Inoculated Tomato Plants Research Articles

First Reports of Potato spindle tuber viroid on Solanum jasminoides and of Tomato apical stunt viroid on Solanum rantonnetti in Poland.

Potato spindle tuber viroid (PSTVd) has a quarantine status in the EU whereas Tomato apical stunt viroid (TASVd) is listed in the EPPO Alert list. During 2007 to 2012 surveys for the presence of PSTVd in 299 ornamental plants of the family Solanaceae (including Solanum jasminoides, S. rantonnetti, Brugmansia sp. and Petunia sp.) were carried out in Poland. The availability of a Pospiviroid genus-specific primer pair (1), which allows for the detection of the most prevalent viroids in ornamental plants by RT-PCR, has facilitated surveys of ornamental plants for pospiviroids. Fifteen S. rantonnetti and twenty-one S. jasminoides plants were sampled randomly and tested. Samples originated from seven different Polish provinces. Total RNA extraction was performed from plant leaves using Master Pure RNA Purification Kit (Epicentre). The obtained RNAs were further used for RT-PCR amplification using SuperScript One-Step RT-PCR System with PlatinumTaq DNA Polymerase (Invitrogen) kit according to the manufacturer's instructions. The Pospiviroid genus-specific primer set Vir1 5'CTTCAGTTGTTTCCACCGGGTAG 3' /Vir2 5'TTCCTGTGGTGCACTCCTGACC 3' (1), was used to amplify a 262-bp RT-PCR product. In addition, three positive samples were tested using PSTVd specific primers 3H1 5' ATCCCCGGGGAAACCTGGAGCGAAC3' /2H1 5'CCCTGAAGCGCTCCTCCGAG 3' (2,4) that amplified the 360-bp product. The presence of RT-PCR products of the expected size was confirmed in two S. jasminoides samples using both primer pairs. One positive sample of S. jasminoides in the testing season 2007/2008 was collected in Zachodniopomorskie Province. The second sample was collected in 2009 in the Lubuskie region. The obtained products were cloned into pGEM-Teasy vector and sequenced using M13F and M13R primers. The sequence comparison using MEGA5 software (3) revealed that both isolates were identical to each other and shared 98 to 100% sequence identity with other PSTVd isolates described to date. The obtained sequence was deposited in the GenBank database (Accession No. KC707563). In addition, in 20 samples of Solanaceae spp. collected in 2012, the presence of an RT-PCR product of 262 bp, typical for Pospiviroids, was shown in one sample of S. rantonnetti collected in Lubuskie Province. Sequencing of the PCR product identified TASVd, and the sequence has been deposited in GenBank (KC707564). Sap derived from PSTVd- and TASVd-positive samples was used to mechanically inoculate tomato plants (variety Moneymaker). In total, 25 plants were inoculated with PSTVd and 25 with TASVd. After 3 weeks, most of the tomato plants displayed growth reduction and distortion. Inoculated tomato plants were sampled and tested by RT-PCR for the presence of viroids and all obtained products were subjected to sequencing. The obtained sequences were identical with original ones. The viroids detected in the two Solanum sp. appeared to be efficiently transmitted to tomato, as 80% of the inoculated plants tested positive by RT-PCR. These results suggest that ornamental plants might act as a source of inocula for tomato or potato crops even if they do not display any visible symptoms. TASVd-infected S. rantonnetti was introduced to Poland from the Netherlands, while the origin of the PSTVd positive S. jasminoides is uncertain. Official eradication measures were imposed due to the detection of viroids in ornamental plants in Poland.

Burkholderia sp. SCMS54 reduces cadmium toxicity and promotes growth in tomato

AbstractCadmium (Cd) can enter soil through the use of fertilisers, calcareous, pesticides and industrial and/or domestic effluents. Cd can leach into groundwater and be taken up by plants, potentially leading to reductions in plant growth and yield. In soil, plant roots interact with heavy metal (HM)‐tolerant microorganisms that may promote plant growth. Soil microorganisms may also be able to solubilise or mobilise soil metals, thereby acting as bioremediators. A better understanding of the interaction among plants, metals, microorganisms and soil will lead to improved plant tolerance. Two multi‐tolerant bacteria from the Burkholderia genus were isolated from Cd‐contaminated and Cd‐uncontaminated soil of a coffee plantation. In addition to its high tolerance to Cd, the strain SCMS54 produces indole‐acetic acid (IAA), solubilises inorganic phosphate and produces siderophores, demonstrating its potential to contribute to beneficial plant–microorganism interactions. When interacting with tomato plants exposed to Cd, the bacterium led to decreases in plant peroxide and chlorosis levels, promoted relative plant growth and decreased the root absorption of Cd, resulting in increased plant tolerance to this highly toxic HM. The results indicated that the inoculation of tomato plants with Burkholderia sp. SCMS54 promotes better growth in plants cultivated in the presence of Cd. This phenomenon appears to be attributed to a mechanism that decreases Cd concentrations in the roots via a beneficial interaction between the bacteria and the plant roots.

