Infected Males Research Articles

Toxoplasma Gondii In Association with TLR4 Among Regular Hemodialysis Patients

Background: Hemodialysis patients can be considered immunocompromised as they have an increased risk of infections. The activity of Toll -like receptors in defense against infections was observed particularly for Toll like receptor4 molecule. Several single-nucleotide polymorphisms (SNPs) residing in genes encoding Toll -like receptors were reported as significant genetic modifications associated with infections. Aim: To determine the association between Toll- like receptors 4 polymorphisms and the susceptibility to infection with Toxoplasma gondii in hemodialysis patients. Materials and Methods: This case- control study was conducted on 150 patients with hemodialysis and 150 apparently healthy blood donors as control group, the samples were collected in the period from march 2021 to November 2021 from Al-Karama hospital and Al-Yarmouk Teaching Hospital. All patients were investigated for the presence of Toxoplasma gondii and Abs (IgG, IgM) by using ELISA technique and conformation by molecular technique (Real time-PCR). The selected SNPs in Toll- like receptors 4 were amplified by using conventional polymerase chain reaction PCR and then sequencing there polymorphism. Results: In the current study the comparison of median age between patients and controls was with no significant difference, while the laboratory tests revealed significant difference in median level of urea, creatinin , calcium , potassium ,albumin and hemoglobin, and insignificant difference for body mass index and sodium between studied groups. The ratio of females infected with Toxoplasma gondii was higher than infected males. The seropositive result in patients for Toxoplasma gondii - IgG and IgM was 15 and 6 respectively while 19 patients were positive by PCR. However in control group there were 8 patients seropositive for IgG and positive in PCR results while the results of IgM and PCR were negative for all control group. The Polymerase chain reaction (PCR) products of Toll- like receptors 4 genes were subjected for direct sequencing by using Bio edit software. And the resultant sequences were compared with reference sequences in NCBI. The analysis of TLR-4 rs4986790 genotypes were 24(80%) AA and 6(20%) AG in patients while 6 (60%) AA and 4(40%) AG in controls with insignificant difference, while the analysis of TLR-4 rs4986791 genotypes were 24(80%) CC and 6 (20%) CT in patients while 6 (60%) CC and 4(40%) CT in controls with insignificant difference. Conclusion: There was no significant association of Toxoplasma gondii with TLR4 genotypes of rs4986790 and rs4986791 SNPs in hemodialysis patients.

Mating receptivity mediated by endosymbiont interactions in a haplodiploid thrips species.

Many arthropods carry maternally inherited endosymbionts that cause cytoplasmic incompatibility (CI), manifested as embryonic mortality in matings of infected males with uninfected females. Infected females, however, do not suffer this cost. Therefore, in populations with mixed endosymbiont infections, selection is expected to favour mechanisms that enable hosts to avoid or mitigate CI. This may include changes in mating behaviour, such as reduced female receptivity to mating and/or remating when approached by incompatible males. Here, we investigated mating behavioural traits in haplodiploid thrips naturally associated with two CI-inducing endosymbionts, Cardinium and Wolbachia. Compared with females with both endosymbionts, those with only Cardinium showed reduced receptivity to males carrying both. However, surprisingly, females without endosymbionts were not less receptive to incompatible males. Furthermore, in contrast to females without endosymbionts, females with Cardinium were far less likely to remate with incompatible than compatible males irrespective of the compatibility type of the first mating. Our results suggest that endosymbiont-specific sexual selection processes occur, whereby females carrying only Cardinium recognize Wolbachia in coinfected males to avoid CI. This may hinder a CI-driven Wolbachia spread. Endosymbiont-mediated mating behaviours may be crucial for the dynamics of CI-inducing endosymbionts and their application in pest management strategies.

Warm temperature inhibits cytoplasmic incompatibility induced by endosymbiotic Rickettsiella in spider hosts.

