Internal Transcribed Spacer Amplicons Research Articles

Distance from the Forest Edge Influences Soil Fungal Communities Colonizing a Reclaimed Soil Borrow Site in Boreal Mixedwood Forest

Soil fungi are important components of boreal forest ecosystems; for example, saprotrophic fungi regulate nutrient cycling, and mycorrhizal species facilitate nutrient uptake by plants. This study aimed to assess soil fungal communities in a reclaimed area and an adjacent natural mixedwood forest and to identify the distribution of taxa available for seedling colonization. Soil fungal microbiomes were assessed along three transects (from 10 m inside the interior of the undisturbed forest to 40 m inside the reclaimed area) and in the roots of small aspen within the natural forest. Using high-throughput deoxyribonucleic acid (DNA) sequencing of internal transcribed spacer amplicons, a total of 2796 unique fungal taxa were detected across fine roots, forest floor, and mineral soils collected along the transects, whereas 166 taxa were detected in the aspen roots from the natural forest. Within the interior of the forest, ectomycorrhizal fungi were more common, whereas in the reclaimed areas, arbuscular mycorrhizae and saprophytes were more common. This survey showed that natural areas of adjacent undisturbed forest can act as a source of ectomycorrhizal fungi for dispersal into reclaimed areas. Notably, soil fungal taxa colonizing the root systems of small aspen included species that are specifically associated with soils from the undisturbed forest (primarily ectomycorrhizae) or the reclaimed clearing (saprotrophs and plant pathogens).

A simple and effective method to discern the true commercial Chinese cordyceps from counterfeits

The Chinese cordyceps, a complex of the fungus Ophiocordyceps sinensis and its species-specific host insects, is also called “DongChongXiaCao” in Chinese. Habitat degradation in recent decades and excessive harvesting by humans has intensified its scarcity and increased the prices of natural populations. Some counterfeits are traded as natural Chinese cordyceps for profit, causing confusion in the marketplace. To promote the safe use of Chinese cordyceps and related products, a duplex PCR method for specifically identifying raw Chinese cordyceps and its primary products was successfully established. Chinese cordyceps could be precisely identified by detecting an internal transcribed spacer amplicon from O. sinensis and a cytochrome oxidase c subunit 1 amplicon from the host species, at a limit of detection as low as 32 pg. Eleven commercial samples were purchased and successfully tested to further verify that the developed duplex PCR method could be reliably used to identify Chinese cordyceps. It provides a new simple way to discern true commercial Chinese cordyceps from counterfeits in the marketplace. This is an important step toward achieving an authentication method for this Chinese medicine. The methodology and the developmental strategy can be used to authenticate other traditional Chinese medicinal materials.

Polyphasic analysis reveals correlation between phenotypic and genotypic analysis in soybean bradyrhizobia (Bradyrhizobium spp.)

Soybean bradyrhizobia (Bradyrhizobium spp.) are bacteria that fix atmospheric nitrogen within the root nodules of soybean, a crop critical for meeting global nutritional protein demand. Members of this group differ in symbiotic effectiveness, and historically both phenotypic and genotypic approaches have been used to assess bradyrhizobial diversity. However, agreement between various approaches of assessment is poorly known. A collection (n=382) of soybean bradyrhizobia (Bradyrhizobium japonicum, B. diazoefficiens, and B. elkanii) were characterized by Internal Transcribed Spacer – Restriction Fragment Length Polymorphism (ITS-RFLP), cellular fatty acid composition (fatty acid methyl esters, FAME), and serological reactions to assess agreement between phenotypic and genotypic methods. Overall, 76% of the accessions demonstrated identical clustering with each of these techniques. FAME was able to identify all 382 accessions, whereas 14% were non-reactive serologically. One ITS-RFLP group, containing 36 Delaware isolates, produced multiple ITS amplicons indicating they possess multiple ribosomal RNA (rrn) operons. Cloning and sequencing revealed that these strains contained as many as three heterogenous rrn operons, a trait previously unknown in bradyrhizobia. A representative subset of 96 isolates was further characterized using 16S rRNA and Internal Transcribed Spacer (ITS) amplicon sequencing. ITS sequences showed better inter- and intra-species discrimination (65–99% identity) than 16S sequences (96–99% identity). This study shows that phenotypic and genotypic approaches are strongly correlated at the species level but should be approached with caution. We also suggest using combined 16S and ITS genotyping data to obtain better inter- and intra-species resolution in bradyrhizobia classification.