Ethylene emission and PR protein synthesis in ACC deaminase producing Methylobacterium spp. inoculated tomato plants (Lycopersicon esculentum Mill.) challenged with Ralstonia solanacearum under greenhouse conditions

Bacteria of genus Methylobacterium have been found to promote plant growth and regulate the level of ethylene in crop plants. This work is aimed to test the induction of defense responses in tomato against bacterial wilt by stress ethylene level reduction mediated by the ACC deaminase activity of Methylobacterium strains. Under greenhouse conditions, the disease index value in Methylobacterium sp. inoculated tomato plants was lower than control plants. Plants treated with Methylobacterium sp. challenge inoculated with Ralstonia solanacearum (RS) showed significantly reduced disease symptoms and lowered ethylene emission under greenhouse condition. The ACC and ACO (1-aminocyclopropane-1-carboxylate oxidase) accumulation in tomato leaves were significantly reduced with Methylobacterium strains inoculation. While ACC oxidase gene expression was found higher in plants treated with R. solanacearum than Methylobacterium sp. treatment, PR proteins related to induced systemic resistance like β-1,3-glucanase, PAL, PO and PPO were increased in Methylobacterium sp. inoculated plants. A significant increase in β-1,3-glucanase and PAL gene expression was found in all the Methylobacterium spp. treatments compared to the R. solanacearum treatment. This study confirms the activity of Methylobacterium sp. in increasing the defense enzymes by modulating the ethylene biosynthesis pathway and suggests the use of methylotrophic bacteria as potential biocontrol agents in tomato cultivation.

Inoculation of tomato plants with rhizobacteria enhances the performance of the phloem-feeding insect Bemisia tabaci.

In their natural environment, plants experience multiple biotic interactions and respond to this complexity in an integrated manner. Therefore, plant responses to herbivory are flexible and depend on the context and complexity in which they occur. For example, plant growth promoting rhizobacteria (PGPR) can enhance plant growth and induce resistance against microbial pathogens and herbivorous insects by a phenomenon termed induced systemic resistance (ISR). In the present study, we investigated the effect of tomato (Solanum lycopersicum) pre-inoculation with the PGPR Pseudomonas fluorescens WCS417r, on the performance of the generalist phloem-feeding insect Bemisia tabaci. Based on the ability of P. fluorescens WCS417r to prime for ISR against generalists chewing insects and necrotrophic pathogens, we hypothesized that pre-inoculated plants will strongly resist B. tabaci infestation. In contrast, we discovered that the pre-inoculation treatment increased the tomato plant suitability for B. tabaci which was emphasized both by faster developmental rate and higher survivability of nymph stages on pre-inoculated plants. Our molecular and chemical analyses suggested that the phenomenon is likely to be related to: (I) the ability of the bacteria to reduce the activity of the plant induced defense systems; (II) a possible manipulation by P. fluorescens of the plant quality (in terms of suitability for B. tabaci) through an indirect effect on the rhizosphere bacterial community. The contribution of our study to the pattern proposed for other belowground rhizobacteria and mycorrhizal fungi and aboveground generalist phloem-feeders is discussed.

Molecular Screening ofTomato Yellow Leaf Curl Virus(TYLCV) in Tomato Cultivars at Buyeo Tomato Experiment Station, Chungnam, Korea

Molecular Screening of Tomato Yellow Leaf Curl Virus (TYLCV) in Tomato Cultivars at Buyeo Tomato Experiment Station, Chungnam, Korea Molecular screening detected the presence of Tomato yellow leaf curl virus (TYLCV) in tomato cultivars grown at Buyeo tomato experiment station (BTES) and in tomato samples collected from two farmer green houses (FGHs). A number of cultivars viz. BT07203, BT08205, Summer King, Madison, and Rapito exhibited tomato yellow leaf curl symptoms with a variable disease incidence (1.37 to 66.86%). Maximum disease incidence 66.86% was found in Rapito cultivar while the least incidence of 1.37% was found in the Madison cultivar. Doterong TY Winner, Minichal and Blackiss cultivars and root stock cultivars (Ganmaune, BT06302, BT07302 and BT10301-2) did not show any visible symptoms of TYLCV. Both FGH samples (cherry tomatoes) showed very mild symptoms. In a whitefly transmission analysis, TYLCV inoculated tomato plants showed leaf curl symptoms similar to naturally infected plants three weeks post-inoculation. None of the other test plant species viz. chilli, potato cantaloupe, cucumber, and sweet potato showed any visible symptoms. PCR analysis of these test plants with a CP gene degenerate primers resulted in positive amplification (~775 bp) in tomato, chilli, potato, cantaloupe, and cucumber but no such amplicon was resulted with sweet potato sample. Some apparently asymptomatic samples viz. Doterong TY winner Minichal and root stock cultivars Ganmaune, BT6302 and BT7302 were also found positive in PCR analysis. Only Blackiss and BT1031-2 cultivars (root stock) were found negative in PCR analysis. CP gene amplicons (~775bp) obtained from 6 isolates (four BTES and one each from both FGHs were cloned and sequenced and data was deposited in GenBank. In BLASTn and phylogenetic analysis, of all six isolates (four selected from BTES and one each from both farmer green houses) shared highest (99-100%) sequence identity and close relationships with various TYLCV isolates reported from South Korea and abroad. During the study, a degenerate primer pair designed based on the CP gene sequences of TYLCV, TbLCV, and SPLCV was found to be broad spectrum begomovirus detection. In PCR analysis, primer pair amplified ToLCNDV, AEV, BYVMV, and ICMV. The primers set may be employed to detect various begomoviruses. .

