Interacting Proteins Research Articles

Essential Functions of Calmodulin and Identification of Its Proximal Interacting Proteins in Tachyzoite-Stage Toxoplasma gondii via BioID Technology.

ABSTRACTToxoplasma gondii (T. gondii) is a pathogen belonging to the apicomplexan phylum, and it threatens human and animal health. Calcium ions, a critical second messenger in cells, can regulate important biological processes, including parasite invasion and egress. Calmodulin (CaM) is a small, highly conserved, Ca2+-binding protein found in all eukaryotic cells. After binding to Ca2+, CaM can be activated to interact with various proteins. However, little is known about CaM’s function and its interacting proteins in T. gondii. In this study, we successfully knocked down CaM in the T. gondii parent strain TATI using a tetracycline-off system with the Toxoplasma CaM promoter. The results indicated that CaM was required for tachyzoite proliferation, invasion, and egress and that CaM depletion resulted in apicoplast loss, thus threatening parasite survival in the next lytic cycle. In the tachyzoite stage, CaM loss caused significant anomalies in the parasite’s basal constriction, motility, and parasite rosette-like arrangement in the parasitophorous vacuole (PV). These phenotypic defects caused by CaM depletion indicate the importance of CaM in T. gondii. Therefore, it is important to identify the CaM-interacting proteins in T. gondii. Applying BioID technology, more than 300 CaM’s proximal interacting proteins were identified from T. gondii. These CaM partners were broadly distributed throughout the parasite. Furthermore, the protein interactome and transcriptome analyses indicated the potential role of CaM in ion binding, cation binding, metal ion binding, calcium ion binding, and oxidation-reduction. Our findings shed light on the CaM function and CaM-interactome in T. gondii and other eukaryotes.IMPORTANCE Toxoplasma gondii is an intracellular pathogen that threatens human and animal health. This unicellular parasite is active in many biological processes, such as egress and invasion. The implementation efficiency of T. gondii biological processes is dependent on signal transmission. Ca2+, as a second messenger, is essential for the parasite’s life cycle. Calmodulin, a ubiquitous Ca2+ receptor protein, is highly conserved and mediates numerous Ca2+-dependent events in eukaryotes. Few CaM functions or regulated partners have been characterized in T. gondii tachyzoites. Here, we reported the essential functions of calmodulin in T. gondii tachyzoite and the identification of its interacting partners using BioID technology, shedding light on the CaM function and CaM-interactome in Toxoplasma gondii and other eukaryotes.

NAC Transcription Factor GmNAC12 Improved Drought Stress Tolerance in Soybean.

NAC transcription factors (TFs) could regulate drought stresses in plants; however, the function of NAC TFs in soybeans remains unclear. To unravel NAC TF function, we established that GmNAC12, a NAC TF from soybean (Glycine max), was involved in the manipulation of stress tolerance. The expression of GmNAC12 was significantly upregulated more than 10-fold under drought stress and more than threefold under abscisic acid (ABA) and ethylene (ETH) treatment. In order to determine the function of GmNAC12 under drought stress conditions, we generated GmNAC12 overexpression and knockout lines. The present findings showed that under drought stress, the survival rate of GmNAC12 overexpression lines increased by more than 57% compared with wild-type plants, while the survival rate of GmNAC12 knockout lines decreased by at least 46%. Furthermore, a subcellular localisation analysis showed that the GmNAC12 protein is concentrated in the nucleus of the tobacco cell. In addition, we used a yeast two-hybrid assay to identify 185 proteins that interact with GmNAC12. Gene ontology (GO) and KEGG analysis showed that GmNAC12 interaction proteins are related to chitin, chlorophyll, ubiquitin–protein transferase, and peroxidase activity. Hence, we have inferred that GmNAC12, as a key gene, could positively regulate soybean tolerance to drought stress.

Lineage-specific protein repeat expansions and contractions reveal malleable regions of immune genes.