Bacterial endosymbionts manipulate reproduction in arthropods to increase their prevalence in the host population. One such manipulation is cytoplasmic incompatibility (CI), wherein the bacteria sabotage sperm in infected males to reduce the hatch rate when mated with uninfected females, but zygotes are 'rescued' when that male mates with an infected female. In the spider Mermessus fradeorum (Linyphiidae), Rickettsiella symbionts cause variable levels of CI. We hypothesised that temperature affects the strength of CI and its rescue in M. fradeorum, potentially mediated by bacterial titre. We reared Rickettsiella-infected spiders in two temperature conditions (26°C vs. 20°C) and tested CI induction in males and rescue in females. In incompatible crosses between infected males and uninfected females, the hatch rate from warm males was doubled (mean ± standard error = 0.687 ± 0.052) relative to cool males (0.348 ± 0.046), indicating that CI induction is weaker in warm males. In rescue crosses between infected females and infected males, female rearing temperature had a marginal effect on CI rescue, but the hatch rate remained high for both warm (0.960 ± 0.023) and cool females (0.994 ± 0.004). Bacterial titre, as measured by quantitative polymerase chain reaction, was lower in warm than cool spiders, particularly in females, suggesting that bacterial titre may play a role in causing the temperature-mediated changes in CI.

Reproductive consequences of the interaction Trypanosoma cruzi − Triatoma infestans and its trade-off with survival

Relative little is known about fitness effects and life history trade-off of Trypanosoma cruzi in Triatoma infestans, the main vector of Chagas disease in Argentina. Previous studies revealed some costs related to development, excretion, and toxicology or their possible trade-offs, but none address effects on reproduction. To study the effect of T. cruzi infection on reproductive efficiency and survival of T. infestans we set up four treatments: both genders uninfected, both genders infected, female infected – males uninfected and female uninfected − males infected. The infection was induced during the third, fourth, and fifth nymphal instars. Reproductive efficiency and longevity variables were recorded. Our results showed that the infection by T. cruzi increased reproductive efficiency and reduced survival of T. infestans. Pairs where one or both individuals were infected presented a greater percentage copulation, of egg-laying females, the onset of copulation and oviposition occurred earlier, and age-specific fecundity was notably higher. Regarding fertility, infected females displayed higher rates irrespective of the infective status of the male counterpart. A reduction in longevity was observed in infected males and females. These findings highlighted that the infection significantly alters the trade-off reproductive efficiency-survival of T. infestans, with the impact differing according to the infection status of each gender, suggesting a complex interplay rather than a simple additive effect. This response corresponds to the reproductive compensation hypothesis.

Effects of blood extraction and ecophysiological experiments on stress in adult males of Liolaemus attenboroughi.

Stress during laboratory experiments can affect the outcomes of ecophysiological studies. The serum corticosterone concentration (CORT), the leukocyte profile, heterophil/lymphocyte ratio (H/L), and the presence of blood endoparasites were analyzed as a proxy of stress and immunological state in adult males of the lizard Liolaemus attenboroughi, endemic to Patagonia, Argentina. The results of the ecophysiological variables (preferred temperature, running speed, locomotor endurance, and body condition index, BCI) were analyzed in relation to stress indicators obtained from blood samples taken at three different times: at capture, and on the third and seventh days in the laboratory. Males at capture showed a high percentage of lymphocytes and heterophils and a low of basophils, monocytes, and eosinophils. Haemogregorina-type endoparasites have been recorded in the genus Liolaemus for the first time. The proportion of infected males remained stable during captivity; however, these males showed higher CORT levels, increased percentages of basophils, and decreased percentages of lymphocytes. There was a significant increment in CORT and H/L, and a decrease in BCI during laboratory experiments, compared with baseline values at capture. The performance was not related to the CORT or the repeated blood sampling. The BCI decreased, possibly due to energy reserve mobilization caused by acute stress. This study shows that blood extraction and ecophysiological experiments over 7 days have a minor effect on the stress indicators used.

First report of Root-Knot Nematode Meloidogyne hapla infecting Siegesbeckia orientalis L. in Shaanxi, China.

