Infections In South Africa Research Articles

The influence of smoking and HIV infection on pulmonary function.

BackgroundPrevalence of HIV, smoking, and pulmonary infections in South Africa are high.ObjectivesWe investigated the role of smoking and HIV status on lung function.MethodsThis is a secondary analysis of a cross-sectional study conducted in South Africa. Data included demographics, pulmonary risk factors and a spirometry test to obtain the forced expiratory volume in one second (FEV1) and the ratio of FEV1/forced vital capacity (FVC). In the initial multivariable regression analysis, the effect of smoking on pulmonary function in HIV-positive adults was assessed. The analysis was repeated, assessing the influence of HIV status on lung function in both HIV-negative and HIV-positive smokers. The models were adjusted for age, sex, body mass index (BMI), time since HIV diagnosis, antiretroviral treatment (ART) use, occupational hazards, history of tuberculosis or pneumonia, indoor smoking and the presence of an indoor fireplace during childhood.ResultsThis study included 524 people living with HIV (PLWH, 66.7% female, mean age 40.9 years [s.d.; 9.4]) and 79 HIV-negative smokers (77.2% male, mean age 34.4 years [s.d.: 12.1]). Of the PLWH, 118 (22.5%) were past or current smokers and 406 (77.5%) were non-smokers. Smoking was not associated with changes in the FEV1 or FEV1/FVC ratio in multivariable regression analysis. In the second analysis, HIV status was also not associated with reduced pulmonary function following adjustment for confounders.ConclusionNeither smoking nor being HIV-positive was associated with decreased pulmonary function in this relatively young population. These findings should be confirmed in a longitudinal study, including an older population.

Study protocol for a population-based observational surveillance study of culture-confirmed neonatal bloodstream infections and meningitis in South Africa: Baby GERMS-SA

IntroductionWorldwide, neonatal mortality remains high accounting for 47% of childhood deaths in 2019 and including an estimated 500 000 deaths from neonatal infections. While 42% of global neonatal deaths occur...

Oral and Oropharyngeal HPV prevalence in South Africa A systematic review and meta-analysis

Prevalence data for HPV infection in the head and neck in Southern African populations is lacking. In addition to cervical cancer, this sexually transmitted oncogenic virus is responsible for a subset of head and neck cancer and is transmitted via oral sexual routes, and through other forms of intimate contact between anatomical sites lined by mucosa. This systematic review and meta-analyses aimed to synthesize data for the prevalence of head and neck HPV infection in South Africa. Original research papers from South Africa reporting on the prevalence of HPV in the head and neck was systematically reviewed using PubMed, Ovid Medline, Embase and the Cochrane Library. A meta-analysis on the prevalence data wasconducted for 16 papers that met the inclusion criteria.

Prevalence and incidence rates of laboratory-confirmed hepatitis B infection in South Africa, 2015 to 2019.

BackgroundHepatitis B virus (HBV), a global public health threat, is targeted for elimination by 2030. As national HBV prevalence and incidence is lacking for South Africa, our study aimed to provide such data in the public health sector.MethodsWe analysed laboratory-confirmed HBV data from 2015 to 2019 to determine annual prevalence and incidence rates of HBV infection per 100,000 population, HBsAg and anti-HBc IgM test positivity rates, and HBsAg and anti-HBc IgM testing rates per 100,000 population. Time trend and statistical analyses were performed on HBsAg and anti-HBc IgM test positivity rates.ResultsThe national prevalence rate of HBV infection per 100,000 population increased from 56.14 in 2015 to 67.76 in 2019. Over the five years, the prevalence rate was higher in males than females, highest amongst individuals 25 to 49 years old and highest in Gauteng province. The HBsAg test positivity rate dropped from 9.77% in 2015 to 8.09% in 2019. Over the five years, the HBsAg test positivity rate was higher in males than females, amongst individuals 25 to 49 years old and amongst individuals of Limpopo province. Amongst HBsAg positive children under 5 years old, the majority (65.7%) were less than a year old. HBsAg testing rates per 100,000 population were higher in females under 45 years of age and in males 45 years and above. The national incidence rate of acute HBV infection per 100,000 population dropped from 3.17 in 2015 to 1.69 in 2019. Over the five-year period, incidence rates were similar between males and females, highest amongst individuals 20 to 39 years old and highest in Mpumalanga province. Amongst individuals 20 to 24 years old, there was a substantial decline in the incidence and anti-HBc IgM test positivity rates over time. Anti-HBc IgM testing rates per 100,000 population were higher in females under 40 years of age and in males 40 years and above.ConclusionCritical to hepatitis B elimination is strengthened infant vaccination coverage and interruption of vertical transmission. Transmission of HBV infection in adults may be reduced through heightened awareness of transmission routes and prevention measures.