Functional diversification, a higher evolutionary rate, and intense positive selection help a limited number of immune genes interact with many pathogens. Repeats in protein-coding regions are a well-known source of functional diversification, adaptive variation, and evolutionary novelty in a short time. Repeats play a crucial role in biochemical functions like functional diversification of transcription regulation, protein kinases, cell adhesion, signaling pathways, morphogenesis, DNA repair, recombination, and RNA processing. Repeat length variation can change the associated protein's interaction, efficacy, and overall protein network. Repeats have an intrinsic unstable nature and can potentially evolve rapidly and expedite the acquisition of complex phenotypic traits and functions. Because of their ability to generate rapid, adaptive variations over short evolutionary distances, repeats are considered "tuning knobs." Repeat length variation in specific genes, like RUNX2 and ALX4, is associated with morphological and physiological changes across vertebrates. Here we study repeat length variation as a potent source of species-specific immune diversification across several clades of tetrapods. Moreover, we provide a clade-wise comprehensive list of immune genes with repeat types for future studies of morphological/evolutionary changes within species groups. We observe significant repeat length variation of FASLG and C1QC in Rodentia and Primates' contrasting species groups, respectively.

Von Willebrand factor and cancer: Another piece of the puzzle

Von Willebrand factor and cancer: Another piece of the puzzle

265 (PB045) - Predictive impact of ARID1A status in solid tumors

Background: Mutations in the gene encoding AT- Rich Interactive Domain-containing protein 1A (ARID1A) occur in several cancer types with varying frequency. The predictive impact of ARID1A mutations on platinum-based chemotherapy and immunotherapy have been investigated retrospectively, yielding conflicting results. We report our analysis on the predictive impact of ARID1A status – mutated (MUT) versus (vs.) wild type (WT) – in metastatic solid tumor patients who were exposed to platinum-based chemotherapy and immunotherapy.

The alternative splicing of intersectin 1 regulated by PTBP1 promotes human glioma progression

Intersectin 1 (ITSN1) contains two isoforms: ITSN1-S and ITSN1-L, which are highly regulated by alternative splicing. Our previous results showed that the two isoforms of ITSN1 displayed opposite functions: ITSN1-S promoted glioma development, while ITSN1-L exerted an inhibitory role in glioma progression. In this study, our transcriptome analysis using a large glioma cohort indicated that the ratio of ITSN1-S/ITSN1-L was positively correlated with glioma grading and poor prognosis. We identified the RNA-binding protein polypyrimidine tract-binding protein 1 (PTBP1) as an ITSN1 pre-mRNA interaction protein through RNA pull-down assay and RNA immunoprecipitation assay. Knockdown of PTBP1 decreased the ratio of ITSN1-S/ITSN1-L. Minigene reporter assay and mutation analyses further confirmed PTBP1 targeted polypyrimidine sequences on ITSN1 exon 30 (TTGCACTTCAGTATTTT) and promoted the inclusion of ITSN1 exon 30. Subsequently, silencing PTBP1 inhibited glioma cell proliferation, migration, and invasion by down-regulating the ratio of ITSN1-S/ITSN1-L. Taken together, our study provides a novel mechanism that PTBP1 modulates the alternative splicing of ITSN1 and promotes glioma proliferation and motility by up-regulating the ratio of ITSN1-S/ITSN1-L, thereby highlighting that PTBP1 may be an attractive therapeutic target for gliomas.

Investigating the cardioprotective effects of Fuzheng Yangxin recipe based on network pharmacology and experimental evaluation.