토마토반점위조바이러스(TSWV) 저항성 토마토 유전자원 탐색

Sw5-2 SCAR 분자표지와 생물검정법을 이용하여 토마토 유전자원 94종의 <TEX>$Tomato$</TEX> <TEX>$spotted$</TEX> <TEX>$wilt$</TEX> <TEX>$virus$</TEX>(TSWV) 저항성을 조사하였다. Sw5-2 SCAR 분자표지의 PCR 산물은 대략 574bp, 500bp, 462bp였는데, 크기가 가장 큰 PCR 산물이 Sw5-b 저항성 대립유전자와 연관되어 있었다. Sw5-b 저항성 대립유전자는 3개 수집종('Eureta', 10-318, 10-321)에서 관찰되었는데, 접종한 개체 가운데 이들 가운데 일부는 TSWV-pb1(토마토 분리주)에 일시적으로 감염되어 회복되거나 줄기에 괴사 병징을 보였다. ELISA 검사에서 음성으로 판명된 수집종 당 1개체씩 총 35개체를 선발하여 병징 발현 및 바이러스 감염 유무를 추가로 조사하였다. 접종 5개월 이후에 병징이 나타나지 않은 26개체를 대상으로 RT-PCR을 이용하여 TSWV 감염유무를 조사한 결과, 모든 개체에서 TSWV의 RT-PCR 산물이 약하게 증폭되었고, 이들 PCR 산물의 증폭 수준은 'Eureta'와 비슷하였다. 선발된 유전자원의 저항성은 조직 내 TSWV의 농도를 낮게 하는데 중요한 역할을 하고 이들은 Sw5를 포함한 여러 가지 유전자들에 의해 양적으로 조절되는 것으로 판단된다. A total of 94 tomato accessions were evaluated for the resistance to <TEX>$Tomato$</TEX> <TEX>$spotted$</TEX> <TEX>$wilt$</TEX> <TEX>$virus$</TEX> (TSWV) using a Sw5-2 SCAR marker and bioassay. PCR products of the marker were approximately 574 bp, 500 bp, and 462 bp, among which the longest was linked to TSWV resistance allele of Sw5-b. This allele was only found in three accessions (09-438, 10-318, and 10-321) in which some individuals showed apparent recovery or stem necrosis symptom to a tomato isolate of TSWV-pb1. Thirty-five individuals (one per each accession) which were non-infected by ELISA were selected for further observation. Among these, 26 individuals that did not show any symptom at 5 months after inoculation were confirmed for viral infection by RT-PCR. TSWV-specific PCR amplicon was weakly detected in all 26 individuals including 'Eureta', a commercial F1 possessing the resistance allele of Sw5-b. The resistant genes in the selected individuals may play an important role for reducing the viral concentration in tissues of inoculated tomato plants and seems to be quantitatively controlled by several factors including Sw5-b gene.

First Report of Tomato chlorosis virus in Potato in Brazil.

Potato plants (Solanum tuberosum cv. Ágata) exhibiting symptoms of leaf roll and interveinal chlorosis, especially on older leaves, were found in a commercial crop in the County of Cristalina, State of Goiás, Brazil in June 2011. The crop was severely infested by whitefly Bemisia tabaci biotype B. Four potato tubers from symptomatic plants were indexed for the presence of the following viruses: Tomato chlorosis virus (ToCV), Potato leaf roll virus (PLRV), Tomato severe rugose virus (ToSRV), and Potato virus Y (PVY). Total RNA was extracted separately from each tuber and used for reverse transcription (RT)-PCR using the HS-11/HS-12 primer pair, which amplifies a fragment of 587 bp from the highly conserved region of the heat shock protein (HSP-70) homolog gene reported for ToCV. The RT-PCR product was subsequently tested by nested-PCR for detection of ToCV with specific primers ToC-5/ToC-6 (2). Amplicons of 463 bp, amplified from total RNA separately extracted from three tubers, were purified and directly sequenced. Comparisons among the three consensus sequences of 448 bp (GenBank Accession Nos. JQ288896, JQ288897, and JQ288898) revealed respectively, 98, 100, and 100% identity with the reported sequence of a tomato isolate of ToCV from Brazil (GenBank Accession No. EU868927) (1). For ToSRV detection, total DNA was extracted from two tubers and a fragment of approximately 820 bp was amplified by PCR with specific primers (3). PLRV and PVY were indexed in two and three tubers, respectively, by double-antibody sandwich-ELISA (SASA, Edinburg, Scotland). Virus-free B. tabaci biotype B were separately transferred to potato and tomato leaves infected with ToCV for an acquisition access period of 24 h. Groups of 30 viruliferous whitefly were transferred to four, young, sprout-grown potato plants cv. Ágata (two plants per virus isolate) for 24-h inoculation access period. After 37 days of inoculation, one plant inoculated with the potato and tomato isolates of ToCV, respectively exhibited symptoms of leaf roll and interveinal chlorosis on order leaves, which were similar to that induced by PLRV. Experimental infection of potato plants with ToCV, which induced leaf roll symptoms resembling PLRV infection, was reported in the United States by Wisler et al. (4). The potato isolate of ToCV was also transmitted by B. tabaci to one of two inoculated tomato plants. The presence of ToCV in all inoculated plants was detected by nested-RT-PCR as described above. To our knowledge, this is the first report on detection of ToCV in field potato plants in the world. Considering that ToCV occurs in innumerous countries around the world, it is transmitted by a cosmopolitan insect, and it induces symptoms similar to PLRV, this finding triggers an alert to field dependent seed-potato multiplication, virus inspector, and certification system.