Siegesbeckia orientalis L., belonging to the family of Asteraceae and also known as 'Xi-Xian Cao' or Herba Siegesbeckiae, has been an important traditional Chinese medicine since the Tang Dynasty (Wang et al., 2021). As the dried aerial parts have medicinal values, S. orientalis is widely grown in China, Japan, Korea, and Vietnam. One almost 600 m2 block of S. orientalis plants with stunting and leaf withering symptoms was found in Luonan County (110.26 E, 34.06 N), Shaanxi Province, in August 2022. Many galls were observed on the roots of these plants, and densities of second-stage juveniles (J2s) were 260~370 per 100 cm3 of soil. Females and eggs were dissected from infected roots, and J2s and males were extracted from the soil for species identification. The perineal patterns of females (n=20) were oval-shaped, with minor dorsal arches, distinct lateral fields, and tiny punctations around anus. The head caps of males were high and obviously narrower than head region which broadened out of the first body annuli. Morphological measurements of females (n=20) were: body length (L) = 897.66 ± 50.89 (860.96-949.74) μm, body width (BW) = 577.69 ± 51.01 (489.91-638.65) μm, stylet length (ST) = 14.03 ± 0.63 (13.25-14.97) μm, dorsal pharyngeal gland orifice to stylet base (DGO) = 4.96 ± 0.47 (4.08-5.37) μm, vulval slit length = 18.82 ± 1.97 (17.24-22.02) μm, vulval slit to anus distance = 13.62 ± 1.22 (12.34-16.18) μm. Measurements of males (n=10) were: L = 1298.73 ± 95.96 (1202.77-1394.69) μm, BW = 28.24 ± 2.38 (25.93-30.55) μm, ST = 20.23 ± 0.78 (19.42-21.04) μm, DGO = 4.89 ± 0.44 (4.56-5.22) μm, spicule length = 28.98 ± 1.68 (26.94-31.02) μm. Measurements of J2s: L = 375.35 ± 14.02 (341.01-400.46) μm, BW = 15.09 ± 1.47 (12.02-16.82) μm, ST = 12.74 ± 0.61(11.46-13.84) μm, DGO = 2.58 ± 0.59 (1.61-3.7) μm, tail length= 74.15 ± 13.73 (50.92-95.09) μm, hyaline tail terminus= 11.36 ± 2.27 (9.53-17.85) μm. These morphological characteristics were consistent with those of Meloidogyne hapla Chitwood, 1949 as described by Whitehead (1968). The DNA of single females (n=10) was isolated using the Proteinase K method for molecular identification (Kumari and Subbotin, 2012). The sequence of rDNA-ITS region was amplified and sequenced with the primers rDNA-F/R (TTGATTACGTCCCTGCCCTTT/TTTCACTCGCCGTTACTAAGG) (Vrain et al., 1992). The 768 bp sequence (GenBank OP542552) was 99.74% identical to the rDNA-ITS sequences of M. hapla (JX024147 and OQ269692). Then the D2/D3 fragments of the 28S rRNA were amplified and sequenced with the primers D2A/D3B (ACAAGTACCGTGAGGGAAAGTTG/TCGGAAGGAACCAGCTACTA) (McClure et al., 2012). The 762 bp fragment (OP554218) showed 100% identical to sequences of M. hapla (MN752204 and OM744204). To confirm the pathogenicity of the population, six 2-week-old healthy S. orientalis seedlings cultured in sterilized sand were each inoculated with 2,000 J2s hatched from egg masses. Four non-inoculated seedlings served as negative controls. After maintenance at 25°C for 60 days, galls appeared on the roots of inoculated plants, being consistent with the symptoms observed in field, while the negative controls showed no symptoms. Females collected from inoculated plants were identified as M. hapla with species-specific primer JWV1/ JWV (Adam et al., 2007), which amplified a fragment of 440 bp. Parasitism was also confirmed by the average recovery of 3,814 J2s per inoculated plant with the reproductive factor of 1.91. This is the first report of S. orientalis being a host of M. hapla. The disease reduces the quality and yield of S. orientalis, and much more efforts would be made for its control in production.

Rickettsia induces strong cytoplasmic incompatibility in a predatory insect.

