST2, ST3, ST5, ST10, ST14 and ST15) were also identified. Conclusions: This is the first molecular detection and public health risk assessment of four intestinal protozoa species in Hainan Tropical Wildlife Park and Botanical Garden, China. Almost all species/genotypes/subtypes of four intestinal protozoa identified in this study have the potential of zoonosis and may cause public health risks.

Molecular characterization and zoonotic potential of Enterocytozoon bieneusi in ruminants in northwest China

This study was conducted to examine the molecular characteristics and assess the zoonotic potential of Enterocytozoon bieneusi in ruminants in northwest China. A total of 1581 fresh fecal samples were collected from eight categories of ruminants. The E. bieneusi was screened and genotyped via nested polymerase chain reaction (PCR) amplification targeting the internal transcribed spacer (ITS) of the small subunit rRNA (ssu rRNA) gene. The result indicated that the average infection rate of E. bieneusi in ruminants was 16.0% (253/1581), with infection rates of E. bieneusi in Mongolian sheep, Mongolian goats, Chifeng cattle, red deer, alpine musk deer, and blue sheep at 21.8% (169/777), 8.2% (46/561), 25.9% (28/108), 13.2% (5/38), 20.0% (4/20), and 6.3% (1/16), respectively. The infections of E. bieneusi varied by different categories. For the different age groups, the infection rates in lambs (29.3%, 108/369) and calves (57.1%, 8/14) were significantly higher than that in ewes (21.1%, 215/1020) and cows (21.3%, 20/94). For the molecular characterization, diverse E. bieneusi ITS genotypes were identified, with a total of 13 genotypes were observed, including 10 known genotypes (BEB6, COS-I, J, CHC8, I, CHG1, BEB4, CHG3, CHS7, and NCF2) and 3 novel genotypes (CNR1 to CNR3). Genotype BEB6 was predominant (59.7%, 151/253). Phylogenetic analysis revealed that most E. bieneusi ITS genotypes clustered into group 2 and only one (NCF2) genotype belonged to group 1. The zoonotic genotypes identified in ruminants in the present study indicated the zoonotic potential of E. bieneusi. In addition, simultaneous identification of genotypes, such as BEB6, COS-I, and BEB4, in the same eco-geographical system indicated some host multiplicity transmission potential of E. bieneusi.

Trichophyton indotineae-An Emerging Pathogen Causing Recalcitrant Dermatophytoses in India and Worldwide-A Multidimensional Perspective.

Trichophyton (T.) indotineae is a newly identified dermatophyte species that has been found in a near-epidemic form on the Indian subcontinent. There is evidence of its spread from the Indian subcontinent to a number of countries worldwide. The fungus is identical to genotype VIII within the T. mentagrophytes/T. interdigitale species complex, which was described in 2019 by sequencing the Internal Transcribed Spacer (ITS) region of ribosomal DNA of the dermatophyte. More than 10 ITS genotypes of T. interdigitale and T. mentagrophytes can now be identified. T. indotineae causes inflammatory and itchy, often widespread, dermatophytosis affecting the groins, gluteal region, trunk, and face. Patients of all ages and genders are affected. The new species has largely displaced other previously prevalent dermatophytes on the Indian subcontinent. T. indotineae has become a problematic dermatophyte due to its predominantly in vitro genetic resistance to terbinafine owing to point mutations of the squalene epoxidase gene. It also displays in vivo resistance to terbinafine. The most efficacious drug currently available for this terbinafine-resistant dermatophytoses, based on sound evidence, is itraconazole.

Molecular Investigation of Enterocytozoon bieneusi in Calves in Oromia Special Zone, Central Ethiopia

Enterocytozoon bieneusi, the most frequently diagnosed microsporidian species in humans, is also identified in a wide range of animals. The aim of this study, therefore, was to determine the prevalence and genotypes of E. bieneusi in calves and to assess its public health implications in Central Ethiopia. A total of 449 fecal samples were examined by a nested PCR targeting the internal transcribed spacer (ITS) of the rRNA gene. All positive PCR products were sequenced to determine the genotypes. Enterocytozoon bieneusi was found in 7.1% (32/449) of the calves. Difference in the infection rate was statistically significant (P < 0.05) among age groups. Out of the 10 ITS genotypes, nine belonging to the known genotypes BEB8, BEB4, BEB17, I, KIN1, Peru11, PigEBITS5, H and ET-L2; and one novel genotype (named as ET-C1) were identified. Four of the genotypes (KIN-1, Peru11, PigEBITS5, and H) were clustered to a member of a major phylogenetic group with zoonotic potential. This study constituted the first molecular characterization of E. bieneusi in Ethiopia, and it suggested a potential risk of zoonotic transmission. Studies in humans and further studies in animals are necessary to assess the public health significance of E. bieneusi.