Profiling Thiol Redox Proteome Using Isotope Tagging Mass Spectrometry

Pseudomonas syringae pv. tomato strain DC3000 not only causes bacterial speck disease in Solanum lycopersicum but also on Brassica species, as well as on Arabidopsis thaliana, a genetically tractable host plant1,2. The accumulation of reactive oxygen species (ROS) in cotyledons inoculated with DC3000 indicates a role of ROS in modulating necrotic cell death during bacterial speck disease of tomato3. Hydrogen peroxide, a component of ROS, is produced after inoculation of tomato plants with Pseudomonas3. Hydrogen peroxide can be detected using a histochemical stain 3'-3' diaminobenzidine (DAB)4. DAB staining reacts with hydrogen peroxide to produce a brown stain on the leaf tissue4. ROS has a regulatory role of the cellular redox environment, which can change the redox status of certain proteins5. Cysteine is an important amino acid sensitive to redox changes. Under mild oxidation, reversible oxidation of cysteine sulfhydryl groups serves as redox sensors and signal transducers that regulate a variety of physiological processes6,7. Tandem mass tag (TMT) reagents enable concurrent identification and multiplexed quantitation of proteins in different samples using tandem mass spectrometry8,9. The cysteine-reactive TMT (cysTMT) reagents enable selective labeling and relative quantitation of cysteine-containing peptides from up to six biological samples. Each isobaric cysTMT tag has the same nominal parent mass and is composed of a sulfhydryl-reactive group, a MS-neutral spacer arm and an MS/MS reporter10. After labeling, the samples were subject to protease digestion. The cysteine-labeled peptides were enriched using a resin containing anti-TMT antibody. During MS/MS analysis, a series of reporter ions (i.e., 126-131 Da) emerge in the low mass region, providing information on relative quantitation. The workflow is effective for reducing sample complexity, improving dynamic range and studying cysteine modifications. Here we present redox proteomic analysis of the Pst DC3000 treated tomato (Rio Grande) leaves using cysTMT technology. This high-throughput method has the potential to be applied to studying other redox-regulated physiological processes.

Profiling Thiol Redox Proteome Using Isotope Tagging Mass Spectrometry

Pseudomonas syringae pv. tomato strain DC3000 not only causes bacterial speck disease in Solanum lycopersicum but also on Brassica species, as well as on Arabidopsis thaliana, a genetically tractable host plant1,2. The accumulation of reactive oxygen species (ROS) in cotyledons inoculated with DC3000 indicates a role of ROS in modulating necrotic cell death during bacterial speck disease of tomato3. Hydrogen peroxide, a component of ROS, is produced after inoculation of tomato plants with Pseudomonas3. Hydrogen peroxide can be detected using a histochemical stain 3'-3' diaminobenzidine (DAB)4. DAB staining reacts with hydrogen peroxide to produce a brown stain on the leaf tissue4. ROS has a regulatory role of the cellular redox environment, which can change the redox status of certain proteins5. Cysteine is an important amino acid sensitive to redox changes. Under mild oxidation, reversible oxidation of cysteine sulfhydryl groups serves as redox sensors and signal transducers that regulate a variety of physiological processes6,7. Tandem mass tag (TMT) reagents enable concurrent identification and multiplexed quantitation of proteins in different samples using tandem mass spectrometry8,9. The cysteine-reactive TMT (cysTMT) reagents enable selective labeling and relative quantitation of cysteine-containing peptides from up to six biological samples. Each isobaric cysTMT tag has the same nominal parent mass and is composed of a sulfhydryl-reactive group, a MS-neutral spacer arm and an MS/MS reporter10. After labeling, the samples were subject to protease digestion. The cysteine-labeled peptides were enriched using a resin containing anti-TMT antibody. During MS/MS analysis, a series of reporter ions (i.e., 126-131 Da) emerge in the low mass region, providing information on relative quantitation. The workflow is effective for reducing sample complexity, improving dynamic range and studying cysteine modifications. Here we present redox proteomic analysis of the Pst DC3000 treated tomato (Rio Grande) leaves using cysTMT technology. This high-throughput method has the potential to be applied to studying other redox-regulated physiological processes.