Metataxonomics of Internal Transcribed Spacer amplicons in cerebrospinal fluid for diagnosing and genotyping of cryptococcal meningitis.

Cryptococcal meningitis is a severe infectious disease associated with high morbidity and mortality. Rapidity and accuracy of diagnosis contribute to better prognosis, but readily available tools, such as microscopy, culture, and antigens do not perform well all the time. Our study attempted to diagnose and genotype cryptococcus in the cerebrospinal fluid (CSF) samples from patients with cryptococcal meningitis using the approach of metataxonomics of Internal Transcribed Spacer (ITS) amplicons. The CSF samples were collected from 11 clinically suspected cryptococcal meningitis patients and four non-infectious controls. Samples were recruited from the First Affiliated Hospital of Fujian Medical University Hospital, Fuzhou Fourth Hospital and the 476th Hospital of Chinese People's Liberation Army from December 2017 to December 2018. ITS1 ribosomal deoxyribonucleic acid (rDNA) genes of 15 whole samples were amplified by universal forward primer ITS1 (CTTGGTCATTTAGAGGAAGTAA) and reverse primer ITS2 (GCTGCGTTCTTCATCGATGC), sequenced by Illumina MiSeq Benchtop Sequencer. The results were confirmed by sanger sequencing of ITS1 region and partial CAP59 gene of microbial isolates from 11 meningitic samples. Pair-wise comparison between infectious group and control group was conducted through permutational multivariate analysis (PERMANOVA) in R software. The 30,000 to 340,000 high-quality clean reads were obtained from each of the positively stained or cultured CSF samples and 8 to 60 reads from each control. The samples from 11 infected patients yielded detectable cryptococcal-specific ITS1 DNA with top abundance (from 95.90% to 99.97%), followed by many other fungal groups (each <1.41%). ITS genotype was defined in 11 CSF samples, corresponding to ITS type 1, and confirmed by Sanger sequencing. A statistically significant difference (r = 0.65869, P = 0.0014) between infectious group and control group was observed. The metataxonomics of ITS amplicons facilitates the diagnosis and genotype of cryptococcus in CSF samples, which may provide a better diagnostic approach of cryptococcal infection.

Fungi associated with tree species at an Alberta oil sands reclamation area, as determined by sporocarp assessments and high-throughput DNA sequencing

Gateway Hill is a 104-ha area in the oil sands region of Alberta, which was operationally reclaimed and reforested in the late 1980s and certified as reclaimed in 2007/08. In 2014, ∼30 years after reclamation was completed, we began studies with the main objective to determine the soil fungi present at the site. Sporocarp surveys in 2014 and 2016 were used to supplement metagenomic analyses of soil fungi in jack pine (Pinus banksiana), white spruce (Picea glauca), and Siberian larch (Larix sibirica) stands. Fungal internal transcribed spacer amplicons of DNA extracted from forest floor, root, and fine soil fractions were sequenced using Roche 454 pyrosequencing in 2014. Coarse soil reclamation samples and soil samples from a nearby unmined spruce stand were sequenced with Illumina in 2016. Sequenced community assemblages were first assessed using unconstrained multivariate analyses, and then using (partially) constrained ordination techniques to directly account for the effects of tree species and other confounding factors. Based on soil DNA analyses the relative abundance of ectomycorrhizal taxa was greater in spruce stands, saprotrophs were more abundant in pine stands, and pathogens were more abundant in larch stands. Associations of fungal taxa, mostly saprotrophs and ectomycorrhizae, with tree species were especially prominent in root fractions. The sporocarp survey found sporcarp abundance was greatest in pine stands and they tended to have more ectomycorrhizal taxa and spruce and larch stands more saprotrophic taxa. The effects of tree species on fungal taxa differed between the sporocarp surveys and soil DNA analyses: many of the fungi identified by sporocarp presence were not detected by soil DNA sequencing, whereas the latter method detected many more species in all trophic groups. Both DNA sequencing methods showed that many operational taxonomic units were preferentially associated with either spruce or pine stands. Though not definitive, preliminary examination of soil fungi using the Illumina platform showed that a natural spruce stand at the base of Gateway Hill had greater species richness than did reclaimed spruce stands. The results of this study show that communities of soil fungi have become established since the initiation of reclamation. Further work is underway to compare this reclamation site to other unmined forest sites.