Transmission of Omicron (B.1.1.529) - SARS-CoV-2 Variant of Concern in a designated quarantine hotel for travelers: a challenge of elimination strategy of COVID-19

Transmission of Omicron (B.1.1.529) - SARS-CoV-2 Variant of Concern in a designated quarantine hotel for travelers: a challenge of elimination strategy of COVID-19

Low seroprevalence of hepatitis E virus in pregnant women in an urban area near Pretoria, South Africa

Hepatitis E virus (HEV) infection is a globally neglected health problem with a high burden in resource-poor communities. Pregnant women are at increased risk of complications. This pilot study sought to assess the seroprevalence of HEV infection in pregnant women at Dr George Mukhari Academic Hospital, South Africa. Stored serum samples from 384 HIV-uninfected pregnant women attending the antenatal clinic were initially screened for HEV total antibody. Positive samples were further evaluated for the presence of IgG and IgM antibody isotypes, using commercial ELISA assays. HEV RNA was assessed in antibody-positive samples utilizing qRT-PCR assay. The sample consisted of women with a median age of 31 years (interquartile range: 28-35 years). Total HEV antibody was detected in 12/384 (3.13%, 95% CI: 1.80-5.38) of these pregnant women. All 12 samples were IgG HEV antibody positive, but none tested positive for IgM antibody or for HEV RNA, demonstrating a lack of current or recent exposure. Our study revealed a low seroprevalence of HEV among pregnant women from an urban area north of Pretoria. This observation warrants further attention to the circulation of HEV in this population, and a greater understanding of the epidemiology of the infection in South Africa.

Reduced neutralisation of the Delta (B.1.617.2) SARS-CoV-2 variant of concern following vaccination.

Vaccines are proving to be highly effective in controlling hospitalisation and deaths associated with SARS-CoV-2 infection but the emergence of viral variants with novel antigenic profiles threatens to diminish their efficacy. Assessment of the ability of sera from vaccine recipients to neutralise SARS-CoV-2 variants will inform the success of strategies for minimising COVID19 cases and the design of effective antigenic formulations. Here, we examine the sensitivity of variants of concern (VOCs) representative of the B.1.617.1 and B.1.617.2 (first associated with infections in India) and B.1.351 (first associated with infection in South Africa) lineages of SARS-CoV-2 to neutralisation by sera from individuals vaccinated with the BNT162b2 (Pfizer/BioNTech) and ChAdOx1 (Oxford/AstraZeneca) vaccines. Across all vaccinated individuals, the spike glycoproteins from B.1.617.1 and B.1.617.2 conferred reductions in neutralisation of 4.31 and 5.11-fold respectively. The reduction seen with the B.1.617.2 lineage approached that conferred by the glycoprotein from B.1.351 (South African) variant (6.29-fold reduction) that is known to be associated with reduced vaccine efficacy. Neutralising antibody titres elicited by vaccination with two doses of BNT162b2 were significantly higher than those elicited by vaccination with two doses of ChAdOx1. Fold decreases in the magnitude of neutralisation titre following two doses of BNT162b2, conferred reductions in titre of 7.77, 11.30 and 9.56-fold respectively to B.1.617.1, B.1.617.2 and B.1.351 pseudoviruses, the reduction in neutralisation of the delta variant B.1.617.2 surpassing that of B.1.351. Fold changes in those vaccinated with two doses of ChAdOx1 were 0.69, 4.01 and 1.48 respectively. The accumulation of mutations in these VOCs, and others, demonstrate the quantifiable risk of antigenic drift and subsequent reduction in vaccine efficacy. Accordingly, booster vaccines based on updated variants are likely to be required over time to prevent productive infection. This study also suggests that two dose regimes of vaccine are required for maximal BNT162b2 and ChAdOx1-induced immunity.

Seroprevalence and characterisation of herpes simplex virus from human immunodeficiency virus in samples collected from two provinces in South Africa: a retrospective study.