Regulation of Ethylene Emission in Tomato (Lycopersicon esculentum Mill.) and Red Pepper (Capsicum annuum L.) Inoculated with ACC Deaminase Producing Methylobacterium spp.

Improvement of plant growth by Methylotrophic bacteria can be influenced through alterations in growth modulating enzymes or hormones, especially by decreasing ethylene levels enzymatically by 1-aminocyclopropane-1-carboxylate (ACC) deaminase or by production of indole-3-acetic acid (IAA). In this study, the effect of seven strains of Methylobacterium on seedling ethylene emission of tomato and red pepper plants was evaluated under greenhouse condition. Ethylene emission was lowest in Methylobacterium oryzae CBMB20 inoculated tomato plants and CBMB110 inoculated red pepper plants at 47 days after sowing (DAS). However, at 58 DAS all inoculated plants showed almost similar pattern of ethylene emission. Methylobacterium inoculated tomato and red pepper plants showed significantly less ethylene emission compared to control. Our results demonstrated that Methylobacterium spp. inoculation promotes plant growth due to the reduction of ethylene emission and therefore can be potentially used in sustainable agriculture production systems.

Induced Suppressiveness to Fusarium oxysporum with Phytostimulation Microorganisms (PSMs) in Hydroponically Grown Tomato

Phytostimulation microorganisms (PSMs) vis. Bacillus subtilis, Bacillus polymyxa and Trichoderma harzianum were tested for their ability to suppress and control Fusariumroot rot in tomato plants grown in sterilized soilless medium artificially infested with Fusarium oxysporum f. sp. radicis-lycopersici (FORL). Antagonistic activities under laboratory conditions were detected at various degrees of the PSMs against F. oxysporum. T. harzianum was the most potent antagonist and gave an inhibition value of 62%. T. harzianum was also the most effective in decreasing the percentage of pre-emergence damping-off (50%) while B. polymyxa was the most effective one in decreasing the post-emergence (3%) under greenhouse conditions. PSMS were used as seeds soaking or seedlings inoculation of tomato plants. Pathogenicity test showed that seedlings were more susceptible to F. oxysporum than seeds. PSMS-treated seeds showed that T. harzianum was the superior in controlling Fusarium root rot disease (93% disease control percentage) while in case of seedlings inoculation, B. subtilis gave the highest disease control value (73.3%). B. subtilis and B. polymyxa treated seeds or seedlings were the superior in improving most growth parameters tested in both cases compared to the controls. These results suggest that the increasing of disease control and improvement of tomato growth parameters by seeds or seedlings inoculation with PSMS may contribute to protection of tomato plants against F. oxysporum root rot disease.

First Report of Natural Infection of Greenhouse Tomatoes by Potato spindle tuber viroid in the United States.

In April 2009, a large number of tomato plants (Solanum lycopersicum L.) grown in a commercial greenhouse facility near Los Angles, CA exhibited general plant stunting (short internodes) and foliar symptoms that included distortion, chlorosis, and scattered necrotic spotting. Over time, the leaves began to exhibit a purple color and curling. Diseased plants were often elongated and frail with spindly shoots. The disease resulted in a significant yield loss due to reduced fruit size. Disease symptoms described above are generally different from those of Pepino mosaic virus (PepMV) infection, which causes yellow mosaic or patches on leaves and marbling of fruits. The disease was initially localized in certain areas in a greenhouse despite using a number of cultural management efforts including vigorous scouting, roguing of diseased plants, and strict hygiene and cleaning practices. The disease was also observed in neighboring greenhouses by the spring of 2010. A standard panel of tests for common tomato viruses and viroids were conducted using the appropriate serological or PCR assays. Reverse transcription (RT) PCR analysis of nine symptomatic plants with pospiviroid-specific primers, Pospil-RE and Pospil-FW (3), produced an amplicon of the expected size (~196 bp) while three healthy looking tomato plants did not. Subsequently, full viroid genomic sequences were obtained through RT-PCR with primer sets specific for Potato spindle tuber viroid (PSTVd), 3H1/2H1 (2), as well as for the pospiviroid genus, MTTVd-F and MTTVd-R (1). Sequences obtained from direct sequencing of amplicons or cloned PCR products from one isolate were identical and consisted of a full viroid genome of 358 nt, which was named PSTVd-CA1 (GenBank Accession No. HM753555). BLASTn queries of the NCBI database showed that this isolate had a high sequence identity (98%) to other PSTVd isolates (i.e., EF044304, X52037, and Y09577). The disease was reproducible upon mechanical transmission (1) on three tomato 'Moneymaker' plants, which expressed symptoms that were similar to those on the source plants. Recovery of PSTVd on the inoculated tomato plants was confirmed by RT-PCR and sequencing. Because of its susceptibility to viroid infection, tomato 'Moneymaker' plants are commonly used as indicators for the study of pospiviroids, including PSTVd. Natural PSTVd infection on greenhouse tomatoes has been reported in Europe (3) and New Zealand. Although a number of reports in the United States have been published on naturally occurring PSTVd infections of potatoes, to our knowledge, this is the first report of a natural PSTVd infection on tomatoes in the United States. The exact source of the PSTVd inoculum in the current disease outbreak is unknown, but it could have been introduced from infected potato or ornamental plants (4) or through infected tomato seeds. The disease epidemic might have been enhanced by frequent hands-on activities in greenhouse tomato production and the environmental conditions (high temperature and intense lighting) in the greenhouse that favor symptom expression.

