rDNA Intergenic Spacer Research Articles

Next generation sequencing and FISH reveal uneven and nonrandom microsatellite distribution in two grasshopper genomes.

Simple sequence repeats (SSRs), also known as microsatellites, are one of the prominent DNA sequences shaping the repeated fraction of eukaryotic genomes. In spite of their profuse use as molecular markers for a variety of genetic and evolutionary studies, their genomic location, distribution, and function are not yet well understood. Here we report the first thorough joint analysis of microsatellite motifs at both genomic and chromosomal levels in animal species, by a combination of 454 sequencing and fluorescent in situ hybridization (FISH) techniques performed on two grasshopper species. The in silico analysis of the 454 reads suggested that microsatellite expansion is not driving size increase of these genomes, as SSR abundance was higher in the species showing the smallest genome. However, the two species showed the same uneven and nonrandom location of SSRs, with clear predominance of dinucleotide motifs and association with several types of repetitive elements, mostly histone gene spacers, ribosomal DNA intergenic spacers (IGS), and transposable elements (TEs). The FISH analysis showed a dispersed chromosome distribution of microsatellite motifs in euchromatic regions, in coincidence with chromosome location patterns previously observed for many mobile elements in these species. However, some SSR motifs were clustered, especially those located in the histone gene cluster.

Phylogenetic relationships, possible ancient hybridization, and biogeographic history of Abies (Pinaceae) based on data from nuclear, plastid, and mitochondrial genomes

Abies, the second largest genus of Pinaceae, consists of approximately 48 species occurring in the north temperate region. Previous molecular phylogenetic studies improved our understanding of relationships within the genus, but were limited by relying on only DNA sequence data from single genome and low taxonomic sampling. Here we use DNA data from three genomes (sequences of internal transcribed spacer of nrITS, three chloroplast DNA intergenic spacers, and two mitochondrial intergenic spacers) from 42 species to elucidate species relationships and construct the biogeographic history of Abies. We further estimated the divergence times of intercontinental disjunction using a relaxed molecular clock calibrated with three macro-fossils. Our phylogenetic analyses recovered six robust clades largely consistent with previous classifications of sections. A sister relationship between the eastern Asian and Europe–Mediterranean clades was highly supported. The monophyly of section Balsamea, disjunct in Far East and western North America, is supported by the nrITS data but not by the cpDNA data. Discordance on placement of section Balsamea between the paternally inherited cpDNA and maternally inherited mtDNA trees was also observed. The data suggested that ancient hybridization was likely involved in the origin of sect. Balsamea. Results from biogeographic analyses and divergence time estimation suggested an origin and early diversification of Abies in an area of high latitude around the Pacific during the Eocene. The present disjunction in eastern Asia and Europe–Mediterranean area of Abies was likely the result of southward migration and isolation by the Turgai Strait in the Late Eocene. An ‘out-of-America’ migration, for the origin of an eastern Asian and western North American disjunct species pairs in section Amabilis was supported. The results suggested a western North American origin of the section with subsequent dispersal across the Bering Land Bridge (BLB) to Japan during the Middle Miocene.

First Report of the Root-Knot Nematode Meloidogyne enterolobii Infecting Jujube in China.