Background:Herpes simplex virus (HSV) is a widely distributed human pathogen that is known for its ulcerative lesions at the infection site. HSV can cause persistent infection in the host that is often followed by a period of latency within the neurons. Considering the high rate of HIV infection in South Africa, it is important to assess the seroprevalence of HSV with a focus to determine the epidemiological association between HSV-DNA and HIV-1 in the population. Methods:A total of 44 sera samples were screened for HSV and HIV-1 using the highly sensitive enzyme-linked immunosorbent assay (ELISA). The ELISA positive samples were characterized using polymerase chain reaction (PCR) to confirm the positivity of both viruses and to further differentiate HSV into HSV-1 and -2. Thereafter, the samples were analysed for relatedness using phylogenetic analysis. Results:Of the 44 samples, 36 (81.8%) were positive for HIV-1, while 35 (79.5%) were positive for HSV when screened with ELISA kits. The PCR results, with the use of type specific primers, showed that 4/35 (11.4%) samples were specific for HSV-1 while 30/35 (85.7%) were specific for HSV-2. Statistical analysis performed using the chi-squared goodness-of-fit test showed that there is a significant relationship between HSV-2 and HIV-1 transmission. Conclusions:There is a significant positive association between HSV-2 and HIV-1 in the study population. Our study shows that some of the HSV-2 isolates are not related to the clinical isolate SD90e from South Africa, suggesting diversity in HSV-2 viral transmission.

Exploring Primary Care Clinicians' Views about How Best to Implement a Potential Trial around Point-of-Care Tests for Common Infections in South Africa.

Optimisation of antibiotic prescribing is critical to combat antimicrobial resistance. Point-of-care tests (POCTs) for common infections could be a valuable tool to achieve this in primary care. Currently, their use has primarily been studied in high-income countries. Trials in low-and-middle-income countries face challenges unique to their setting. This study aims to explore the barriers and facilitators for a future trial of POCTs for common infections in South Africa. Twenty-three primary care clinicians in the Western Cape Metropole were interviewed. Interview transcripts were analysed using thematic analysis. We identified three key themes. These themes focused on clinicians’ views about proposed trial design and novel POCTs, clinicians’ perspectives about trial set-up, and specific trial procedures. Participants were overall positive about the proposed trial and POCTs. Potential issues centred around the limited space and technology available and participant retention to follow-up. Additionally, impact on clinic workload was an important consideration. These insights will be invaluable in informing the design of a feasibility trial of POCTs in this setting.

Seroprevalence and characterisation of herpes simplex virus from human immunodeficiency virus in samples collected from two provinces in South Africa: a retrospective study

Background: Herpes simplex virus (HSV) is a widely distributed human pathogen that is known for its ulcerative lesions at the infection site. HSV can cause persistent infection in the host that is often followed by a period of latency within the neurons. Considering the high rate of HIV infection in South Africa, it is important to assess the seroprevalence of HSV with a focus to determine the epidemiological association between HSV-DNA and HIV-1 in the population. Methods: A total of 44 sera samples were screened for HSV and HIV-1 using the highly sensitive enzyme-linked immunosorbent assay (ELISA). The ELISA positive samples were characterized using polymerase chain reaction (PCR) to confirm the positivity of both viruses and to further differentiate HSV into HSV-1 and -2. Thereafter, the samples were analysed for relatedness using phylogenetic analysis. Results: Of the 44 samples, 36 (81.8%) were positive for HIV-1, while 35 (79.5%) were positive for HSV when screened with ELISA kits. The PCR results, with the use of type specific primers, showed that 4/35 (11.4%) samples were specific for HSV-1 while 30/35 (85.7%) were specific for HSV-2. Statistical analysis performed using the chi-squared goodness-of-fit test showed that there is a significant relationship between HSV-2 and HIV-1 transmission. Conclusions:There is a significant relationship between HSV-2 and HIV-1 in the study population. Our study shows that some of the HSV-2 isolates are not related to the clinical isolate SD90e from South Africa, suggesting diversity in HSV-2 viral transmission.

Quantifying Vulnerabilities of Single Women and Sexually Transmitted Infections in South Africa (2002-2016): Is It Getting Better (or Worse)?