First Report of Capsicum chlorosis virus Infecting Tomato in Taiwan.

In December 2009, two samples from tomato plants (Solanum lycopersicum cv. Known-you 301) showing symptoms of chlorosis and necrosis on leaves were collected from two different fields that exhibited 5% disease incidence in Wufeng Township, Taichung County. Reverse transcription (RT)-PCR was applied to detect the presence of potential viruses in collected samples using three degenerate primers (3), gL3637/gL4435c for tospoviruses, Tob-Uni1/Tob-Uni2 for tobamoviruses, and Hrp5/Pot1 for potyviruses, and one specific primer, FJJ2001-7/FJJ2001-8, for the coat protein gene of Cucumber mosaic virus (3). An 816-nt DNA fragment was amplified from each of these two field samples by RT-PCR with the tospovirus degenerate primers, gL3637/gL4435c, designed from the conserved region of L RNA. One of the amplified fragments was cloned and sequenced. A homology search indicated that the new tomato-infecting virus in Taiwan might belong to Capsicum chlorosis virus (CaCV) since the partial L RNA shared more than 87% nucleotide and 99.6% amino acid identity with two CaCV isolates from Thailand (GenBank Accession Nos. DQ256124 and NC_008302). A virus culture isolated from the symptomatic tomato was established in Chenopodium quinoa through triple single-lesion isolation and designated as TwTom1. The partial L RNA and full-length nucleocapsid (N) gene of TwTom1 were obtained by RT-PCR with primer pairs gL3637/gL4435c and FJJ 2010-2 (5'-TTAAAT(C/T)ACAC(C/T)TCTATAGA)/N3534c (1), respectively. The 816-nt L RNA conserved region of TwTom1 (Accession No. HM021140) also shared 87% nucleotide and 99.6% amino acid identity with those of the above mentioned two CaCV isolates available in GenBank. The 828-nt N gene of TwTom1 (Accession No. HM021139) shared 85 to 98.1% nucleotide and 92 to 100% amino acid identity with those of 26 CaCV isolates available in GenBank. TwTom1 shared the highest N gene nucleotide and amino acid identity, 98.1 and 100%, respectively, with a gloxinia isolate (Accession No. AY312061). Sequence analysis results indicated that TwTom1 is an isolate of CaCV. The TwTom1 isolate was back inoculated onto three tomato (cv. Known-you 301) plants for pathogenicity test. The inoculated tomato plants showed symptoms of chlorosis at 13 days postinoculation (dpi) and symptoms of chlorosis plus necrosis on leaves at 20 dpi, which were similar to that observed in the field. A protein band measuring approximately 30 kDa in the crude sap of the TwTom1-infected tomato was observed in western blotting using the antiserum against the N protein of CaCV. In addition, CaCV was later detected by RT-PCR in two symptomatic tomato samples collected from another field. CaCV was first found in Australia, then Thailand, Taiwan, China, and India (2). Although CaCV was found to infect several species of ornamental crops in Taiwan, to our knowledge, this is the first report of CaCV that could naturally infect tomato, a nonornamental plant in Taiwan.

Ralstonia solanacearum ΔPGI-1 Strain KZR-5 Is Affected in Growth, Response to Cold Stress and Invasion of Tomato

The survival and persistence of Ralstonia solanacearum biovar 2 in temperate climates is still poorly understood. To assess whether genomic variants of the organism show adaptation to local conditions, we compared the behaviour of environmental strain KZR-5, which underwent a deletion of the 17.6 kb genomic island PGI-1, with that of environmental strain KZR-1 and potato-derived strains 1609 and 715. PGI-1 harbours two genes of potential ecological relevance, i.e. one encoding a hypothetical protein with a RelA/SpoT domain and one a putative cellobiohydrolase. We thus assessed bacterial fate under conditions of amino acid starvation, during growth, upon incubation at low temperature and invasion of tomato plants. In contrast to the other strains, environmental strain KZR-5 did not grow on media that induce amino acid starvation. In addition, its maximum growth rate at 28°C in rich medium was significantly reduced. On the other hand, long-term survival at 4°C was significantly enhanced as compared to that of strains 1609, 715 and KZR-1. Although strain KZR-5 showed growth rates (at 28°C) in two different media, which were similar to those of strains 1609 and 715, its ability to compete with these strains under these conditions was reduced. In singly inoculated tomato plants, no significant differences in invasiveness were observed among strains KZR-5, KZR-1, 1609 and 715. However, reduced competitiveness of strain KZR-5 was found in experiments on tomato plant colonisation and wilting when using 1:1 or 5:1 mixtures of strains. The potential role of PGI-1 in plant invasion, response to stress and growth in competition at high and moderate temperatures is discussed.