Jujube (Ziziphus jujuba Mill.) is an economically-important fruit crop grown in Europe, Australia, and southern/eastern Asia. In China, it is often called red date and the fruit is used in traditional Chinese herbal medicine and wine. In February 2014, jujube plants growing in a sandy soil in Sanya, Hainan Province, China, were observed exhibiting symptoms of decline, including stunting, wilting, and no flowering or fruit set. Roots systems of sick plants (n = 20) had many galls, the typical symptoms of root-knot nematode infection, and the incidence of infection was 100%. These galls were formed in the primary, secondary, and tertiary roots. Meloidogyne spp. females and egg masses were dissected from the symptomatic roots. Each root contained about 72 females on average (n = 20). The perineal patterns of females (n = 10) were oval shaped with moderate to high dorsal arches and mostly lacking obvious lateral lines. Second-stage juveniles (n = 20) had large and triangular lateral lips and broad, bluntly rounded tail tips. These morphological characteristics are the same as those for Meloidogyne enterolobii Yang & Eisenback 1983 (5). Identification was further confirmed after DNA extraction from 12 nematodes. Part of the rDNA spanning the internal transcribed spacer (ITS) 1, 5.8S gene, and ITS2 was amplified with primers V5367/26S (TTGATTACGTCCCTGCCCTTT/TTTCACTCGCCGTTACTAAGG) (4). A 764-bp fragment was amplified, which was 100% identical to sequences of M. enterolobii (GenBank Accession Nos. KJ146863, KF418369, JQ082448, and JX024149) in GenBank. Species identification was confirmed by using PCR to amplify mitochondrial (mt) DNA and rDNA intergenic spacers (IGS) 2 with primers C2F3/1108 (GGTCAATGTTCAGAAATTTGTGG/TACCTTTGACCAATCACGCT) (3) and M. enterolobii specific primers Me-F/Me-R (AACTTTTGTGAAAGTGCCGCTG/TCAGTTCAGGCAGGATCAACC), respectively (2). The PCR products were approximately 700 bp for mtDNA and 200 bp for rDNA-IGS2, which were also identical to those previously reported for M. enterolobii (2,3). M. enterolobii is considered as one of the most damaging root-knot nematode species due to its wide host range, high reproduction rate, and ability to overcome the resistance genes (Mi-1, Mh, Mir1, N, Tabasco, and Rk) in several crops (1). It is reported that over 20 plant species from eight families (Annonaceae, Apiaceae, Cucurbitaceae, Convolvulaceae, Fabaceae, Marantaceae, Myrtaceae, and Solanaceae) in China are hosts for M. enterolobii. To our knowledge, this is the first report of jujube as a host of M. enterolobii and the first record of M. enterolobii as a parasite of a plant in the family Rhamnaceae in China.

Genetic characteristics of Streptococcus dysgalactiae isolated from cage cultured cobia, Rachycentron canadum (L.).

Disease outbreaks occurred during 2007-2013 in Taiwan with 2.5-10% mortality among the cage cultured cobia, Rachycentron canadum (L.), characterized by the presence of polyserositis, pericarditis and peritonitis. The micro-organisms isolated from internal organs were Gram-positive cocci. The isolates were confirmed as Streptococcus dysgalactiae by a polymerase chain reaction assay that yielded the expected specific 259 bp amplicon. Additionally, partial sequence of the 16S-23S rDNA intergenic spacer region of the GCS strain isolates from fish was also compared and produced 100% sequence identity with S. dysgalactiae (GenBank accession number AB252398). The genetic characterization was then determined by pulsed-field gel electrophoresis (PFGE) analysis. Based on PFGE, the Apa I or Sma I digestion patterns of chromosomal DNA of these isolates were grouped into three main clusters. Taiwanese strains were divided into two clusters, and the tet(M) gene was detected in cluster 1 (pulsotypes: A1-A2 and S1-S3), but not in cluster 2 strains (pulsotypes: A3-A4 and S4-S5). Three Japanese strains from amberjack, Seriola dumerili (Risso), were grouped into cluster 3 (pulsotypes: A5-A7 and S6-S8) and displayed no mortality to cobia in the challenge experiment. Conversely, Taiwanese strains from cobia and snubnose pompano, Trachinotus blochii (L.), displayed a mortality rate of 50-87.5% in cobia.

Roles for Pbp1 and Caloric Restriction in Genome and Lifespan Maintenance via Suppression of RNA-DNA Hybrids

Intergenic transcription within repetitive loci such as the ribosomal DNA (rDNA) repeats of yeast commonly triggers aberrant recombination. Major mechanisms suppressing aberrant rDNA recombination rely on chromatin silencing or RNAPII repression at intergenic spacers within the repeats. We find ancient processes operating at rDNA intergenic spacers and other loci to maintain genome stability via repression of RNA-DNA hybrids. The yeast Ataxin-2 protein Pbp1 binds noncoding RNA, suppresses RNA-DNA hybrids, and prevents aberrant rDNA recombination. Repression of RNA-DNA hybrids in Pbp1-deficient cells through RNaseH overexpression, deletion of the G4DNA-stabilizing Stm1, or caloric restriction operating via RNaseH/Pif1 restores rDNA stability. Pbp1 also limits hybrids at non-rDNA G4DNA loci including telomeres. Moreover, cells lacking Pbp1 have a short replicative lifespan that is extended upon hybrid suppression. Thus, we find roles for Pbp1 in genome maintenance and reveal that caloric restriction counteracts Pbp1 deficiencies by engaging RNaseH and Pif1.