Curable sexually transmitted infections (STIs) affect millions of people across the world. Besides unacceptably high HIV rates, South Africa also has the highest burden of STIs in the world. The aim of the study was to investigate temporal changes in STI incidence rates using the data from ~ 10,000 women who enrolled in several HIV prevention trials, KwaZulu-Natal, South Africa (2002-2016). We particularly focused on the changes in distribution of the most influential factors and their population-level impacts on STI incidence rates over time. Characteristics of the women were compared across the study periods: 2002-2004, 2005-2008, 2009-2011, and 2012-2016. Besides multivariable Cox regression models, population attributable risks were calculated for the significant factors. Despite the significant progress in prevention, testing, and treatment programs, infection rates increased substantially from 13.6 to 20.0 per 100 person-year over the study period. Our findings provided a compelling evidence for single/non-cohabiting South African women to be the most vulnerable population who consistently and substantially contributed to increasing STI rates during the 15years of study duration (PAR%: 44%-47%). We also highlighted the impact of women's lack of knowledge related to their partner, using injectable contraceptives, less parity, and baseline STI positivity which were increased substantially over time. Our findings suggest that a significant proportion of STIs could be prevented by targeting single/non-cohabiting. These results may provide guidance in developing more effective STI prevention programs by targeting women at highest risk of infections and delivering more realistic messages.

Impact of Disclosure over Time on the Emotional Well-Being of Children with Perinatally Acquired HIV Infection in South Africa.

The aim of this study was to describe the disclosure process in children with perinatally acquired HIV infection (PHIV+) and its impact on their emotional well-being and adherence to antiretroviral therapy (ART) in South Africa. This prospective cohort study followed PHIV+ children aged 7 to 13 years attending counseling over 18 months. Standardized disclosure tools were used by a counselor with both child and caregiver present. Assessments included the Child Behavior Checklist (CBCL), Vineland Adaptive Behavior Scale (VABS), Child Depression Inventory (CDI), and Revised Children's Manifest Anxiety Scale (RCMAS). Adherence to ART was recorded through pharmacy pill returns. Changes over time and their differences from baseline were assessed by linear mixed models. Thirty children with median age 10 years (interquartile range [IQR]: 9.0-11.0) were enrolled. The median time to disclosure was 48 weeks (IQR: 48.0-54.6). There was a significant decrease from baseline (p < 0.0001) and over time (p = 0.0037) in the total CDI score. A positive trend in the changes from baseline and over time was observed for internalizing (p values < 0.0001) and externalizing (p values < 0.0001) CBCL scales and Total Anxiety score of the RCMAS (p < 0.0001 and p < 0.0002, respectively). Only the Defensiveness median T-score increased during the follow-up (p = 0.004) and in the change from baseline (p = 0.0005). The adaptive (p = 0.0092) and maladaptive (p < 0.0001) scores of the VABS showed a decrease from baseline. ART adherence remained high throughout this study. Disclosure does not worsen the child's emotional well-being and adherence to ART over time. This study adds to research from low- and middle-income countries to alleviate fears that disclosure may have an adverse outcome on children with PHIV+.

Seroprevalence and characterisation of herpes simplex virus from human immunodeficiency virus in samples collected from two provinces in South Africa: a retrospective study

Background: Herpes simplex virus (HSV) is a widely distributed human pathogen that is known for its ulcerative lesions at the infection site. HSV can cause persistent infection in the host that is often followed by a period of latency within the neurons. Considering the high rate of HIV infection in South Africa, it is important to assess the seroprevalence of HSV with a focus to determine the epidemiological association between HSV-DNA and HIV-1 in the population. Methods: A total of 44 sera samples were screened for HSV and HIV-1 using the highly sensitive enzyme-linked immunosorbent assay (ELISA). The ELISA positive samples were characterized using polymerase chain reaction (PCR) to confirm the positivity of both viruses and to further differentiate HSV into HSV-1 and -2. Thereafter, the samples were analysed for relatedness using phylogenetic analysis. Results: Of the 44 samples, 36 (81.8%) were positive for HIV-1, while 35 (79.5%) were positive for HSV when screened with ELISA kits. The PCR results, with the use of type specific primers, showed that 4/35 (11.4%) samples were specific for HSV-1 while 30/35 (85.7%) were specific for HSV-2. Statistical analysis performed using the chi-squared goodness-of-fit test showed that there is a significant relationship between HSV-2 and HIV-1 transmission. Conclusions: The prevalence of HSV in the population is high with an increased HSV-2 infection in women. Our study shows that some of the HSV-2 isolates are not related to the clinical isolate SD90e from South Africa, suggesting diversity in HSV-2 viral transmission.

Maternal characteristics and pregnancy outcomes of hospitalized pregnant women with SARS-CoV-2 infection in South Africa: An International Network of Obstetric Survey Systems-based cohort study.