Characterization of the Mycobiome of the Seagrass, Zostera marina, Reveals Putative Associations With Marine Chytrids.

Seagrasses are globally distributed marine flowering plants that are foundation species in coastal ecosystems. Seagrass beds play essential roles as habitats and hatcheries, in nutrient cycling, and in protecting the coastline from erosion. Although many studies have focused on seagrass ecology, only a limited number have investigated their associated fungi. In terrestrial systems, fungi can have beneficial and detrimental effects on plant fitness. However, not much is known about marine fungi and even less is known about seagrass associated fungi. Here we used culture-independent sequencing of the ribosomal internal transcribed spacer (ITS) region to characterize the taxonomic diversity of fungi associated with the seagrass, Zostera marina. We sampled from two Z. marina beds in Bodega Bay over three time points to investigate fungal diversity within and between plants. Our results indicate that there are many fungal taxa for which a taxonomic assignment cannot be made living on and inside Z. marina leaves, roots and rhizomes and that these plant tissues harbor distinct fungal communities. We also identified differences in the abundances of the orders, Glomerellales, Agaricales and Malasseziales, between seagrass tissues. The most prevalent ITS amplicon sequence variants (ASVs) associated with Z. marina tissues could not initially be confidently assigned to a fungal phylum, but shared significant sequence similarity with Chytridiomycota and Aphelidomycota. To obtain a more definitive taxonomic classification of the most abundant ASV associated with Z. marina leaves, we used PCR with one primer targeting a unique region of this ASV’s ITS2 and a second primer targeting fungal 28S rRNA genes to amplify part of the 28S rRNA gene region corresponding to this ASV. Sequencing and phylogenetic analysis of the resulting partial 28S rRNA gene revealed that the organism that this ASV comes from is a member of Novel Clade SW-I in the order Lobulomycetales in the phylum Chytridiomycota. This clade includes known parasites of freshwater diatoms and algae and it is possible this chytrid is directly infecting Z. marina leaf tissues. This work highlights a need for further studies focusing on marine fungi and the potential importance of these understudied communities to the larger seagrass ecosystem.

Intestinal Fungal Dysbiosis and Systemic Immune Response to Fungi in Patients With Alcoholic Hepatitis.

Chronic alcohol consumption causes increased intestinal permeability and changes in the intestinal microbiota composition, which contribute to the development and progression of alcohol-related liver disease. In this setting, little is known about commensal fungi in the gut. We studied the intestinal mycobiota in a cohort of patients with alcoholic hepatitis, patients with alcohol use disorder, and nonalcoholic controls using fungal-specific internal transcribed spacer amplicon sequencing of fecal samples. We further measured serum anti-Saccharomyces cerevisiae antibodies (ASCA) as a systemic immune response to fungal products or fungi. Candida was the most abundant genus in the fecal mycobiota of the two alcohol groups, whereas genus Penicillium dominated the mycobiome of nonalcoholic controls. We observed a lower diversity in the alcohol groups compared with controls. Antibiotic or steroid treatment was not associated with a lower diversity. Patients with alcoholic hepatitis had significantly higher ASCA levels compared to patients with alcohol use disorder and to nonalcoholic controls. Within the alcoholic hepatitis cohort, patients with levels of at least 34 IU/mL had a significantly lower 90-day survival (59%) compared with those with ASCA levels less than 34 IU/mL (80%) with an adjusted hazard ratio of 3.13 (95% CI, 1.11-8.82; P=0.031). Conclusion: Patients with alcohol-associated liver disease have a lower fungal diversity with an overgrowth of Candida compared with controls. Higher serum ASCA was associated with increased mortality in patients with alcoholic hepatitis. Intestinal fungi may serve as a therapeutic target to improve survival, and ASCA may be useful to predict the outcome in patients with alcoholic hepatitis.

Soil Microbial Community Responses After Amendment with Thermally Altered Pinus radiata Needles.