Background: Under Chinese medicine theory guidance, Fuzheng Yangxin Recipe (FZYX) is clinically effective for the treatment of heart failure (HF) caused by ischemic heart disease (IHD). This study aimed to investigate the mechanism of the myocardial protective effects of FZYX on HF. Materials and methods: The Gene expression omnibus database was used to identify differential genes of the IHD subtype. Through network pharmacological methods, the targets of the active components of FZYX were obtained. We also constructed IHD-induced HF model rats by ligating the left anterior descending coronary artery. Echocardiography, pathological section staining, enzyme-linked immunosorbent assay, western blotting, immunohistochemistry, and quantitative real-time PCR analyses were performed to verify the protective effects of FZYX on the myocardium. Results: We identified 53 active components and 37 potential targets of FZYX associated with the IHD subtype. Signal transducer and activator of transcription 3 (STAT3) is a key protein in the protein-protein interaction (PPI) network. A total of 146 biological processes, 10 cellular components and 40 molecular function subcategories were identified by Gene Ontology (GO) enrichment analysis, and 18 signalling pathways, including apoptosis, were identified by Kyoto Encyclopedia of Genes and Genomes (KEGG) enrichment analysis. In vivo experiments showed that FZYX significantly inhibited cardiomyocyte apoptosis, promoted the expression and phosphorylation of STAT3, and improved cardiac function. Conclusion: FZXY improves cardiac function and protects cardiomyocytes from injury via multi-component, multi-target and multi-pathway action, especially its possible role in regulating STAT3 expression and anti-apoptotic effect.

Irradiation potentiates p53 phosphorylation and p53 binding to the promoter and coding region of the TP53 gene

An essential factor of the DNA damage response is 53BP1, a multimeric protein that inhibits the resection-dependent double-strand break (DBS) repair. The p53 protein is a tumor suppressor known as a guardian of the genome. Although the interaction between 53BP1 and its p53 partner is well-known in regulating gene expression, a question remains whether genome injury can affect the interaction between 53BP1 and p53 proteins or p53 binding to DNA. Here, using mass spectrometry, we determine post-translational modifications and interaction properties of 53BP1 and p53 proteins in non-irradiated and γ-irradiated cells. In addition, we used Atomic Force Microscopy (AFM) and Fluorescent Lifetime Imaging Microscopy combined with Fluorescence Resonance Energy Transfer (FLIM-FRET) for studies of p53 binding to DNA. Also, we used local laser microirradiation as a tool of advanced confocal microscopy, showing selected protein accumulation at locally induced DNA lesions. We observed that 53BP1 and p53 proteins accumulate at microirradiated chromatin but with distinct kinetics. The density of 53BP1 (53BP1pS1778) phosphorylated form was lower in DNA lesions than in the non-specified form. By mass spectrometry, we found 22 phosphorylations, 4 acetylation sites, and methylation of arginine 1355 within the DNA-binding domain of the 53BP1 protein (aa1219-1711). The p53 protein was phosphorylated on 8 amino acids and acetylated on the N-terminal domain. Post-translational modifications (PTMs) of 53BP1 were not changed in cells exposed to γ-radiation, while γ-rays increased the level of S6ph and S15ph in p53. Interaction analysis showed that 53BP1 and p53 proteins have 54 identical interaction protein partners, and AFM revealed that p53 binds to both non-specific and TP53-specific sequences (AGACATGCCTA GGCATGTCT). Irradiation by γ-rays enhanced the density of the p53 protein at the AGACATGCCTAGGCATGTCT region, and the binding of p53 S15ph to the TP53 promoter was potentiated in irradiated cells. These findings show that γ-irradiation, in general, strengthens the binding of phosphorylated p53 protein to the encoding gene.

Transferrin Mediated NCC Killing Activity through NCCRP-1 in Nile Tilapia (Oreochromis niloticus)