ObjectiveTo describe risk factors and outcomes of pregnant women infected with SARS‐CoV‐2 admitted to South African healthcare facilities.MethodsA population‐based cohort study was conducted utilizing an amended International Obstetric Surveillance System protocol. Data on pregnant women with SARS‐CoV‐2 infection, hospitalized between April 14, 2020, and November 24, 2020, were analyzed.ResultsA total of 36 hospitals submitted data on 673 infected hospitalized pregnant women; 217 (32.2%) were admitted for COVID‐19 illness and 456 for other indications. There were 39 deaths with a case fatality rate of 6.3%: 32 (14.7%) deaths occurred in women admitted for COVID‐19 illness compared to 7 (1.8%) in women admitted for other indications. Of the women, 106 (15.9%) required critical care. Maternal tuberculosis, but not HIV co‐infection or other co‐morbidities, was associated with admission for COVID‐19 illness. Rates of cesarean delivery did not differ significantly between women admitted for COVID‐19 and those admitted for other indications. There were 179 (35.4%) preterm births, 25 (4.7%) stillbirths, 12 (2.3%) neonatal deaths, and 162 (30.8%) neonatal admissions. Neonatal outcomes did not differ significantly from those of infected women admitted for other indications.ConclusionThe maternal mortality rate was high among women admitted with SARS‐CoV‐2 infection and higher in women admitted primarily for COVID‐19 illness with tuberculosis being the only co‐morbidity associated with admission.

In silico analysis of mutations associated with occult hepatitis B virus (HBV) infection in South Africa.

Occult hepatitis B virus (OBI) infection is defined by the presence of viral DNA in the liver and/or serum in absence of hepatitis B surface antigen (HBsAg). While multiple studies have identified mutations that are associated with OBI, only a small portion of these mutations have been functionally characterized in vitro. Using complementary in silico approaches, the effects of OBI-associated amino acid mutations on HBV protein function in HBV/HIV-positive ART-naïve South Africans were evaluated. Two OBI-associated mutations in the PreS1 region, one in the PreS2 region, and seven in the surface region of subgenotype A1 sequences were identified as deleterious. In subgenotype A2 sequences, 11 OBI-associated mutations in the PreS1 region, seven in the PreS2 region, and 31 in the surface region were identified as deleterious. In the polymerase region, 14 OBI-associated mutations in subgenotype A1 and 71 OBI-associated mutations in subgenotype A2 were identified as deleterious. This study utilized in silico approaches to characterize the likely impact of OBI-associated mutations on viral function, thereby identifying and prioritizing candidates and reducing the significant cost associated with functional studies that are essential for mechanistic studies of the OBI phenotype.

First report of orchid fleck virus associated with citrus leprosis symptoms in rough lemon (Citrus jambhiri) and mandarin (C. reticulata) the United States.