Identification of hypervariable regions within the 16S–23S rRNA intergenic spacer region of Flavobacterium columnare and its application in assigning genomovar group to an individual strain

Flavobacterium columnare is an important bacterial pathogen of fish with wide ge- netic variability within species. This intraspecies diversity has been termed as genomovars and genomovar groups on the basis of Restriction Fragment Length Polymorphisms of 16S rDNA and 16S-23S rDNA Intergenic Spacer Region (ISR), respectively. In this study, we demonstrate the source of genetic heterogeneity in the F. columnare by sequence analysis of ISR. Length of ISR sequences of different genomovars varied from 553 to 592 nucleotides, while the similarity among sequences ranged from 76.1 to 92.6%. A common ISR structure with tRNAAa and tRNAne embedded within the sequence was identified in all the genomovars ofF. columnare. The results show that strains of F. columnare can be categorized into five genomovar groups based on the heterogeneity in the ISR sequences. Of these, strains belonging to Genomovar I and II can be sub-divided into two groups each; while strains of Genomovar III belonged to one group. Sequence similarity between genomovar groups was lower for ISR (76.1-92.6%) as compared to 16S rDNA (96.1-99.4%) indicating its ability to resolve closely related groups within the genomovars of F. columnare. The main source of variation between genomovar groups is the presence of three hyper variable regions (V1, V2 & V3) in the ISR Of the three, V3 was found to be the most heterogeneous region and was found to be useful in assigning genomovar group to an individual strain of F. columnare.

Identification of Lactobacillus strains of goose origin using MALDI-TOF mass spectrometry and 16S–23S rDNA intergenic spacer PCR analysis

The objective of our study was to identify Lactobacillus sp. strains of goose origin using MALDI-TOF mass spectrometry, ITS-PCR and ITS-PCR/RFLP. All three techniques proved to be valuable tools for identification of avian lactobacilli and produced comparable classification results. Lactobacillus strains were isolated from 100% of geese aged 3 weeks to 4 years, but from only 25% of chicks aged 1–10 days. Among the 104 strains isolated, we distinguished 14 Lactobacillus species. The dominant species was Lactobacillus salivarius (35.6%), followed by Lactobacillus johnsonii (18.3%), Lactobacillus ingluviei (11.5%) and Lactobacillus agilis (7.7%). The intact-cell MALDI-TOF mass spectrometry enabled rapid species identification of the lactobacilli with minimal pretreatment. However, it produced more than one identification result for 11.5% examined strains (mainly of the species L. johnsonii). ITS-PCR distinguished 12 genotypes among the isolates, but was not able to differentiate closely related strains, i.e. between Lactobacillus amylovorus and Lactobacillus kitasatonis and between Lactobacillus paracasei, Lactobacillus rhamnosus and Lactobacillus zeae. These species were differentiated by ITS-PCR/RFLP using the restriction enzymes TaqI and MseI. The results obtained indicate that ITS-PCR and ITS-PCR/RFLP assays could be used not only for interspecific, but also for intraspecific, typing.