Post-fire litter layers are composed of leaves and woody debris that predominantly fall during or soon after the fire event. These layers are distinctly different to pre-fire litters due to their common origin and deposition time. However, heterogeneity can arise from the variable thermal conditions in the canopy during fire. Therefore, in this study, we used thermally altered pine needles (heated to 40 °C, 150 °C, 260 °C and 320 °C for 1 h) in a laboratory incubation study for 43 days. These samples were measured for respiration throughout and extracted for DNA at the experiment's end; soil ribosomal RNA was analysed using Illumina sequencing (16S and internal transcribed spacer amplicons). The addition of pine needles heated to 40 °C or 150 °C caused a substantial shift in community structure, decreased alpha diversity and significantly increased soil respiration relative to the control treatment. In contrast, pine needles heated to 260 °C or 320 °C had little effect on microbial community structure or soil respiration. These results indicate that highly thermally altered needles are not microbially decomposed during the first 43 days of exposure and therefore that biomass temperature may have significant effects on post-fire litter decomposition and carbon flux. This research outlines an important knowledge gap in forest fire responses that may affect post-fire carbon emission estimates.

Bacterial and Fungal Endophytic Microbiomes of Salicornia europaea.

We examined Salicornia europaea, a nonmycorrhizal halophyte associated with specific and unique endophytic bacteria and fungi. The microbial community structure was analyzed at two sites differing in salinization history (anthropogenic and naturally saline site), in contrasting seasons (spring and fall) and in two plant organs (shoots and roots) via 16S rRNA and internal transcribed spacer amplicon sequencing. We observed distinct communities at the two sites, and in shoots and roots, while the season was of no importance. The bacterial community was less diverse in shoot libraries than in roots, regardless of the site and season, whereas no significant differences were observed for the fungal community. Proteobacteria and Bacteroidetes dominated bacterial assemblages, and Ascomycetes were the most frequent fungi. A root core microbiome operational taxonomic unit belonging to the genus Marinimicrobium was identified. We detected a significant influence of the Salicornia bacterial community on the fungal one by means of cocorrespondence analysis. In addition, pathways and potential functions of the bacterial community in Salicornia europaea were inferred and discussed. We can conclude that bacterial and fungal microbiomes of S. europaea are determined by the origin of salinity at the sites. Bacterial communities seemed to influence fungal ones, but not the other way around, which takes us closer to understanding of interactions between the two microbial groups. In addition, the plant organs of the halophyte filter the microbial community composition.IMPORTANCE Endophytes are particularly fascinating because of their multifaceted lifestyle, i.e., they may exist as either free-living soil microbes or saprobic ones or pathogens. Endophytic communities of halophytes may be different than those in other plants because salinity acts as an environmental filter. At the same time, they may contribute to the host's adaptation to adverse environmental conditions, which may be of importance in agriculture.

Endophytic Communities of Transgenic Poplar Were Determined by the Environment and Niche Rather Than by Transgenic Events.

Microbial communities associated with plants represent key determinants of plant health, survival, and growth. However, a good understanding of the structural composition of the bacterial and fungal microbiome present in different plant tissues and growing environments, especially in transgenic woody plants, is required. In the present study, we hypothesized that environmental conditions, ecological niches, and transgenic events could influence the community structure of plant-associated microorganisms (bacterial and fungal endophytes). We sampled the root and stem endospheres of field-grown transgenic and non-transgenic poplar trees (Populus alba × P. berolinensis) and applied 16S rRNA and internal transcribed spacer amplicon Illumina MiSeq sequencing to determine the bacterial and fungal communities associated with the different plant habitats and tissues. We found that actinobacteria, proteobacteria, bacteroidetes, and firmicutes were the dominant endophytic bacteria, and the fungal community was dominated by dothideomycetes, agaricomycetes, leotiomycetes, and sordariomycetes. In conclusion, transgenic events did not affect the endophytic bacterial and fungal diversity of poplar trees. The bacterial and fungal community structure depends on the pH and the soil organic matter content. Each plant tissue represents a unique ecological niche for the microbial communities. Finally, we identified the indicator operational taxonomic units (OTUs) and core microbiome associated with the different plant tissues of Populus and different environmental conditions. The results provide a basis for further study of host-microbial interactions with the identified abundant OTUs of Populus.