Citrus leprosis is an economically important disease of citrus in South and Central America. The disease can be caused by several non-systemic viruses belonging to the genera Cilevirus (family Kitaviridae) and Dichorhavirus (family Rhabdoviridae) (Roy et al. 2015; Freitas-Astúa et al. 2018). In February 2020, lesions consistent with citrus leprosis were observed on the leaves and stems of rough lemon (Citrus jambhiri) and mandarin (C. reticulata) trees in Hilo, Hawaii. Brevipalpus mites, vector of orchid fleck virus (OFV), were also present on these trees (Freitas-Astúa et al. 2018). To identify the virus associated with the symptoms, total RNA was isolated using a NucleoSpin RNA Plus kit (Macherey-Nagel) and underwent reverse transcription (RT)-PCR with two newly designed universal primers specific for dichorhaviruses (Dichora-R1-F1: 5`-CAYCACTGYGCBRTNGCWGATGA, Dichora-R1-R1: 5`-AGKATRTSWGCCATCCKGGCTATBAG). The expected ~350 bp amplicon was obtained and directly sequenced in both directions. Blastn and Blastx searches revealed that the primer-trimmed consensus sequence (MT232917) shared 99.3% nucleotide (nt) and 100% amino acid (aa) identity with an OFV isolate from Germany (AF321775). OFV has two orchid- (OFV-Orc1 and OFV-Orc2) and two citrus- (OFV-Cit1 and OFV-Cit2) infecting strains (Roy et al. 2020). However, an isolate of OFV-Orc1 has recently been associated with citrus leprosis in South Africa (Cook et al. 2019). To confirm the presence of OFV in Hawaiian citrus and identify the strain, symptomatic tissue was submitted to USDA-APHIS-PPQ-S&T where total RNA were extracted from the symptomatic tissue using RNeasy Plant Mini kit (Qiagen). The RNA samples were tested with OFV-Orc and OFV-Cit generic and specific primers in a conventional RT-PCR assay following optimized RT-PCR protocols (Roy et al. 2020). Two additional sets of generic primers (OFV-Orc-GPF: 5'-AGCGATAACGACCTTGATATGACACC, OFV-Orc-GPR: 5'-TGAGTGGTAGTCAATG CTCCATCAT and OFV-R2-GF1: 5'- CARTGTCAGGAGGATGCATGGAA, OFV-R2-GR: 5'- GACCTGCTTGATGTAATTGCTTCCTTC') were designed based on available OFV phospho (P) and large (L) polyprotein gene sequences in GenBank. These assays detected OFV-Orc2 in the symptomatic citrus samples, with the nucleocapsid (1353 bp), P (626 bp), and L (831 bp) gene sequences sharing 97 to 98% identity with published OFV-Orc2 sequences (AB244417 and AB516441). Ribo-depleted RNA (Ribo-Zero, Illumina) was prepared using a TruSeq Stranded Total RNA Library Prep kit (Illumina) and underwent high throughput sequencing (HTS) on a MiSeq platform (Illumina). The resulting 19.6 million 2x75bp reads were de novo assembled using SPAdes v. 3.10.0 (Bankevitch et al. 2012). In addition to sequences corresponding to citrus tristeza virus and citrus vein enation virus, two contigs of 6,412 nt (average depth 18,821; MW021482) and 5,986 nt (average depth 19,278; MW021483), were found to have ≥98% identity to RNA1 (AB244417) and RNA2 (AB244418) of OFV isolate So (Japan), respectively. This is the first report of OFV in Hawaii and the first time leprosis has been observed in the USA since it was eradicated from Florida in the 1960s, although that outbreak was attributed to infection by citrus leprosis virus-N0, a distant relative of OFV (Hartung et al. 2015). The recent detection of citrus leprosis associated with OFV infection in South Africa (Cook et al. 2019) and now Hawaii underscores the threat this pathogen poses to the global citrus industry.

Psychosocial Aspects During the First Wave of COVID-19 Infection in South Africa.

Background: In South Africa, as in many countries, the nationwide spread of COVID-19 caused a public health emergency that resulted in the government implementing necessary restrictive measures such as the nationwide lockdown as a way of containing the pandemic. Such restrictive measure, while necessary, can disrupt many aspects of people's lives resulting in unprecedented psychosocial distress.Aim: The present study aims to describe the psychosocial health and situational factors associated with the novel coronavirus (COVID-19) in South Africa during the first wave of infection.Methods: This cross-sectional survey, recruited a total of 203 participants through convenience sampling via online platforms—WhatsApp, Facebook, emails, etc.—during COVID-19 lockdown in the country. Through the snowball technique, participants from across South Africa completed the online survey that assessed socio-demographic information, risk perception, history of mental health, COVID-19-related stress, and fears during the lockdown (first wave).Results: The majority of the participants who completed the survey were young, Black African, and female. Participants reported feelings of stress and anxiety (61.2%); stress about finances (39.5%); and feelings of sadness, anger, and/or frustration (31.6%) during the lockdown. Females compared to males were more likely to perceive COVID-19 as a risk to their household, = 45,844, p < 0.001 and community, = 40,047, p = 0.005. COVID-19 differentially impacted the mental health of participants with and without mental health diagnosis, = 16.596, p = 0.002. Participants with a prior mental health diagnosis reported significant extra stress during lockdown (p < 0.05).Conclusion: The findings may be of significance to assist in the development of targeted psychosocial interventions to help people during and after the pandemic.