Epidemiological and clinical aspects of Trichophyton mentagrophytes/Trichophyton interdigitale infections in the Zurich area: a retrospective study using genotyping.

Trichophyton mentagrophytes (formerly Arthroderma vanbreuseghemii) and its clonal offshoot Trichophyton interdigitale, which are leading causes of dermatophytoses, have recently been recognized as two separate species. Over the last 20years, several internal transcribed spacer (ITS) genotypes of Trichophyton mentagrophytes and Trichophyton interdigitale have been identified, some of which have specific characteristics and lead to typical clinical manifestations. The aim of this study was to determine the current epidemiology of Trichophyton mentagrophytes and Trichophyton interdigitale genotypes in Switzerland, particularly in the Zurich area. Consecutive cases diagnosed by ITS sequencing between 2009 and 2019 were retrospectively analysed. A total of 81 Trichophyton mentagrophytes and 81 Trichophyton interdigitale cases were investigated. T.mentagrophytes infections clearly differed from T.interdigitale infections by affecting younger and more frequently female patients, targeting almost exclusively head and body rather than feet and toenails, leading to inflammatory dermatophytosis and often requiring a combination of systemic and topical treatment. Seven different T. mentagrophytes genotypes (II*, III, III*, IV, VII, VIII and XXVI) were observed, with genotype XXVI being discovered in this study. Genotype III occurred most frequently (56% of all T. mentagrophytes cases) and affected predominantly children. Genotypes III* and VII led to inflammatory tinea in most cases. Four strains that proved to be terbinafine resistant belonged to the 'Indian genotype' VIII, which mostly caused tinea glutealis and inguinalis. Being able to distinguish between Trichophyton mentagrophytes and Trichophyton interdigitale is of paramount importance as the two species cause different clinical presentations. In addition, ITS genotyping allows recognizing sources of infection and potential terbinafine resistance. The latter needs to be confirmed by resistance testing or by sequencing part of the squalene epoxidase (SQLE) gene.

Characterizations of Enterocytozoon bieneusi at new genetic loci reveal a lack of strict host specificity among common genotypes and the existence of a canine-adapted Enterocytozoon species

Molecular characterizations of the microsporidian pathogen Enterocytozoon bieneusi at the ribosomal internal transcribed spacer (ITS) locus have identified nearly 500 genotypes in 11 phylogenetic groups with different host ranges. Among those, one unique group of genotypes, Group 11, is commonly found in dogs. Genetic characterizations of those and many divergent E. bieneusi genotypes at other genetic loci are thus far impossible. In this study, we sequenced 151 E. bieneusi isolates from several ITS genotype groups at the 16S rRNA locus and two new semi-conservative genetic markers (casein kinase 1 (ck1) and spore wall protein 1 (swp1)). Comparison of the near full (~1,200 bp) 16S rRNA sequences showed mostly two to three nucleotide substitutions between Group 1 and Group 2 genotypes, while Group 11 isolates differed from those by 26 (2.2%) nucleotides. Sequence analyses of the ck1 and swp1 loci confirmed the genetic uniqueness of Group 11 genotypes, which produced sequences very divergent from other groups. In contrast, genotypes in Groups 1 and 2 produced similar nucleotide sequences at these genetic loci, and there was discordant placement of ITS genotypes among loci in phylogenetic analyses of sequences. These results suggest that the canine-adapted Group 11 genotypes are genetically divergent from other genotype groups of E. bieneusi, possibly representing a different Enterocytozoon sp. They also indicate that there is no clear genetic differentiation of ITS Groups 1 and 2 at other genetic loci, supporting the conclusion on the lack of strict host specificity in both groups. Data and genetic markers from the study should facilitate population genetic characterizations of E. bieneusi isolates and improve our understanding of the zoonotic potential of E. bieneusi in domestic animals.