Petunia- and Arabidopsis-Specific Root Microbiota Responses to Phosphate Supplementation

Phosphorus (P) is a limiting element for plant growth. Several root microbes, including arbuscular mycorrhizal fungi (AMF), have the capacity to improve plant nutrition and their abundance is known to depend on P fertility. However, how complex root-associated bacterial and fungal communities respond to various levels of P supplementation remains ill-defined. Here we investigated the responses of the root-associated bacteria and fungi to varying levels of P supply using 16S rRNA gene and internal transcribed spacer amplicon sequencing. We grew Petunia, which forms symbiosis with AMF, and the nonmycorrhizal model species Arabidopsis as a control in a soil that is limiting in plant-available P and we then supplemented the plants with complete fertilizer solutions that varied only in their phosphate concentrations. We searched for microbes, whose abundances varied by P fertilization, tested whether a core microbiota responding to the P treatments could be identified and asked whether bacterial and fungal co-occurrence patterns change in response to the varying P levels. Root microbiota composition varied substantially in response to the varying P application. A core microbiota was not identified as different bacterial and fungal groups responded to low-P conditions in Arabidopsis and Petunia. Microbes with P-dependent abundance patterns included Mortierellomycotina in Arabidopsis, while in Petunia, they included AMF and their symbiotic endobacteria. Of note, the P-dependent root colonization by AMF was reliably quantified by sequencing. The fact that the root microbiotas of the two plant species responded differently to low-P conditions suggests that plant species specificity would need to be considered for the eventual development of microbial products that improve plant P nutrition. [Formula: see text]Copyright © 2019 The Author(s). This is an open access article distributed under the CC BY-NC-ND 4.0 International license .

Belowground fungal community diversity and composition associated with Norway spruce along an altitudinal gradient.

Altitudinal gradients provide valuable information about the effects of environmental variables on changes in species richness and composition as well as the distribution of below ground fungal communities. Since most knowledge in this respect has been gathered on aboveground communities, we focused our study towards the characterization of belowground fungal communities associated with two different ages of Norway spruce (Picea abies) trees along an altitudinal gradient. By sequencing the internal transcribed spacer (ITS) region on the Illumina platform, we investigated the fungal communities in a floristically and geologically relatively well explored forest on the slope of Mt. Iseler of the Bavarian Alps. From fine roots and rhizosphere of a total of 90 of Norway spruce trees from 18 plots we detected 1285 taxa, with a range of 167 to 506 (average 377) taxa per plot. Fungal taxa are distributed over 96 different orders belonging to the phyla Ascomycota, Basidiomycota, Chrytridiomycota, Glomeromycota, and Mucoromycota. Overall the Agaricales (438 taxa) and Tremellales (81 taxa) belonging to the Basidiomycota and the Hypocreales (65 spp.) and Helotiales (61 taxa) belonging to the Ascomycota represented the taxon richest orders. The evaluation of our multivariate generalized mixed models indicate that the altitude has a significant influence on the composition of the fungal communities (p < 0.003) and that tree age determines community diversity (p < 0.05). A total of 47 ecological guilds were detected, of which the ectomycorrhizal and saprophytic guilds were the most taxon-rich. Our ITS amplicon Illumina sequencing approach allowed us to characterize a high fungal community diversity that would not be possible to capture with fruiting body surveys alone. We conclude that it is an invaluable tool for diverse monitoring tasks and inventorying biodiversity, especially in the detection of microorganisms developing very ephemeral and/or inconspicuous fruiting bodies or lacking them all together. Results suggest that the altitude mainly influences the community composition, whereas fungal diversity becomes higher in mature/older trees. Finally, we demonstrate that novel techniques from bacterial microbiome analyses are also useful for studying fungal diversity and community structure in a DNA metabarcoding approach, but that incomplete reference sequence databases so far limit effective identification.

Changes in rhizosphere microbial communities in potted cucumber seedlings treated with syringic acid.