Prevalence, Serovars, and Factors Associated with Salmonella Contamination of Chicken Carcasses Sold in Outlets of the Informal Market in Gauteng Province, South Africa

Salmonella has been linked to many foodborne illnesses and epidemics in both humans and animals. This cross-sectional study determined the prevalence, serovars, and factors associated with Salmonella contamination of chickens slaughtered in informal market outlets in Gauteng Province, South Africa. A total of 151 chicken carcasses were randomly collected from 47 outlets. Standard bacteriological and molecular methods were used to isolate, identify, and determine the serovar of Salmonella isolates. The prevalence of Salmonella in carcass swabs, cloacal swabs, and carcass drips was 29.1% (44 of 151), 27.2% (41 of 151), and 43.7% (66 of 151), respectively, and the differences were statistically significant (P = 0.004). Only 5 (township locations of outlet, throughput, carcass evisceration, location of carcass for sale, and outlet sanitation) of 10 factors investigated for the contamination of carcasses by Salmonella were statistically significantly (P < 0.05) associated with the isolation of Salmonella. Of the 268 isolates of Salmonella, 157 (58.6%) were typeable using a limited molecular PCR technique, and nine serovars were identified. The predominant Salmonella enterica serovars were Bovismorbificans (31.0%), Enteritidis (7.5%), and Hadar (6.7%). The five important factors found to be significantly associated with the isolation of Salmonella at these outlets offer opportunities for the reduction of Salmonella contamination. There is a need for further investigation of the probable causes of the predominant isolation of Salmonella serovar Bovismorbificans in chickens and its potential implications for human infections in South Africa. It is concluded that chickens purchased from the informal market in Gauteng Province can be a source for salmonellosis in humans if improperly cooked before consumption.

Factors associated to subjective well-being and TB infection in South Africa

Eighty-five percent of the world's new Tuberculosis cases are found in thirty high burdened countries, one of which is South Africa. South Africa is one of the eight countries that are said to account for the two thirds of the total new Tuberculosis cases. The Tuberculosis epidemic is driven by the following reasons: firstly, poor living conditions which are a result of the wide gap between the rich and the poverty stricken among some populations; and, secondly, late presentation to health facilities. Over the years, healthcare programs have made a meaningful impact in identifying patients presenting to Tuberculosis care. A global Tuberculosis report shows an estimated sixty million lives were saved through Tuberculosis treatment and diagnosis between the years 2000 and 2019. This progress has encouraged the United Nations to set the health target of eradicating the Tuberculosis epidemic by 2030. For this goal to be attained, strategies to modify risk behaviour need to remain a main priority. In the South African context, it would be important to note the diversity of the individuals experience which is rooted in South African socio-political history and has resulted in high levels of social inequality and disparate socio-economic status groups, as a significant factor when considering the well-being of Tuberculosis infected South Africans. The aim of this research was to understand health related well-being in South Africa, by noting and comparing the diversity of life satisfaction experience between participants from different sociodemographic status groups across South Africa. In this interview statistician Motladi Matatiele and Demographer Nancy Stiegler from the University of Western Cape discuss the possible factors of subjective well-being in the Tuberculosis infected South African population and provide an understanding of the behavioural aspects tied to Tuberculosis infection.

Escape of SARS-CoV-2 501Y.V2 from neutralization by convalescent plasma.

SARS-CoV-2 variants of concern (VOC) have arisen independently at multiple locations1,2 and may reduce the efficacy of current vaccines that target the spike glycoprotein of SARS-CoV-23. Here, using a live-virus neutralization assay, we compared the neutralization of a non-VOC variant with the 501Y.V2 VOC (also knownas B.1.351) using plasma collected from adults who were hospitalized with COVID-19 during the two waves of infection in South Africa, the second wave of which was dominated by infections with the 501Y.V2 variant. Sequencing demonstrated that infections of plasma donors from the first wave were with viruses that did not contain the mutations associated with 501Y.V2, except for one infection that contained theE484K substitution in the receptor-binding domain. The 501Y.V2 virus variant was effectively neutralized by plasma from individuals who were infected during the second wave.The first-wave virus variant was effectively neutralized by plasma from first-wave infections. However, the 501Y.V2 variant was poorly cross-neutralized by plasma from individuals with first-wave infections; the efficacy was reduced by 15.1-fold relative to neutralization of 501Y.V2 by plasma from individuals infected in the second wave. By contrast, cross-neutralization of first-wave virus variants using plasma from individuals with second-wave infections was more effective, showing only a 2.3-fold decrease relative to neutralization of first-wave virus variants by plasma from individuals infected in the first wave. Although we tested only one plasma sample from an individual infected with a SARS-CoV-2 variant with only the E484K substitution, this plasma sample potently neutralized both variants. The observed effective neutralization of first-wave virus by plasma from individuals infected with 501Y.V2 provides preliminary evidence that vaccines based on VOC sequences could retain activity against other circulating SARS-CoV-2 lineages.