Rickettsia, a group of intracellular bacteria found in eukaryotes, exhibits diverse lifestyles, with some acting as vertebrate pathogens transmitted by arthropod vectors and others serving as maternally transmitted arthropod endosymbionts, some of which manipulate host reproduction for their own benefit. Two phenotypes, namely male-killing and parthenogenesis induction are known as Rickettsia-induced host reproductive manipulations, but it remains unknown whether Rickettsia can induce other types of host manipulation. In this study, we discovered that Rickettsia induced strong cytoplasmic incompatibility (CI), in which uninfected females produce no offspring when mated with infected males, in the predatory insect Nesidiocoris tenuis (Hemiptera: Miridae). Molecular phylogenetic analysis revealed that the Rickettsia strain was related to Rickettsia bellii, a common insect endosymbiont. Notably, this strain carried plasmid-encoded homologues of the CI-inducing factors (namely cifA-like and cifB-like genes), typically found in Wolbachia, which are well-known CI-inducing endosymbionts. Protein domain prediction revealed that the cifB-like gene encodes PD-(D/E)XK nuclease and deubiquitinase domains, which are responsible for Wolbachia-induced CI, as well as ovarian tumour-like (OTU-like) cysteine protease and ankyrin repeat domains. These findings suggest that Rickettsia and Wolbachia endosymbionts share underlying mechanisms of CI and that CI-inducing ability was acquired by microbes through horizontal plasmid transfer.

Seroprevalence of hepatitis c virus in Blood Donors in Kabul in 2023

Introduction: Understanding the prevalence and distribution of the hepatitis C virus (HCV) is crucial for the development of effective prevention and control strategies, given its significant impact on global public health. The objective of this study was to examine the seroprevalence of HCV among blood donors in Kabul and assess the possible gender-based variations in infection rates. Materials and Methods: This study analyzed blood donor records from the central blood bank in Kabul, including both male and female donors, from January to December 2023. HCV screening was performed using ELISA testing, and the data were analyzed using SPSS to determine HCV prevalence and investigate gender-based differences in infection rates. Results: In this study, 59 out of 15,080 individuals (0.39%) tested positive for HCV infection. Among the HCV-positive cases, 81.5% were male and 18.6% were female. The majority of infected males (64.4%) were in the 30-39 age range. A significant proportion of HCV-positive patients had no formal education (69.5%) and were unemployed (61.0%). Additionally, the majority of HCV-positive patients reported a low monthly income (66.1%). Discussion: The study found a low prevalence of HCV infection (0.39%) among the participants, with the highest rates observed in the 30-39 age group. Socioeconomic factors, such as lack of education, unemployment, and low income, were associated with HCV infection. Targeted interventions are needed to address gender disparities, age-specific risks, and socioeconomic determinants to improve prevention and control strategies for HCV in Kabul's blood donor population and enhance overall population health.

Wolbachia affect female mate preference and offspring fitness in a parasitoid wasp.

Wolbachia are widespread intracellular bacteria in insects that often have high rates of spread due to their impact on insect reproduction. These bacteria may also affect the mating behavior of their host with impacts on the fitness of host progeny. In this study, we investigated the impact of Wolbachia on a preference for mating with young or old males in the parasitoid wasp Habrobracon hebetor. Our results showed that uninfected females from a tetracycline-treated line preferred to mate with young males, whereas Wolbachia-infected females had no preference. Time to mating was relatively shorter in the infected lines. Regardless of Wolbachia infection status, progeny resulting from matings with young males showed higher fitness than those from crosses with old males, and infected females crossed with infected young males showed the highest performance. These results suggest an impact of Wolbachia on female mate preference and offspring fitness although it is unclear how this phenomenon increases Wolbachia transmission of infected wasps. © 2024 Society of Chemical Industry.

Infestation of the spider crab Menaethius monoceros (Epialtidae: Brachyura) from the Egyptian Red Sea coasts by Parasacculina pilosella (Polyascidae: Rhizocephala: Cirripedia

The results of this study showed that out of 287 individuals (135 males and 152 females) of the spider crab Menaethius monoceros collected from the Red Sea and the Gulfs of Suez and Aqaba, 15 individuals (6 males and 9 females) were infected with Parasacculina pilosella (Van Kampen & Boschma, 1925) (Polyascidae: Rhizocephala: Cirripedia: Crustacea). A total of 20 externae were recorded, including 11 singles, three doubles, and only one triple on the infected crab abdomens. The overall infection rate was 5.23% for the combined sexes at all sites, declined to 4.44% in males, but increased to 5.92% in females, reaching a higher rate of 16.07% in the populations of Marsa Alam and Shalateen sectors during summer. The examined externae have variable colors, sizes, and shapes based on their sexual maturity, which has been classified into four stages: immature or virgin, early mature, maturing, and late (spent externae). The largest number of externae was eight extruded on the 3rd abdominal segment, while it decreased to six, two, and one on the 4th, 2nd and 5th segments, respectively. The size of externae varied from 1.3 × 1.0 × 1.0 to 6.3 × 4.5 × 2.5 mm (Breadth × Height × Thickness). These results showed changes in the external secondary sexual characters of the infected males, represented by the remarkable broadness of the abdomen fringed with marginal setae and invagination of the sternum, but were limited in infected females.