Non-specific cytotoxic cell l (NCC) is a kind of important lymphocyte participating in the non-specific immune response in teleost. Non-specific cytotoxic cell receptor protein 1 (NCCRP-1) is a receptor molecule on the surface of NCC and plays an important role in mediating the activity of NCC. However, there are few reports on which signal molecule could transmit signals through NCCRP-1. In this study, yeast two-hybrid library of tilapia liver and head kidney was constructed, and a transferrin from Oreochromis niloticus (On-TF) with interaction protein sequence was obtained by screening the library with bait vector NCCRP-1 of Oreochromis niloticus (On-NCCRP-1). Then, the open reading frame (ORF) of On-TF was cloned, which had 2088 bp in length, encoding polypeptides of 695 amino acids. The deduced amino acid sequence was highly homologous to teleost and similar to mammalian TF, containing two TR_FER domains (25-343th aa and 344-686th aa) for binding iron ions. Furthermore, a point-to-point yeast two-hybrid method was used to further verify whether On-NCCRP-1 could bind to On-TF. The recombinant On-TF (rOn-TF) protein was purified by prokaryotic expression system. In vitro experiments showed that rOn-TF could up-regulate the expression of killing effector molecule of NCC by On-NCCRP-1, and rOn-TF-activated NCCs showed a significantly improved ability to kill FHM cells, indicating that rOn-TF could regulate the NCC signaling pathway through NCC receptor molecule On-NCCRP-1. The results provide a more theoretical basis for understanding the regulation mechanism of NCC activity.

GST-IVTT pull-down: a fast and versatile in vitro method for validating and mapping protein-protein interactions.

Over the past few decades, dozens of in vitro methods have been developed to map, investigate and validate protein-protein interactions. However, most of these approaches are time-consuming and labour-intensive or require specialised equipment or substantial amounts of purified proteins. Here, we describe a fast and versatile research protocol that is suitable for the in vitro analysis of the physical interaction between proteins or for mapping the binding surfaces. The principle of this method is based on the immobilisation of the protein/domain of interest to a carrier followed by its incubation with a labelled putative binding partner, which is generated by a coupled in vitro transcription/translation reaction. Interacting proteins are removed from the carrier, fractionated and visualised by SDS/PAGE autoradiography (or western blotting). This simple and cheap method can be easily carried out in every wet lab.

Genome-Wide Characterization and Expression Analysis of Fatty acid Desaturase Gene Family in Poplar.

Fatty acid desaturases (FADs) modulate carbon–carbon single bonds to form carbon–carbon double bonds in acyl chains, leading to unsaturated fatty acids (UFAs) that have vital roles in plant growth and development and their response to environmental stresses. In this study, a total of 23 Populus trichocarpa FAD (PtFAD) candidates were identified from the poplar genome and clustered into seven clades, including FAB2, FAD2, FAD3/7/8, FAD5, FAD6, DSD, and SLD. The exon–intron compositions and conserved motifs of the PtFADs, clustered into the same clade, were considerably conserved. It was found that segmental duplication events are predominantly attributable to the PtFAD gene family expansion. Several hormone- and stress-responsive elements in the PtFAD promoters implied that the expression of the PtFAD members was complicatedly regulated. A gene expression pattern analysis revealed that some PtFAD mRNA levels were significantly induced by abiotic stress. An interaction proteins and gene ontology (GO) analysis indicated that the PtFADs are closely associated with the UFAs biosynthesis. In addition, the UFA contents in poplars were significantly changed under drought and salt stresses, especially the ratio of linoleic and linolenic acids. The integration of the PtFAD expression patterns and UFA contents showed that the abiotic stress-induced PtFAD3/7/8 members mediating the conversion of linoleic and linolenic acids play vital roles in response to osmotic stress. This study highlights the profiles and functions of the PtFADs and identifies some valuable genes for forest improvements.

Development of pyrrolidine and isoindoline derivatives as new DPP8 inhibitors using a combination of 3D-QSAR technique, pharmacophore modeling, docking studies, and molecular dynamics simulations

ABSTRACT Dipeptidyl peptidase proteins (DPPs) are a family of serine proteases with an active, vital role in multiple pathological conditions, including different types of cancer and autoimmune diseases. DPP inhibitors can induce an inflammatory form of cell death by activating inflammasome sensors and pro-caspase 1. This study used docking calculations and extended molecular dynamics simulations to investigate the interaction patterns for DPP8-inhibitor complex structures. We also implemented a novel procedure to develop new DPP8 inhibitors using pharmacophore and CoMFA models, docking studies, and molecular dynamics simulations. Our results showed the critical role of Glu 275, Glu 276, and Tyr 788 residues in the active site of protein in DPP8-inhibitor interaction. We also provided a platform for comparing the effectiveness of the most important DPP8 inhibitors. Moreover, we introduced a new 1G244 derivative with the highest affinity among all the studied compounds to inhibit DPP8 protein.