Phylogenetic Relationships among Dracaenoid Genera (Asparagaceae: Nolinoideae) Inferred from Chloroplast DNA Loci

The global evolutionary pattern among the dracaenoid plant genera Dracaena, Pleomele, and Sansevieria has remained ambiguous. Their classification has been disputed due to different taxonomic interpretation and the difficulty in morphological characterization of the species and genera. This study explores the phylogenetic analysis of 95 species representing all three genera using four combined chloroplast intergenic spacer DNA regions (trnL-trnF, ndhF-rpl32, trnQ-rps16, and rpl32-trnL). The combined dataset was analyzed using parsimony, maximum likelihood, and Bayesian analysis. Results show that 1) dracaenoids are monophyletic; 2) the Hawaiian Pleomele species are the sister group to the remainder of the dracaenoid clade; 3) species of Dracaena and the remaining Pleomele are intermixed; 4) Sansevieria is monophyletic, but nested within Dracaena; 5) the Central American species D. americana and D. cubensis are the sister group to the remainder of the non-Hawaiian dracaenoid species. The Hawaiian Pleomele are morphologically and phylogenetically distinct from the remaining dracaenoids and are recognized as a distinct genus, Chrysodracon, and new species combinations are made. Dracaena is paraphyletic in regards to Sansevieria and those species should be recognized as species of Dracaena. The polyphyletic status of Pleomele species nested within Dracaena confirms previous morphology based studies that combined these genera.

Phenotypic and genotypic characteristics of Arcanobacterium haemolyticum isolated from clinical samples in a Danish hospital

Six Arcanobacterium haemolyticum strains isolated from six patients of two hospitals in Denmark were identified phenotypically, also including matrix-assisted laser desorption ionization time-of-flight mass spectrometry (MALDI-TOF MS) analysis, and by genotypic methods. The latter were performed by sequencing 16S rDNA and glyceraldehyde 3-phosphate dehydrogenase encoding gene gap and by amplification of an A. haemolyticum specific region of 16S-23S rDNA intergenic spacer region and 23S rDNA. The six A. haemolyticum strains were further investigated for the presence of seven potential virulence genes encoding arcanolysin, phospholipase D, hemolysin A, CAMP factor family protein, collagen binding protein, neuraminidase A and neuraminidase H which appeared to be present in two (seven virulence genes), two (six virulence genes) and two strains (four virulence genes), respectively. The phenotypic and genotypic properties described in the present study might help to reliably identify and further characterize A. haemolyticum isolated from human patients, a species which seems to be of increasing importance.

Further Studies on Arcanobacterium phocisimile: a Novel Species of Genus Arcanobacterium.

Arcanobacterium phocisimile, a newly described species with the type strain A. phocisimile 2698T isolated from a vaginal swab of a harbour seal and four additional A. phocisimile strains also isolated from four harbour seals could reliably be identified by phenotypic properties, by matrix assisted laser desorption ionization time of flight mass spectrometry (MALDI-TOF MS), and by sequencing the genomic targets 16S rDNA and 16S-23S rDNA intergenic spacer region and the genes rpoB and gap. The A. phocisimile strains investigated in the present study were isolated together with several other bacterial species indicating that the pathogenic importance of A. phocisimile remains unclear. However, the detection of peptidic spectra by MALDI-TOF MS and the presented phenotypic and genotypic approach might help to identify A. phocisimile in future.