Phytotoxic effects of phenolic compounds have been extensively studied, but less attention has been given to the effects of these compounds on soil microbial communities, which are crucial to the productivity of agricultural systems. Responses of cucumber rhizosphere bacterial and fungal communities to syringic acid (SA), a phenolic compound with autotoxicity to cucumber, were analyzed by high-throughput sequencing of 16S rRNA gene and internal transcribed spacer amplicons. SA at the concentration of 0.1 μmol g-1 soil changed rhizosphere bacterial and fungal community compositions, decreased bacterial community diversity but increased fungal community richness and diversity (P<0.05). Moreover, SA increased the relative abundances of bacterial phylum Proteobacteria and fungal classes Leotiomycetes, Pezizomycetes, Tremellomycetes and Eurotiomycetes, but decreased the relative abundances of bacterial phylum Firmicutes and fungal class Sordariomycetes (P<0.05). At the genus level, SA decreased the relative abundances of microbial taxa with pathogen-antagonistic and/or plant growth promoting potentials, such as Pseudomonas spp. (P<0.05). Real-time PCR validated that SA decreased cucumber rhizosphere Pseudomonas spp. abundance (P<0.05). In vitro study showed that SA (0.01 to 10 mM) inhibited the growth of a strain of Pseudomonas spp. with pathogen-antagonistic activities to cucumber pathogen Fusarium oxysporum f.sp. cucumerinum Owen (P<0.05). Overall, SA changed cucumber rhizosphere bacterial and fungal community compositions, which may exert negative effects on cucumber seedling growth through inhibiting plant-beneficial microorganisms.

Microbial Community Analyses of the Deteriorated Storeroom Objects in the Tianjin Museum Using Culture-Independent and Culture-Dependent Approaches.

In the storeroom C7 of the Tianjin Museum, one wooden desk and two leather luggages dated back to Qing dynasty (1644-1912 AD) presented viable microbial contamination. The aim of the present study was to investigate microbial communities responsible for the biodeterioration of storeroom objects using a combination of culture-independent and culture-dependent methods as well microscopic techniques. Scanning electron microscopy (SEM) revealed that the microflora on three storeroom objects were characterized by a marked presence of Eurotium halophilicum. Real-time quantitative polymerase chain reaction (qPCR) analysis proved that fungi were the main causative agents behind the biodeterioration in this case. Fungal internal transcribed spacer (ITS) amplicon sequencing documented the presence of two main fungi — Eurotium halophilicum and Aspergillus penicillioides. Molecular identification of fungal strains isolated from the surfaces and the air of the storeroom were most closely related to Chaetomium, Aspergillus, Penicillium, and Fusarium, showing discrepancies in fungal taxa compared to ITS amplicon sequencing. The most isolated bacterial phylum was Firmicutes, mostly Bacillus members. In addition, four biocide products — Preventol® D 7, P 91, 20 N and Euxyl® K 100 were selected to test their capability against fungal strains isolated from the surfaces. According to the susceptibility assay, Preventol® D 7 based on isothiazolinones was the most effective against fungal isolates. Findings from this study provided a knowledge about storeroom fungi, and exemplify a type of preliminary test that may be conducted before planning any biocide treatment, which may be useful to mitigate the fungal deterioration for further conservation of the museum.

P-Coumaric can alter the composition of cucumber rhizosphere microbial communities and induce negative plant-microbial interactions

Phenolics from root exudates or decaying residues are usually referred as autotoxins of several plant species. However, how phenolics affect soil microbial communities and their functional significances are poorly understood. Rhizosphere bacterial and fungal communities from cucumber (Cucumis sativus L.) seedlings treated with p-coumaric acid, an autotoxin of cucumber, were analyzed by high-throughput sequencing of 16S rRNA gene and internal transcribed spacer amplicons. Then, feedback effects of the rhizosphere biota on cucumber seedlings were evaluated by inoculating non-sterilized and sterilized rhizosphere soils to sterilized background soils. p-Coumaric acid decreased the bacterial diversity of rhizosphere but increased fungal diversity and altered the compositions of both the bacterial and fungal communities. p-Coumaric acid increased the relative abundances of microbial taxa with phenol-degrading capability (such as Chaetomium, Humicola, and Mortierella spp.) and microbial taxa which contained plant pathogens (such as Fusarium spp.). However, p-coumaric acid inhibited the relative abundances of Lysobacter, Haliangium, and Gymnoascus spp., whose species can have pathogen-antagonistic and/or plant-growth-promoting effects. The positive effect of cucumber rhizosphere microbiota on cucumber seedling growth was reduced by p-coumaric acid. Overall, our results showed that, besides its direct phytotoxicity, p-coumaric acid can inhibit cucumber seedling growth through generating negative plant-soil microbial interactions.