Bio-Engineered Scaffolds Derived from Decellularized Human Esophagus for Functional Organ Reconstruction.

Esophageal reconstruction through bio-engineered allografts that highly resemble the peculiar properties of the tissue extracellular matrix (ECM) is a prospective strategy to overcome the limitations of current surgical approaches. In this work, human esophagus was decellularized for the first time in the literature by comparing three detergent-enzymatic protocols. After decellularization, residual DNA quantification and histological analyses showed that all protocols efficiently removed cells, DNA (<50 ng/mg of tissue) and muscle fibers, preserving collagen/elastin components. The glycosaminoglycan fraction was maintained (70–98%) in the decellularized versus native tissues, while immunohistochemistry showed unchanged expression of specific ECM markers (collagen IV, laminin). The proteomic signature of acellular esophagi corroborated the retention of structural collagens, basement membrane and matrix–cell interaction proteins. Conversely, decellularization led to the loss of HLA-DR expression, producing non-immunogenic allografts. According to hydroxyproline quantification, matrix collagen was preserved (2–6 µg/mg of tissue) after decellularization, while Second-Harmonic Generation imaging highlighted a decrease in collagen intensity. Based on uniaxial tensile tests, decellularization affected tissue stiffness, but sample integrity/manipulability was still maintained. Finally, the cytotoxicity test revealed that no harmful remnants/contaminants were present on acellular esophageal matrices, suggesting allograft biosafety. Despite the different outcomes showed by the three decellularization methods (regarding, for example, tissue manipulability, DNA removal, and glycosaminoglycans/hydroxyproline contents) the ultimate validation should be provided by future repopulation tests and in vivo orthotopic implant of esophageal scaffolds.

Genomic analysis reveals cryptic diversity in aphelids and sheds light on the emergence of Fungi

Over the past decade, molecular phylogenetics has reshaped our understanding of the fungal tree of life by unraveling a hitherto elusive diversity of the protistan relatives of Fungi. Aphelida constitutes one of these novel deep branches that precede the emergence of osmotrophic fungal lifestyle and hold particular significance as the pathogens of algae. Here, we obtain and analyze the genomes of aphelid species Amoeboaphelidium protococcarum and Amoeboaphelidium occidentale. Genomic data unmask the vast divergence between these species, hidden behind their morphological similarity, and reveal hybrid genomes with a complex evolutionary history in two strains of A.protococcarum. We confirm the proposed sister relationship between Aphelida and Fungi using phylogenomic analysis and chart the reduction of characteristic proteins involved in phagocytic activity in the evolution of Holomycota. Annotation of aphelid genomes demonstrates the retention of actin nucleation-promoting complexes associated with phagocytosis and amoeboid motility and also reveals a conspicuous expansion of receptor-like protein kinases, uncharacteristic of fungal lineages. We find that aphelids possess multiple carbohydrate-processing enzymes that are involved in fungal cell wall synthesis but do not display rich complements of algal cell-wall-processing enzymes, suggesting an independent origin of fungal plant-degrading capabilities. Aphelid genomes show that the emergence of Fungi from phagotrophic ancestors relied on a common cell wall synthetic machinery but required a different set of proteins for digestion and interaction with the environment.

The Colletotrichum siamense Hydrophobin CsHydr1 Interacts with the Lipid Droplet-Coating Protein CsCap20 and Regulates Lipid Metabolism and Virulence.