Population genetic analysis suggests genetic recombination is responsible for increased zoonotic potential of Enterocytozoon bieneusi from ruminants in China

Enterocytozoon bieneusi is a zoonotic pathogen with worldwide distribution. Among the 11 established groups of E. bieneusi genotypes based on phylogenetic analysis of the ribosomal internal transcribed spacer (ITS), the human-infective potential and population genetics of the Group 1 genotypes from diverse hosts are well characterized. In contrast, Group 2 genotypes from ruminants have unclear population genetics, leading to poor understanding of their host range and zoonotic potential. In this study, we sequence-characterized 121 Group 2 isolates from dairy cattle, beef cattle, yaks, Tibetan sheep, golden takins, and deer from China at five genetic loci (ITS, MS1, MS3, MS4 and MS7), comparing with data from 113 Group 1 isolates from nonhuman primates. Except for MS7, most of the genetic loci produced efficient PCR amplification and high nucleotide identity between Groups 1 and 2 of E. bieneusi genotypes. In population genetic analyses of the sequence data, a strong linkage disequilibrium was observed among these genetic loci in the overall Group 2 population. The individual ITS genotypes (I, J and BEB4) within Group 2, however, had reduced linkage disequilibrium and increased genetic exchanges among isolates. There was only partial genetic differentiation between Group 1 and Group 2 genotypes, with some occurrence of genetic recombination between them. Genetic recombination was especially common between genotypes I and J within Group 2. The data presented indicate a high genetic identity between Group 1 and Group 2 genotypes of E. bieneusi, which could be responsible for the broad host range and high zoonotic potential of Group 2 genotypes in China. As there is no effective treatment against E. bieneusi, the One Health approach should be used in the control and prevention of zoonotic transmission of the pathogen.

Multilocus sequence typing of Enterocytozoon bieneusi in crab-eating macaques (Macaca fascicularis) in Hainan, China

BackgroundEnterocytozoon bieneusi is one of common intestinal pathogens in humans and animals including non-human primates (NHPs). Many zoonotic pathogens including E. bieneusi have been found in these animals. However, there are few studies on the population structure of E. bieneusi in NHPs. To infer the gene diversity and population genetics of E. bieneusi, we selected 88 E. bieneusi-positive samples from crab-eating macaques for multilocus characterizations in this study.MethodsThe E. bieneusi isolates examined belonged to three common genotypes with different host ranges by sequence analysis of the ribosomal internal transcribed spacer (ITS): Type IV (n = 44), Macaque3 (n = 24) and Peru8 (n = 20). They were further characterized by sequence analysis at four microsatellite and minisatellite loci (MS1, MS3, MS4 and MS7). DnaSP, Arlequin and LIAN were used to analyze the sequence data together with those from the ITS locus to infer the population genetics. Subpopulation structure was inferred using phylogenetic and STRUCTURE analyses.ResultsSeventy-two (81.8%), 71 (80.7%), 76 (86.4%) and 79 (89.8%) samples were amplified and sequenced successfully at the MS1, MS3, MS4 and MS7 loci, respectively, with 53 having sequence data at all five MLST loci including ITS. Altogether, 33 multilocus genotypes (MLGs) were produced based on concatenated sequences from the 53 samples. In phylogenetic analyses of sequences and allelic data, four major subpopulations (SPs) were observed with different ITS genotypes in each of them: Type IV and Peru8 in SP1 and SP2; Type IV, Macaque3 and Peru8 in SP3; and Type IV and Macaque3 in SP4. SP3 and SP4 were phylogenetically related and might be NHP-specific based on the fact that Macaque3 is mostly found in NHPs. A strong linkage disequilibrium (LD) was observed among the multilocus sequences and allelic data.ConclusionsThe significant LD in the multilocus sequence analysis indicated the presence of an overall clonal population structure of E. bieneusi in crab-eating macaques. The inconsistent segregation of MLGs among ITS genotypes suggested some occurrence of genetic recombination. These observations should improve our understanding of the population genetics of E. bieneusi in NHPs.

Evidence for Zoonotic Potential of Enterocytozoon bieneusi in Its First Molecular Characterization in Captive Mammals at Bangladesh National Zoo.

To determine the occurrence and genotypes of Enterocytozoon bieneusi in captive mammals at Bangladesh National Zoo and to assess their zoonotic significance, 200 fecal samples from 32 mammalian species were examined using a nested PCR and sequencing of internal transcribed spacer (ITS) gene. Enterocytozoon bieneusi was detected in 16.5% (33/200) of the samples. Seven different ITS genotypes were identified, including two known genotypes (D and J) and five new ones (BAN4 to BAN8). Genotype D was the most common genotype being observed in 19 isolates. In phylogenetic analysis, four genotypes (D, BAN4, BAN5, and BAN6), detected in 30 isolates (90.9%), belonged to Group 1 having zoonotic potential. The sequence of genotype J found in a Malayan pangolin was clustered in so-called ruminant-specific Group 2. The other two genotypes BAN7 and BAN8 were clustered in primate-specific Group 5. To our knowledge, this is the first report of molecular characterization of E.bieneusi in Bangladesh, particularly in captive-bred wildlife in this country. The potentially zoonotic genotypes of E.bieneusi are maintained in zoo mammals that may transmit among these animals and to the humans through environmental contamination or contact.