Strain diversity of Borrelia burgdorferi sensu lato in Serbia

The geographic distribution of Borrelia burgdorferi sensu lato species in Europe shows very dynamic spatial and temporal variations. Since different Borrelia species usually correlate with different clinical manifestation of Lyme borreliosis, knowledge of the geographic distribution of the pathogen is very important for understanding the ecology and epidemiology of the disease. Our previous studies, based on direct molecular methods, revealed high diversity of species of the B. burgdorferi s.l. complex and unexpected high prevalence of B. lusitaniae in Ixodes ricinus ticks from Serbia. The aim of the present study was further isolation and typization of viable B. burgdorferi s.l. strains from vectors in Serbia as a basis for studies of biological, genetic and ecological variations. A total of 248 adult I. ricinus ticks collected from 24 localities were processed for cultivation. Prior to cultivation, all ticks were disinfected, then triturated in BSK H medium. The culture tubes were incubated at 33°C for 3 months. Cultures were periodically examined by dark field microscopy. For confirmation of isolated strains, seminested PCR for the flaB gene was performed. Determination of B. burgdorferi s.l. species was carried out by the RFLP technique, using restriction enzymes MseI and DraI on the previously amplified 5-23S rDNA intergenic spacer (Postic et al., 1994). For Borrelia identification by RT-PCR targeting, the hbb gene protocol of Portnoi et al. (2006) was followed. Sequencing of the 5-23S rDNA intergenic spacer and flaB gene was performed for phylogenetic analysis. Thirty-four spirochete cultures were isolated and subjected to further genotyping analyses. According to the RFLP patterns of the 5S-23S rDNA intergenic spacer, specimens were determined as: B. lusitaniae, B. afzelii, B. burgdorferi s.s., B. garinii and B. valaisiana. For all strains identified as B. lusitaniae, B. garinii, B. afzelii and B. valaisiana according to the MseI-RFLP method, results of RT-PCR were in absolute agreement. However, Tm values for all strains identified as B. burgdorferi s.s. according to RFLP patterns were in the range for B. lusitaniae strains (64.17 to 64.58 °C). Thus, it was impossible to distinguish B. burgdorferi s.s. and B. lusitaniae strains by this method. Sequencing analysis for strains identified as B. lusitaniae, B. garinii, B. afzelii and B. valaisiana was in agreement with MseI-RFLP and RT-PCR results. In cases of uncoordinated MseI-RFLP and RT-PCR results, sequencing analysis confirmed unclear strains as B. lusitaniae. The results of this study showed B. lusitaniae to be the species with highest prevalence in I. ricinus ticks from Serbia.

Distribution and Diversity of Rhizobial Populations Associated with <i>Acacia senegal</i> (L.) Willd. Provenances in Senegalese Arid and Semiarid Regions

Abstract: Distribution and diversity of rhizobial strains associated with Acacia senegal (L.) Willd. in relation to seed provenances in soils from arid (Dahra) and semiarid (Goudiry) zones of Senegal were investigated. PCR-RFLP performed on 16S-23S rDNA intergenic spacer (IGS) of nodule crude extracts revealed a high genetic diversity of rhizobial strains, which was higher in the semiarid region than in the arid region. The distribution of rhizobial populations was influenced by soil physical and chemical characteristics, and by A. senegal provenances as shown by the analysis of correspondence. In contrast, the phenotypic diversity of rhizobial strains was not correlated with the soil origin. The phylogenetic tree (performed by the maximum likelihood algorithm) of IGS 16S-23S sequences showed that most of the rhizobial strains nodulating A. senegal were closely related to Mesorhizobium plurifarium. Our results showed that rhizobial taxa associated with A. senegal were mainly distributed according to soil physical and chemical characteristics, and A. senegal provenances. A large subset of A. senegal root-nodulating bacteria had high diversity that correlated with the most favourable environmental conditions. Understanding the diversity and distribution of rhizobial strains may be exploited in the formulation of A. senegal inoculants for different seed provenances for resilience to soil stresses in various environmental conditions.

The tomato wilt fungus Fusarium oxysporum f. sp. lycopersici shares common ancestors with nonpathogenic F. oxysporum isolated from wild tomatoes in the Peruvian Andes.

Fusarium oxysporum is an ascomycetous fungus that is well-known as a soilborne plant pathogen. In addition, a large population of nonpathogenic F. oxysporum (NPF) inhabits various environmental niches, including the phytosphere. To obtain an insight into the origin of plant pathogenic F. oxysporum, we focused on the tomato (Solanum lycopersicum) and its pathogenic F. oxysporum f. sp. lycopersici (FOL). We collected F. oxysporum from wild and transition Solanum spp. and modern cultivars of tomato in Chile, Ecuador, Peru, Mexico, Afghanistan, Italy, and Japan, evaluated the fungal isolates for pathogenicity, VCG, mating type, and distribution of SIX genes related to the pathogenicity of FOL, and constructed phylogenies based on ribosomal DNA intergenic spacer sequences. All F. oxysporum isolates sampled were genetically more diverse than FOL. They were not pathogenic to the tomato and did not carry SIX genes. Certain NPF isolates including those from wild Solanum spp. in Peru were grouped in FOL clades, whereas most of the NPF isolates were not. Our results suggested that the population of NPF isolates in FOL clades gave rise to FOL by gaining pathogenicity.