Previous studies of the lipid droplet-coating protein Cap20 in Colletotrichum show that it plays a key role in appressorium development and virulence. In this study, the hydrophobin CsHydr1, which contains a signal peptide of 19 amino acids and a hydrophobic domain (HYDRO), was shown to interact with CsCap20 in Colletotrichum siamense. The CsHydr1 deletion mutant showed slightly enhanced mycelial growth, small conidia, slow spore germination and appressoria formation, cell wall integrity and virulence. Like CsCAP20, CsHydr1 is also localized on the lipid droplet surface of C. siamense. However, when CsCap20 was absent, some CsHydr1 was observed in other parts. Quantitative lipid determination showed that the absence of either CsHydr1 or CsCap20 reduced the content of lipids in mycelia and conidia, while the effect of CsCap20 was more obvious; these results suggest that an interaction protein CsHydr1 of CsCap20 is localized on the lipid droplet surface and involved in lipid metabolism, which affects appressorium formation and virulence in C. siamense.

Network Pharmacology and in vitro Experimental Verification on Intervention of Quercetin, Present in Chinese Medicine Yishen Qutong Granules, on Esophageal Cancer.

To explore the potential mechanism of Yishen Qutong Granules (YSQTG) for the treatment of esophageal cancer using network pharmacology and experimental research. The effective components and molecular mechanism of YSQTG in treating esophageal cancer were expounded based on network pharmacology and molecular docking. The key compound was identified by high-performance liquid chromatography and mass spectrometry (HPLC-MS) to verify the malignant phenotype of the key compounds in the treatment of esophageal cancer. Then, the interaction proteins of key compounds were screened by pull-down assay combined with mass spectrometry. RNA-seq was used to screen the differential genes in the treatment of esophageal cancer by key compounds, and the potential mechanism of key compounds on the main therapeutic targets was verified. Totally 76 effective compounds of YSQTG were found, as well as 309 related targets, and 102 drug and disease interaction targets. The drug-compound-target network of YSQTG was constructed, suggesting that quercetin, luteolin, wogonin, kaempferol and baicalein may be the most important compounds, while quercetin had higher degree value and degree centrality, which might be the key compound in YSQTG. The HPLC-MS results also showed the stable presence of quercetin in YSQTG. By establishing a protein interaction network, the main therapeutic targets of YSQTG in treating esophageal cancer were Jun proto-oncogene, interleukin-6, tumor necrosis factor, and RELA proto-oncogene. The results of cell function experiments in vitro showed that quercetin could inhibit proliferation, invasion, and clonal formation of esophageal carcinoma cells. Quercetin mainly affected the biological processes of esophageal cancer cells, such as proliferation, cell cycle, and cell metastasis. A total of 357 quercetin interacting proteins were screened, and 531 genes were significantly changed. Further pathway enrichment analysis showed that quercetin mainly affects the metabolic pathway, MAPK signaling pathway, and nuclear factor kappa B (NF- κ B) signaling pathway, etc. Quercetin, the key compound of YSQTG, had stronger binding activity by molecular docking. Pull-down assay confirmed that NF- κ B was a quercetin-specific interaction protein, and quercetin could significantly reduce the protein level of NF- κ B, the main therapeutic target. YSQTG can be multi-component, multi-target, multi-channel treatment of esophageal cancer, it is a potential drug for the treatment of esophageal cancer.

Genome-Wide Analysis of the RNase T2 Family and Identification of Interacting Proteins of Four ClS-RNase Genes in 'XiangShui' Lemon.