Different Amplicon Targets for Sequencing-Based Studies of Fungal Diversity

Target-gene amplicon sequencing is the most exploited high-throughput sequencing application in microbial ecology. The targets are taxonomically relevant genes, with 16S rRNA being the gold standard for bacteria. As for fungi, the most commonly used target is the internal transcribed spacer (ITS). However, the uneven ITS length among species may promote preferential amplification and sequencing and incorrect estimation of their abundance. Therefore, the use of different targets is desirable. We evaluated the use of three different target amplicons for the characterization of fungal diversity. After an in silico primer evaluation, we compared three amplicons (the ITS1-ITS2 region [ITS1-2], 18S ribosomal small subunit RNA, and the D1/D2 domain of the 26S ribosomal large subunit RNA), using biological samples and a mock community of common fungal species. All three targets allowed for accurate identification of the species present. Nevertheless, high heterogeneity in ITS1-2 length was found, and this caused an overestimation of the abundance of species with a shorter ITS, while both 18S and 26S amplicons allowed for more reliable quantification. We demonstrated that ITS1-2 amplicon sequencing, although widely used, may lead to an incorrect evaluation of fungal communities, and efforts should be made to promote the use of different targets in sequencing-based microbial ecology studies.IMPORTANCE Amplicon-sequencing approaches for fungi may rely on different targets affecting the diversity and abundance of the fungal species. An increasing number of studies will address fungal diversity by high-throughput amplicon sequencing. The description of the communities must be accurate and reliable in order to draw useful insights and to address both ecological and biological questions. By analyzing a mock community and several biological samples, we demonstrate that using different amplicon targets may change the results of fungal microbiota analysis, and we highlight how a careful choice of the target is fundamental for a thorough description of the fungal communities.

Role of fungi in chronic rhinosinusitis through ITS sequencing.

Next-generation sequencing increases the sensitivity of fungal identification and may improve our understanding of the role that fungi play in sinus health and disease, which remains incompletely understood. We sequenced the internal transcribed spacer (ITS) amplicon to explore the role of the mycobiome in chronic rhinosinusitis (CRS). Swabs were collected intraoperatively from the middle meatus of 90 patients (63 with CRS; 27 controls). DNA was extracted, and ITS amplicon concentration was measured using fluorometry. Internal transcribed spacer amplicons were sequenced on the Illumina MiSeq (Illumina Inc San Diego CA). Sequencing data were analyzed using QIIME. Using conventional detection techniques of culture and histology, fungi only were identified in nine of 63 (14.3%) CRS patients (fungus-identified group); the remaining 54 CRS patients and all controls did not have fungus identified using the traditional techniques. This fungus-identified group had a significantly higher average ITS concentration and a significantly lower Shannon's diversity index compared to the other two groups. The most abundant organism sequenced was Aspergillus (35.22% of all sequences). Multivariate analysis showed that positive fungal detection using traditional techniques and computed tomography (CT) double densities were the most important clinical predictors of a high fungal biomass, whereas Lund-Mackay score, polyps, eosinophilia, and eosinophilic mucus were not significant in comparison. Fungal biomass estimated through ITS amplicon concentration correlated with traditional fungal detection techniques and CT double densities. Our results suggest that fungal dysbiosis only occurs in the sinuses of a selected subset of patients, and therefore could not be a universal determinant of sinus disease pathogenesis in all CRS patients. NA. Laryngoscope, 128:16-22, 2018.

Development and Evaluation of a Molecular Diagnostic Method for Rapid Detection of Histoplasma capsulatum var. farciminosum, the Causative Agent of Epizootic Lymphangitis, in Equine Clinical Samples.