Polyphasic analysis reveals correlation between phenotypic and genotypic analysis in soybean bradyrhizobia (Bradyrhizobium spp.)

Soybean bradyrhizobia (Bradyrhizobium spp.) are bacteria that fix atmospheric nitrogen within the root nodules of soybean, a crop critical for meeting global nutritional protein demand. Members of this group differ in symbiotic effectiveness, and historically both phenotypic and genotypic approaches have been used to assess bradyrhizobial diversity. However, agreement between various approaches of assessment is poorly known. A collection (n=382) of soybean bradyrhizobia (Bradyrhizobium japonicum, B. diazoefficiens, and B. elkanii) were characterized by Internal Transcribed Spacer – Restriction Fragment Length Polymorphism (ITS-RFLP), cellular fatty acid composition (fatty acid methyl esters, FAME), and serological reactions to assess agreement between phenotypic and genotypic methods. Overall, 76% of the accessions demonstrated identical clustering with each of these techniques. FAME was able to identify all 382 accessions, whereas 14% were non-reactive serologically. One ITS-RFLP group, containing 36 Delaware isolates, produced multiple ITS amplicons indicating they possess multiple ribosomal RNA (rrn) operons. Cloning and sequencing revealed that these strains contained as many as three heterogenous rrn operons, a trait previously unknown in bradyrhizobia. A representative subset of 96 isolates was further characterized using 16S rRNA and Internal Transcribed Spacer (ITS) amplicon sequencing. ITS sequences showed better inter- and intra-species discrimination (65–99% identity) than 16S sequences (96–99% identity). This study shows that phenotypic and genotypic approaches are strongly correlated at the species level but should be approached with caution. We also suggest using combined 16S and ITS genotyping data to obtain better inter- and intra-species resolution in bradyrhizobia classification.

Molecular identification and genotyping of Enterocytozoon bieneusi in experimental rats in China

Experimental rats are important animal models, and a history of pathogenic infections in these animals will directly affect the animal trial results. Enterocytozoon bieneusi is a ubiquitous potential pathogen transmitted via the fecal-oral route. To determine the prevalence and genotypic distributions of E. bieneusi in experimental rats in China, 291 fresh fecal samples were collected from four medical experimental animal centers. Enterocytozoon bieneusi was screened via nested-PCR amplification of the internal transcribed spacer (ITS) region. Of the rats tested, 4.8% (14/291) were positive for E. bieneusi. Five E. bieneusi ITS genotypes (four known: EbpA, EbpC, CHY1, and N; one novel: SHR1) were detected among 14 sequenced samples. The dominant E. bieneusi genotype was EbpA (50.0%, 7/14). In the phylogenetic analysis, genotypes EbpA and EbpC belonged to the previously described group 1, genotypes N and SHR1 belonged to group 2, and genotype CHY1 belonged to the novel group 12. To our knowledge, this is the first report of E. bieneusi in experimental laboratory rats in China. Infections with this pathogen must be monitored in laboratory animals, and quality control officers in the medical experimental centers should attempt to trace the pathogen's source and stop its transmission.

Molecular Characterization and Phylogenetic Analysis of Enterocytozoon bieneusi in Lambs in Oromia Special Zone, Central Ethiopia.

Enterocytozoon bieneusi is the most frequently diagnosed microsporidian species in humans and occurs in a wide range of animals. This study was conducted in Central Ethiopia to determine the prevalence and genotypes of E. bieneusi in lambs in order to evaluate their public health significance. Three hundred eighty nine fecal samples were collected and screened using a nested PCR targeting the internal transcribed spacer (ITS) of the ribosomal RNA gene. All positive PCR products were sequenced to determine the genotypes. E. bieneusi was found in 39 (10.03%) of the lambs. Differences in the infection rates among sex and age groups were not significant (P > 0.05). Five ITS genotypes belonging to three known genotypes BEB6, COS-I, and COS-II, and two novel genotypes (ET-L1 and ET-L2) were identified in lambs. All five genotypes identified in the present study clustered within cattle-specific Group 2 in the ITS phylogenetic tree. This first molecular detection and characterization of E. bieneusi in lambs in Ethiopia has identified the need for further studies in humans and other domestic animals in order to determine the public health significance of E. bieneusi in Ethiopia.