Potential use of hydroxytyrosol-rich extract from olive mill wastewater as a biological fungicide against Botrytis cinerea in tomato

Olive mill wastewater (OMW) is a rich source of antifungal agents and has a merit as alternative to synthetic fungicides. To develop disease control agents against Botrytis cinerea, a hydroxytyrosol-rich (29.27% weight:dry weight) olive mill wastewater (HROMW) and a hydroxytyrosol-rich (52.67% weight:dry weight) extract (HRE) were prepared from fresh OMW using hydrolysis and post-hydrolysis purification processes. The HROMW and HRE showed strong fungicidal activity against B. cinerea with minimal fungicidal concentrations (MFCs) of 14.36–28.72 and 28.72–57.44 mg l−1 (dry weight), respectively. According to EN 1275: 1997 standard method, HROMW and HRE at 1.25% (dry weight:volume) showed powerful disinfectant properties resulting in a reduction in the viability of B. cinerea spores by >4 log units after 30 min of contact time. The HROMW or HRE foliar spray treatments, of the B. cinerea inoculated tomato plants, resulted in disease control percentage of 95 and 91%, respectively, whereas 70% was conferred by benomyl treatment. Although, HRE possessed a similar disease severity reduction than HROMW, it showed great advantage by fortifying plants and by improving their growth and healthy aspect. Indeed, HRE-treated plants showed significantly better: (i) plant height (146.2 and 130.5%), (ii) average stem diameter (135% and 110%), (iii) leaf number (163.6 and 128.5%), and (iv) leaf colour (chlorophyll a content) (144.4 and 103%) than benomyl-treated and non-treated plants, respectively. This study revealed that HRE offers a natural and effective extract to control grey mould.

Mycorrhizal root colonisation and the subsequent host plant response of soil less grown tomato plants in the presence and absence of the mycorrhizal stimulant, Mycotech

A hydroponic trial was carried out to assess the effect of inoculating tomato plants with AM fungi, in the presence and absence of a mycorrrhizal stimulant (Mycotech). Four treatments were applied: (1) AM inoculant, (2) mycorrhizal stimulant, (3) AM + stimulant and (4) stimulant alone. Arbuscular mycorrhizal treated plants were 14% root colonized, whilst AM + stimulant treated plants, were 25% colonized. No colonization was observed in non-AM and non-AM + Stimulant treated plants. However, AM + stimulant treated plants did not show any significant improvement over AM treated plants, in either the plant nutrient concentrations, except Cu, or the growth of the plants, despite a root colonization advantage. In general, there was also no improvement in colonized plants over non-colonized plants, possibly due to the abundant supply of nutrients. However, stimulant treated plants performed better than the other plants in terms of their P, K, Ca, Mg and Mn nutrition. The causes of this increase remain unknown. This study has shown that the combined use of mycorrhizal stimulant and AM have a definite advantage for improving root colonization levels, but more research with regard to nutrient supply in the system, is required to ensure further benefits to the plants. Key words: Arbuscular mycorrhizal, dry matter, hydroponics, inoculant, macronutrients, micronutrients, tomatoes

Pseudomonas corrugata and Pseudomonas marginalis associated with the collapse of tomato plants in rockwool slab hydroponic culture

Plant pathogenic species Pseudomonas corrugata and P. marginalis were detected and determined in collapsed tomato plants in rockwool slab hydroponic culture in southern Moravia, Czech Republic. Surprisingly, P. marginalis was also determined before planting in apparently healthy grafted tomato transplants grown in hydroponic culture. Moreover, non-pathogenic P. fluorescens, P. putida, P. synxantha, and Stenotrophomonas malthophilia were identified. The Biolog Identification GN2&amp;nbsp;MicroPlate&amp;trade; System System (Biolog, Inc., Hayward, USA) was used for identification of bacterial isolates. Cultures of P. corrugata and P. marginalis were used in a greenhouse pathogenicity experiment. Seven weeks old tomato plants of cv. Moneymaker grown in sterilised perlite were inoculated into the stem with a hypodermic needle at one point above the cotyledon node. In inoculated tomato plants, disease symptoms were observed that included external and internal dark brown lesions around the inoculation site, watering and collapse of pith and sometimes also vascular browning and wilting of leaves. In comparison with P. marginalis, P. corrugata appeared to be a much stronger pathogen. Both tested Pseudomonas species were recovered from inoculated tomato plants. P. corrugata was found to move both upwards to the apex of the stem and downwards from the site of the inoculated stem into roots. When inoculated into potato tuber slices, some tomato strains of P. marginalis, P. fluorescens, P. synxantha, and Pseudomonas sp. produced soft rot. However, other strains of the same species were not able to macerate the potato tissue. It is concluded that P. corrugata and P. marginalis can be associated with the collapse of tomato crop in soilless culture grown in a greenhouse. This is the first report on P. corrugata in tomato plants in the Czech Republic. The role of plant pathogenic bacteria, fungal root rot and vascular pathogens and Pepino mosaic virus in the collapse of tomato plants is discussed.