The molecular diversity analysis of Auricularia auricula-judae in China by nuclear ribosomal DNA intergenic spacer

For the crossbreeding of Auricularia auricula-judae, selecting the appropriated parents in hybridization is very important. However, the classification and diversity analysis of A. auricula-judae has been equivocal, due to the similarity of the fruiting body morphology and its susceptibility to environmental influences. For this purpose, the molecular diversity of 32 A. auricula-judae commercial cultivars in China was analyzed by using the nuclear ribosomal DNA intergenic spacer.

Eco-geographical diversity of cowpea bradyrhizobia in Senegal is marked by dominance of two genetic types

The genetic diversity of native cowpea rhizobia originating from 60 sites across four eco-geographic zones in Senegal was studied. More than 300 cowpea nodules were analyzed by PCR-RFLP of the 16S–23S rDNA InterGenic Spacer region (IGS). Alignments of IGS sequences indicated that all genotypes were grouping within the Bradyrhizobium genus. The geographical distribution showed that apart from five IGS types, the others were specifically found in only one region. The diversity was significantly higher in the Senegal River valley zone, which presents lower mean annual rainfalls and slightly alkaline soils. Interestingly, two IGS types dominated the Senegalese rhizobial collection, one IGS type (VI) was found on more than half of the nodules collected in the northern Senegal River valley while another IGS type (I) was recovered from the great majority of nodules in the three other regions sampled. Two representative strains from each of these two dominant types were isolated and further analyzed. Multi Locus Sequence Analyses using 6 housekeeping genes indicate that they belong to a new Bradyrhizobium species closely related to B. yuanmingense. Phylogenetic analyses of 2 symbiotic genes nodC and nifH show that they are clustered with B. arachidis. Physiological tests on these strains have shown that under laboratory conditions, the growth of the IGS type VI strains was slightly less affected by a higher osmotic strength in the medium and to alkaline pH, which corroborates the soil physico-chemical parameters.

Further characteristics of Arcanobacterium canis, a novel species of genus Arcanobacterium

Comparable to previously conducted phenotypical and genotypical investigations characterizing Arcanobacterium canis, a newly described species with the type strain A. canis DSM 25104 isolated from an otitis externa of a dog, four additional A. canis strains isolated from infections of three dogs and one cat could reliably be identified by phenotypic properties, by matrix-assisted laser desorption ionization-time of flight mass spectrometry (MALDI-TOF MS) and by sequencing the genomic targets 16S rDNA, 16S-23S rDNA intergenic spacer region, 23S rDNA, and the genes rpoB and gap. All four A. canis investigated in the present study were isolated from the infected animals together with several other bacterial species indicating that the pathogenic importance of A. canis remains unclear. However, the detection of peptidic spectra by MALDI-TOF MS and the presented phenotypic and genotypic approaches might help to identify A. canis in future and might elucidate the role this species plays in infections of dogs and cats.

Production of Selenium-Enriched Biomass by Enterococcus durans

Selenium (Se) is an essential micronutrient for several organisms, and there is an increased interest about adequate sources for dietary selenium supplementation. The aim of this study was to evaluate the selenium bioaccumulation capacity of an Enterococcus strain. The isolate LAB18s was identified as Enterococcus durans by the VITEK® 2 system and analysis of both 16S rDNA gene sequence (JX503528) and the 16S-23S rDNA intergenic spacer (ITS). After 24-h incubation, E. durans LAB18s bioaccumulated elevated Se(IV) concentrations, reaching 2.60 and 176.97mg/g in media containing initial amounts of 15 and 240mg/l sodium selenite, respectively. The isolate grew optimally and had high selenium bioaccumulation at initial pH of 7.0 and 30°C. Time course studies showed that E. durans LAB18s displayed the highest bioaccumulation of Se(IV) after 6h of incubation. Analyses from scanning electron microscopy (SEM) demonstrated the presence of filaments connecting the cells of E. durans LAB18s cultivated in the presence of sodium selenite. It was demonstrated that a considerable amount of Se(IV) was absorbed by E. durans LAB18s. Therefore, this strain may represent an alternative source of organic dietary selenium.