Metataxonomics of Internal Transcribed Spacer amplicons in cerebrospinal fluid for diagnosing and genotyping of cryptococcal meningitis.

Cryptococcal meningitis is a severe infectious disease associated with high morbidity and mortality. Rapidity and accuracy of diagnosis contribute to better prognosis, but readily available tools, such as microscopy, culture, and antigens do not perform well all the time. Our study attempted to diagnose and genotype cryptococcus in the cerebrospinal fluid (CSF) samples from patients with cryptococcal meningitis using the approach of metataxonomics of Internal Transcribed Spacer (ITS) amplicons. The CSF samples were collected from 11 clinically suspected cryptococcal meningitis patients and four non-infectious controls. Samples were recruited from the First Affiliated Hospital of Fujian Medical University Hospital, Fuzhou Fourth Hospital and the 476th Hospital of Chinese People's Liberation Army from December 2017 to December 2018. ITS1 ribosomal deoxyribonucleic acid (rDNA) genes of 15 whole samples were amplified by universal forward primer ITS1 (CTTGGTCATTTAGAGGAAGTAA) and reverse primer ITS2 (GCTGCGTTCTTCATCGATGC), sequenced by Illumina MiSeq Benchtop Sequencer. The results were confirmed by sanger sequencing of ITS1 region and partial CAP59 gene of microbial isolates from 11 meningitic samples. Pair-wise comparison between infectious group and control group was conducted through permutational multivariate analysis (PERMANOVA) in R software. The 30,000 to 340,000 high-quality clean reads were obtained from each of the positively stained or cultured CSF samples and 8 to 60 reads from each control. The samples from 11 infected patients yielded detectable cryptococcal-specific ITS1 DNA with top abundance (from 95.90% to 99.97%), followed by many other fungal groups (each <1.41%). ITS genotype was defined in 11 CSF samples, corresponding to ITS type 1, and confirmed by Sanger sequencing. A statistically significant difference (r = 0.65869, P = 0.0014) between infectious group and control group was observed. The metataxonomics of ITS amplicons facilitates the diagnosis and genotype of cryptococcus in CSF samples, which may provide a better diagnostic approach of cryptococcal infection.

Genotyping of Enterocytozoon bieneusi among captive long-tailed macaques (Macaca fascicularis) in Hainan Province: High genetic diversity and zoonotic potential

Enterocytozoon bieneusi is a potentially important zoonotic pathogen. However, there is no information on E. bieneusi infection of captive long-tailed macaques (Macaca fascicularis) in Hainan Province, China. Here 193 fecal specimens of M. fascicularis were collected from a breeding base in Hainan Province, China, housing non-human primates for experimental use. E. bieneusi was identified and genotyped by nested PCR analysis of the internal transcribed spacer (ITS) region of the rRNA gene. A total of 59 (30.6%) specimens were PCR-positive for E. bieneusi and 16 ITS genotypes were identified including nine known genotypes: Type IV (n = 19), D (n = 11), CM1 (n = 8), PigEBITS7 (n = 4), Pongo2 (n = 4), Peru8 (n = 3), Peru11 (n = 1), WL21 (n = 1) and CM2 (n = 1) and seven novel genotypes HNM-I to HNM-VII (one each). Importantly, genotypes D, Type IV, Peru8, PigEBITS7, and Peru11, which were the predominant (38/59, 64.4%) genotypes identified among captive M. fascicularis in this study, are also well-known human-pathogenic genotypes. All the genotypes of E. bieneusi identified here, including the seven novel ones, belonged to zoonotic Group 1. This is the first report of the identification of E. bieneusi in M. fascicularis in Hainan Province, China. The finding that the numerous known human-pathogenic types and seven novel genotypes of E. bieneusi all belong to zoonotic Group 1 indicates the possibility of transmission of this important pathogenic parasite between M. fascicularis and humans.

Trichophyton mentagrophytes and Tinterdigitale genotypes are associated with particular geographic areas and clinical manifestations.