Effect of viroid infection on the dynamics of phenolic metabolites in the apoplast of tomato leaves

Plants are capable of producing a wide array of secondary metabolites that serve a variety of functions, due to their bioactive, redox or structural properties. Subtle changes in the external or internal environment of the plant can cause significant changes in the array of secondary metabolites present in the tissue. During the last 10 years the critical roles that these metabolites play both in plant development as well as plant defense against biological and abiotic stresses have begun to become more widely appreciated. Here we describe changes in apoplastic phenolics associated with systemic infections of Potato spindle tuber viroid (PSTVd) as it spreads through inoculated tomato plants. Apoplast fluids from leaves at different distances from the infection site were examined by HPLC–UV over a 5 week period. The phenolic composition of apoplasts in healthy plants was highly dynamic and depended on leaf position as well as plant age. Differences in the apoplast composition of PSTVd infected plants were detected only in leaves in which the viroid was present and multiplied. In those leaves, apoplast phenolics that were similar to the control generally decreased although some increased compared to control plants. Another set of phenolics that were unique to the viroid infected plants appeared simultaneously with the onset of viroid replication and then disappeared. An important basic finding of this study is that the composition of apoplastic metabolites is dynamic, changing with time and leaf development. In addition we demonstrate that the secondary metabolites of the leaf apoplast respond to the presence of the viroid in the symplast of the cell. This study provides a basis for a more detailed investigation of the dynamics and identification of the apoplastic phenolics involved in the viroid–host interaction.

First Report of a Natural Infection by Mexican Papita Viroid and Tomato Chlorotic Dwarf Viroid on Greenhouse Tomatoes in Mexico

In early 2008, tomato plants (Solanum lycopersicum) grown in a large greenhouse facility located near Mexico City exhibited general stunting, leaf chlorosis at the top of the diseased plant that later turned bronze or purple, and reduced-sized fruits. Initially, diseased plants were confined to a 5-ha greenhouse, but the disease quickly spread to two additional 5-ha greenhouses in the summer of 2008. By the end of 2008, approximately 5% of tomato plants in 35-ha of greenhouse were infected. Sixteen diseased samples were collected, twelve in 2008 and four in 2009. Bioassays through mechanical inoculation with leaf extracts of diseased samples demonstrated the transmissibility of the causal agent to plants of tomato cvs. Horizon or Rutgers, which expressed symptoms that were similar to those on the source plants. Serological or PCR assays were negative for several commonly occurring greenhouse tomato viruses. However, an expected size product (~196 bp) was consistently detected by reverse transcription (RT)-PCR using pospiviroid-specific primers Pospil-RE and Pospil-FW (4) in all symptomatic samples or from the mechanically inoculated tomato plants. Preliminary analysis with sequences obtained from direct sequencing of amplicons revealed one dominant sequence with 94% identity to Mexican papita viroid (MPVd) (GenBank Accessions Nos. L78454 and L78456-L78463). However, further analysis of the cloned cDNAs indicated a mixed infection of two pospiviroids in two samples. Of 10 cDNA clones analyzed, 9 were MPVd-like sequences and one was sequence of Tomato chlorotic dwarf viroid (TCDVd). Further analysis using full genomic sequences obtained by RT-PCR with previously designed primers (2) or a new set of primers (MTTVd-F: 5' GGG GAA ACC TGG AGC GAA CTG G, and MTTVd-R: 5' GGG GAT CCC TGA AGC GCT CCT) revealed genetic diversity in this population. Eight of thirteen cloned cDNAs represented by the 359-nt sequence of isolate Mex8 (GenBank Accession No. GQ131572) had 93 to 94% nucleotide sequence identity to other MPVd isolates (L78454 and L78456-L78463). Five other cDNA clones represented by the 361-nt sequence of isolate HM2 (GenBank Accession No. GQ131573) were 99% identical to a TCDVd isolate recently identified in Arizona (GenBank Accession No. FJ822878) and 96 to 97% identical to TCDVd isolates from other areas (GenBank Accession Nos. AF162131 and AB329668). These results are the first evidence of a mixed infection of two viroids infecting tomatoes in Mexico. MPVd was first identified in Mexico on papita (S. cardiophyllum) in 1996 (1). The origin of TCDVd in this greenhouse was not determined, but TCDVd potentially can be seed transmitted in tomato (3). The close relationship between the Mexican and the U.S. isolates suggests that TCDVd in these two countries may share a common origin, likely from seed. To our knowledge, this is the first report of a natural infection of MPVd and TCDVd on tomatoes in Mexico.

Blue mold of tomato caused by Penicillium oxalicum in Japan

In 2006, stem rot and blue-green crusty lesions were found on the stems of tomato plants in Chiba Prefecture, Japan. Penicillium oxalicum was isolated repeatedly from the diseased plants. The causal fungus reproduced natural symptoms after artificial inoculation of tomato plants and was re-isolated from symptomatic plant tissue. P. oxalicum is a new pathogen that causes blue mold on tomato plants in Japan.