Culture-independent metagenomic approach to characterize the surface and subsurface soil bacterial community in the Brahmaputra valley, Assam, North-East India, an Indo-Burma mega-biodiversity hotspot

Soil bacterial communities, which contain the highest level of prokaryotic diversity of any natural environment, are important for ecosystem functioning. A culture-independent metagenomic approach was employed in the present investigation to characterize the diversity of soil bacterial community composition in five geochemically and hydrologically different surface and subsurface soil habitats of Brahmaputra valley, Assam, North-East India, an Indo-Burma mega-biodiversity hotspot. The diversity of soil bacterial community was determined through sequence analysis of 16S-23S intergenic spacer regions (ISR). Polymerase chain reaction (PCR) universal primers, 1406F (5'-TGYACACACCGCCCGT-3') and 155r (5'-GGGTTBCATTCRG-3') were used for amplification of 16S-23S ribosomal DNA intergenic spacers of bacteria. Amplification resulted in an intense array of PCR products approximately ranging in size from 200 to 900 bp. Clear banding patterns were observed in analysed samples using the primer set in combination. A clear change in microbial ISR profile was observed on visual analysis of gel electrophoresis profiles. Fast alignment database searches of PCR amplicons of 16S-23S ISR sequence data revealed that the isolated sequences resembled five major phylogenetic groups of bacteria, namely α-, β- and γ-subdivisions of Proteobacteria, Acidobacterium and Comamonadaceae.

Genetic diversity of Puccinia striiformis from cereals in Alberta, Canada

Stripe rust of wheat caused by Puccinia striiformis f. sp. tritici has recently become a production problem on wheat in Alberta, Canada, and stripe rust of barley caused by P. striiformis f. sp. hordei occurs regularly. A total of 261 isolates of P. striiformis were collected from wheat, barley, Hordeum jubatum and triticale plants in Alberta, Canada from 2007 to 2012, and compared to isolates from other provinces and the USA. The genetic diversity of the pathogen was assessed using 11 simple sequence repeat (SSR) markers and by examining a length polymorphism in the ribosomal DNA (rDNA) intergenic spacer 1 (IGS1) region. A total of 28 SSR genotypes were detected within Alberta. The 13 genotypes common on wheat (P. striiformis f. sp. tritici) were distinct from the 15 genotypes common on barley (P. striiformis f. sp. hordei). Four SSR genotypes, two within each forma specialis, represented 85% of the isolates recovered. Genotypic diversity was low, population genetic analysis indicated a clonal structure, and the genotypes were widely dispersed. In both formae speciales, the dominant genotype varied between years. The second most common P. striiformis f. sp. hordei genotype was found to be more closely related to older P. striiformis f. sp. tritici genotypes from the USA than to other P. striiformis f. sp. hordei genotypes.

Local genetic structure in the critically endangered, cave-associated perennial herbPrimulina tabacum(Gesneriaceae)

The local spatial genetic structures of cave-associated plants are seldom studied. Given that these plants are mainly confined to small areas in and around the entrances of caves, we hypothesized that they might lack genetic structures at local scales. To test this hypothesis, we sampled two large populations (named D and T) of a critically endangered perennial herb, Primulina tabacum, which is endemic to karst caves in southern China. We analysed nine microsatellite loci and sequenced four chloroplast DNA (cpDNA) intergenic spacer regions to study the genetic diversity and structure within and between both populations. Both populations have distinct genetic characteristics. Samples from two subpopulations in population D showed considerable genetic divergence. This is not consistent with the hypothesis that P. tabacum has a weak genetic structure at a local scale. However, 94% of the individuals in population T shared the same multilocus genotype, which indicates little genetic structure within this population. The contributions of seed flow, pollen flow and (sub)population history to the genetic diversity and structure in each and both populations are discussed. Our study is the first to investigate local genetic diversity and structure in a cave-associated plant, and provides valuable information for the sustainable conservation of such species.