S-RNase plays vital roles in the process of self-incompatibility (SI) in Rutaceae plants. Data have shown that the rejection phenomenon during self-pollination is due to the degradation of pollen tube RNA by S-RNase. The cytoskeleton microfilaments of pollen tubes are destroyed, and other components cannot extend downwards from the stigma and, ultimately, cannot reach the ovary to complete fertilisation. In this study, four S-RNase gene sequences were identified from the ‘XiangShui’ lemon genome and ubiquitome. Sequence analysis revealed that the conserved RNase T2 domains within S-RNases in ‘XiangShui’ lemon are the same as those within other species. Expression pattern analysis revealed that S3-RNase and S4-RNase are specifically expressed in the pistils, and spatiotemporal expression analysis showed that the S3-RNase expression levels in the stigmas, styles and ovaries were significantly higher after self-pollination than after cross-pollination. Subcellular localisation analysis showed that the S1-RNase, S2-RNase, S3-RNase and S4-RNase were found to be expressed in the nucleus according to laser confocal microscopy. In addition, yeast two-hybrid (Y2H) assays showed that S3-RNase interacted with F-box, Bifunctional fucokinase/fucose pyrophosphorylase (FKGP), aspartic proteinase A1, RRP46, pectinesterase/pectinesterase inhibitor 51 (PME51), phospholipid:diacylglycerol acyltransferase 1 (PDAT1), gibberellin receptor GID1B, GDT1-like protein 4, putative invertase inhibitor, tRNA ligase, PAP15, PAE8, TIM14-2, PGIP1 and p24beta2. Moreover, S3-RNase interacted with TOPP4. Therefore, S3-RNase may play an important role in the SI of ‘XiangShui’ lemon.

DNA G-Quadruplex in Human Telomeres and Oncogene Promoters: Structures, Functions, and Small Molecule Targeting.

DNA G-quadruplex secondary structures formed in guanine-rich human telomeres and oncogene promoters are functionally important and have emerged as a promising new class of cancer-specific drug targets. These globular intramolecular structures are stabilized by K+ or Na+ and form readily under physiological solution conditions. Moreover, G-quadruplexes are epigenetic features and can alter chromatin structure and function together with interactive proteins. Here, we discuss our efforts over the last two decades to understand the structures and functions of DNA G-quadruplexes formed in key oncogene promoters and human telomeres and their interactions with small molecules. Using high-field NMR spectroscopy, we determined the high-resolution structures of physiologically relevant telomeric G-quadruplexes in K+ solution with a major form (hybrid-2) and a minor form (hybrid-1), as well as a two-tetrad intermediate. The intrinsic structural polymorphism of telomeric DNA may be important for the biology of human telomeres, and we proposed a model for the interconversion. More recently, we have worked on G-quadruplexes of MYC, BCL2, PDGFR-β, VEGF, and k-RAS oncogene promoters. We determined the structure of the major G-quadruplex formed in the MYC promoter, a prototype for parallel G-quadruplexes. It is the first example of the parallel-stranded G3NG3 structure motif with a 1-nt loop, which is prevalent in promoter sequences and likely evolutionarily selected to initiate folding. Remarkably, the parallel MYC promoter G-quadruplexes are highly stable. Additionally, we determined the molecular structures of G-quadruplexes formed in human BCL2, VEGF, and PDGFR-β promoters, each adopting a unique structure. For example, the BCL2 promoter contains distinct interchangeable G-quadruplexes in two adjacent regions, suggesting precise regulation by different proteins. The PDGFR-β promoter adopts unique "broken-strand" and vacancy G-quadruplexes, which can be recognized by cellular guanine metabolites for a potential regulatory role.Structural information on G-quadruplexes in complex with small-molecules is critical for understanding specific recognition and structure-based rational drug design. Our studies show that many G-quadruplexes contain unique structural features such as capping and loop structures, allowing specific recognition by drugs and protein. This represents a paradigm shift in understanding DNA as a drug target: Rather than a uniform, nonselective binding site in duplex DNA, the G-quadruplex is being pursued as a new class of selectively targetable drug receptors. We focus on targeting the biologically relevant MYC promoter G-quadruplex (MycG4) with small molecules and have determined its first and additional drug complex structures. Very recently, we have discovered clinically tested indenoisoquinolines as strong MycG4 binders and potent MYC inhibitors. We have also discovered drugs targeting the unique dGMP-bound-vG4 formed in the PDGFR-β promoter. Moreover, we determined the complex structures of the first small molecules that specifically recognize the physiologically relevant human telomeric G-quadruplexes. Unlike the previously recognized dogma that the optimal G-quadruplex ligands are large aromatic or cyclic compounds, our results suggest that smaller asymmetric compounds with appropriate functional groups are better choices to specifically bind G-quadruplexes. This body of work lays a strong foundation for future work aimed at understanding the cellular functions of G-quadruplexes and G-quadruplex-targeted drug design.