The fungi Trichophyton mentagrophytes and Tinterdigitale account for significant amount of dermatophytosis cases worldwide. These two dermatophytes form a species complex and have a number of ribosomal internal transcribed spacer (ITS) region genotypes, allowing simultaneous species identification and strain typing. Our aim was to describe the geographic distribution of Tmentagrophytes/Tinterdigitale ITS region genotypes and find an association between the genotypes and clinical presentations of respective infections. We performed rDNA ITS region sequencing in 397 Iranian Tmentagrophytes/Tinterdigitale isolates and analysed all available in GenBank entries with sequences of this kind. For the study, 515 clinical annotations were available. Statistical analysis was performed by chi-squared test and Spearman rank correlation analysis. A total of 971 sequences belonged to genotypes with at least 10 geographic annotations and were classified on the basis of exclusive occurrence in a particular region or high relative contribution to a regional sample. We discerned Asian and Oceanian ("KU496915" Type V, "KT192500" Type VIII, "KU315316"), European ("FM986750" Type III, "MF926358" Type III*, "KT285210" Type VI) and cosmopolitan ("FM986691" Type I, "JX122216" Type II, "KP132819" Type II* and "AF170453" Type XXIV) genotypes. There was statistically significant difference in the ITS genotype distribution between different affected body sites. Trichophyton mentagrophytes "KT192500" Type VIII correlated with tinea cruris, Tmentagrophytes "KU496915" Type V correlated with tinea corporis, Tinterdigitale "JX122216" Type II correlated with tinea pedis and onychomycosis. Trichophyton mentagrophytes and Tinterdigitale genotypes can be associated with distinct geographic locations and particular clinical presentations.

In Situ Collection and Preservation of Intact Microcystis Colonies to Assess Population Diversity and Microcystin Quotas.

Understanding of colony specific properties of cyanobacteria in the natural environment has been challenging because sampling methods disaggregate colonies and there are often delays before they can be isolated and preserved. Microcystis is a ubiquitous cyanobacteria that forms large colonies in situ and often produces microcystins, a potent hepatotoxin. In the present study a new cryo-sampling technique was used to collect intact Microcystis colonies in situ by embedding them in a sheet of ice. Thirty-two of these Microcystis colonies were investigated with image analysis, liquid chromatography-mass spectrometry, quantitative polymerase chain reaction and high-throughput sequencing to assess their volume, microcystin quota and internal transcribed spacer (ITS) genotype diversity. Microcystin quotas were positively correlated to colony volume (R2 = 0.32; p = 0.004). Individual colonies had low Microcystis ITS genotype diversity and one ITS operational taxonomic unit predominated in all samples. This study demonstrates the utility of the cryo-sampling method to enhance the understanding of colony-specific properties of cyanobacteria with higher precision than previously possible.

Predominance of Trichophyton interdigitale Revealed in Podiatric Nail Dust Collections in Eastern Australia.

Toenail onychomycosis caused by dermatophytes is a significant medical and financial worldwide burden. Relatively scant research has been undertaken as to the predominant species and strains causing this condition in Australia, which is a unique isolated continent with diverse geographical, climatic and population regions. Four regions were selected in Eastern Australia: Far North Queensland, Rural Victoria, Melbourne Metropolitan and Tasmania. From each of these areas, communal nail dust bags from podiatric physicians' work were collected and analysed. A total of 32 dust bags were collected: 10 from Far North Queensland, 8 from Melbourne Metropolitan, 8 from Rural Victoria and 6 from Tasmania. Dermatophyte test medium was used to isolate dermatophytes from the dust, and the colonies were subcultured to Potato Dextrose Agar. Of the bags collected, in total 69% were positive for dermatophytes: 40% from Far North Queensland, 75% from Melbourne Metropolitan, 88% from Rural Victoria and 83% from Tasmania. The internal transcribed spacer (ITS) region of ribosomal DNA was used to identify and compare isolates. A total of 148 dermatophyte strains were identified. The predominant species isolated was Trichophyton interdigitale (125 isolates), which was found in all four regions. This species was further subdivided into four ITS genotypes: the first two were present in all regions, but the third was found only in the Melbourne Metropolitan area and the fourth only in Tasmania. Only one strain of Trichophyton rubrum was found and only in Rural Victoria. Eighteen isolates of Arthroderma quadrifidum were cultured from Rural Victoria and Tasmania and were further classified into three ITS genotypes. Some isolates rarely reported in clinical material were identified as Paraphyton cookei, Arthroderma tuberculatum and Arthroderma crocatum. A potentially new species of Arthroderma was also found in Melbourne Metropolitan. These findings reveal a unique dermatophyte fingerprint in toenails for Eastern Australia.