Histoplasma capsulatum var. farciminosum, the causative agent of epizootic lymphangitis (EZL), is endemic in parts of Africa. Diagnosis based on clinical signs and microscopy lacks specificity and is a barrier to further understanding this neglected disease. Here, a nested PCR method targeting the internal transcribed spacer (ITS) region of the rRNA operon was validated for application to equine clinical samples. Twenty-nine horses with signs of EZL from different climatic regions of Ethiopia were clinically examined. Blood samples and aspirates of pus from cutaneous nodules were taken, along with blood from a further 20 horses with no cutaneous EZL lesions. Among the 29 horses with suspected cases of EZL, H. capsulatum var. farciminosum was confirmed by extraction of DNA from pus and blood samples from 25 and 17 horses, respectively. Positive PCR results were also obtained with heat-inactivated pus (24 horses) and blood (23 horses) spotted onto Whatman FTA cards. Two positive results were obtained among blood samples from 20 horses that did not exhibit clinical signs of EZL. These are the first reports of the direct detection of H. capsulatum var. farciminosum in equine blood and at high frequency among horses exhibiting cutaneous lesions. The nested PCR outperformed conventional microscopic diagnosis, as characteristic yeast cells could be observed only in 14 pus samples. The presence of H. capsulatum var. farciminosum DNA was confirmed by sequencing the cloned PCR products, and while alignment of the ITS amplicons showed very little sequence variation, there was preliminary single nucleotide polymorphism-based evidence for the existence of two subgroups of H. capsulatum var. farciminosum. This molecular diagnostic method now permits investigation of the epidemiology of EZL.

Sample Preparation for Fungal Community Analysis by High-Throughput Sequencing of Barcode Amplicons.

Fungal species participate in vast numbers of processes in the landscape around us. However, their often cryptic growth, inside various substrates and in highly diverse species assemblages, has been a major obstacle to thorough analysis of fungal communities, hampering exhaustive description of the fungal kingdom. Recent technological developments allowing rapid, high-throughput sequencing of mixed communities from many samples at once are currently having a tremendous impact in fungal community ecology. Universal DNA extraction followed by amplification and sequencing of fungal species-level barcodes such as the nuclear internal transcribed spacer (ITS) region now enable identification and relative quantification of fungal community members across well-replicated experimental settings. Here, we present the sample preparation procedure presently used in our laboratory for fungal community analysis by high-throughput sequencing of amplified ITS2 markers. We focus on the procedure optimized for studies of total fungal communities in humus-rich soils, wood, and litter. However, this procedure can be applied to other sample types and markers. We focus on the laboratory-based part of sample preparation, that is, the procedure from the point where samples enter the laboratory until amplicons are submitted for sequencing. Our procedure comprises four main parts: (1) universal DNA extraction, (2) optimization of PCR conditions, (3) production of tagged ITS amplicons, and (4) preparation of the multiplexed amplicon mix to be sequenced. The presented procedure is independent of the specific high-throughput sequencing technology used, which makes it highly versatile.

Fungal malignant otitis externa caused by Alternaria chlamydospora: first case report

Introduction: Malignant otitis externa (MOE) is a rare clinical entity, usually observed in diabetic or immunosuppressed patients, with serious morbidity due to associated osteomyelitis, cranial nerve palsies and intracranial infections. Pseudomonas aeruginosa is the main pathogen in over 95 % of cases; Aspergillus species and Candida albicans have also been implicated in fungal MOE. Case presentation: Α 79‐year‐old male with type 2 diabetes with otalgia, otorrhoea and granulation tissue occupying the right external ear canal was diagnosed with MOE. Direct microscopy of a tissue biopsy specimen taken from the granulation tissue revealed septate branching hyphae and chlamydospores. An olivaceous‐black colony cultured within 3 days at 30 °C was identified microscopically as Alternaria sp. and molecularly as Alternaria chlamydospora using the restriction fragment length polymorphism pattern of the internal transcribed spacer (ITS) region on the basis of the 570 bp ITS amplicon, a BstUI largest band of 578 bp and absence of the TaqI 114 bp band. The patient was unresponsive to ciprofloxacin, whereas the pain was relieved after 2 weeks of voriconazole treatment followed by surgical debridement. Conclusion: We present, we believe, the first reported case of MOE for which Alternaria sp. seems to be the causative pathogen. A high index of suspicion was needed in order to reach the diagnosis. We recommend taking tissue cultures when a high‐risk patient is not responsive to the initial antibiotic treatment, as fungal MOE could be a repercussion of unsuccessfully treated bacterial otitis externa or it could represent a de novo presentation of fungal disease.