Analysis of expression and interaction proteins of BjuSPL10c in B. juncea

• BjuSPL10c was expressed at a high level in flowers and up-regulated at reproductive stage. • Seven potential interactive proteins (BjuB025567, BjuA041065, BjuB033332, BjuA045694, BjuA027365, BjuA031237 and BjuA005619) were screened from B.juncea yeast library of flower buds at squaring stage. • Six (BjuB025567, BjuA041065, BjuB033332, BjuA045694, BjuA031237 and BjuA005619) of those proteins interacted with BjuSPL10c in vivo. • All of these six genes expressing interactive proteins were down-regulated in flowers. Brassica juncea var. tumida Tsen et Lee (Tumorous stem mustard) is a specific vegetable in China. Its tumorous stem can be consumed as fresh vegetable or produced pickle. In practice, early-bolting happens in around 15%, which inhibits B. juncea industry development. SPL is a plant specific transcription factor, plays important roles in flowering and gibberellins (GA) signaling. qRT-PCR assay found that BjuSPL10c was expressed at a high level in flowers and reproductive stage. To explore interactive proteins, BjuSPL10c was used as bait, finally seven proteins were screened and they are BjuB025567, BjuA041065, BjuB033332, BjuA045694, BjuA027365, BjuA031237 and BjuA005619. Further study confirmed that six of those proteins interacted with BjuSPL10c in vivo. qRT-PCR was conducted to understand mRNA expression levels of these six proteins in different tissues and development stages. The results showed that compared with root, mRNAs for all of these six genes were down-regulated in flowers. For different developmental stages, BjuB025567 and BjuA005619 were up-regulated at vegetative stage, down-regulated at reproductive stage; BjuB033332, BjuA045694 and BjuA031237 were significantly up-regulated at both vegetative and reproductive stages; BjuA041065 was showed “down-up-down” expression pattern. Taking all results together, BjuB025567, BjuA041065, BjuB033332, BjuA045694 and BjuA031237 may participate in flowering time regulation through interacting with BjuSPL10c in B. juncea .

Insights into functional connectivity in mammalian signal transduction pathways by pairwise comparison of protein interaction partners of critical signaling hubs.

Growth factors and cytokines activate signal transduction pathways and regulate gene expression in eukaryotes. Intracellular domains of activated receptors recruit several protein kinases as well as transcription factors that serve as platforms or hubs for the assembly of multi-protein complexes. The signaling hubs involved in a related biologic function often share common interaction proteins and target genes. This functional connectivity suggests that a pairwise comparison of protein interaction partners of signaling hubs and network analysis of common partners and their expression analysis might lead to the identification of critical nodes in cellular signaling. A pairwise comparison of signaling hubs across several related pathways might reveal novel signaling modules. Analysis of protein interaction connectome by Venn (PIC-Venn) of transcription factors STAT1, STAT3, NFKB1, RELA, FOS, and JUN, and their common interaction network suggested that BRCA1 and TSC22D3 function as critical nodes in immune responses by connecting the signaling hubs into signaling modules. Transcriptional regulation of critical hubs may play a major role in the lung epithelial cells in response to SARS-CoV-2 and in COVID-19 patients. Mutations and differential expression levels of these critical nodes and modules in pathological conditions might deregulate signaling pathways and their target genes involved in inflammation. Biological connectivity emerges from the structural connectivity of interaction networks across several signaling hubs in related pathways. The main objectives of this study are to identify critical hubs, critical nodes, and modules involved in the signal transduction pathways of innate and adaptive immunity. Application of PIC-Venn to several signaling hubs might reveal novel nodes and modules that can be targeted by small regulatory molecules to simultaneously activate or inhibit cell signaling in health and disease.