Testing the immune markers MIP, IL-23 and find a relationship between them in the serum of male patients with toxoplasmosis

The aim of the current study is to find the levels of MIP and IL-23 in the serum of a group of male patients infected with Toxoplasma gondii who were diagnosed with the disease by rapid IGg screening and to find the levels of IGg protein in the blood serum of a group of male patients infected with the disease. The aforementioned immune indicators in the serum of healthy people as a control group. Blood samples were taken from donors who came to the main blood bank in Najaf Al-Ashraf, and the relationship between these immune indicators was studied using ELISA technology. The total number of males was (78), (48) of whom were sick males and (30) healthy males who were not infected with the disease. The study showed that the percentage of infected males was 61% and those who were not infected were (4.38%). Age was studied and it was found that there was no significant difference in the age of patients and healthy people, and that the age range of patients was between (16 – 56) years. Serum tests were conducted for MIP, there was a slight increase, and a highly significant increase for IL-23. The current study demonstrated the existence of positive relationships between MIP-1 and IL-23.

Trypanosoma vivax in and outside cattle blood: Parasitological, molecular, and serological detection, reservoir tissues, histopathological lesions, and vertical transmission evaluation

This study reports assessment of the sensitivity of diagnostic techniques to detect T. vivax in experimentally infected cattle. Additionally, it describes T. vivax extravascular parasitism during the acute and chronic phases of trypanosomosis and congenital transmission. The T. vivax diagnosis was compared using blood samples collected from the jugular, coccygeal and ear tip veins. For this study, 13 males and two females were infected with ≈ 1 × 106 viable T. vivax trypomastigotes (D0). One animal was kept as a negative control during the entire study. The 13 infected males were euthanized between 14 and 749 days post-infection (DPI). After confirming the cyclicity of both females (9 months of age), they were naturally mated with a bull. One female was euthanized at 840 DPI, and the other at 924 DPI. The two calves, one from each female, were euthanized at six months of age (924 DPI), and the negative control at 924 DPI. During this period, T. vivax in blood was assessed using direct methods (Woo test, cPCR, microscopic examination of fresh wet blood films and parasite quantification - Brener method), and serological methods (IFAT, ELISA, and IA). Tissue samples were collected from the liver, spleen, brain, cerebellum, heart, testicles, epididymis, kidneys, eyeballs, pre-scapular lymph nodes, ear tips, mammary glands, uterus, and ovaries. The protozoan DNA was examined using LAMP. There was no difference in the detection of T. vivax using the Woo test and Brener method among the jugular, coccygeal, and ear tip veins. The sensitivity of the detection methods varied depending on the disease phase. Direct methods (Woo test, Brener method, and cPCR) demonstrated higher sensitivity during the acute phase, while serological methods (IFAT, ELISA, and IA) were more sensitive during the chronic phase. Anti-T. vivax antibodies were detected up to 924 DPI. Tissue evaluation using LAMP demonstrated the presence of T. vivax DNA and associated histopathological changes up to 840 or 924 DPI. Only in mammary glands and ovaries was no DNA detected. The most frequently observed histopathological alteration was lymphohistioplasmocytic inflammatory infiltrate. No transplacental transmission of T. vivax was observed.

Serum gonadal hormones levels and hypogonadism in ART naïve newly diagnosed HIV infected adult males in Mwanza, Tanzania

BackgroundHuman immunodeficiency virus/acquired immunodeficiency syndrome (HIV/AIDS) is an endemic chronic disease which is characterized with progressive depletion of CD4 T cells and increased susceptibility to opportunistic infections. Previous studies have associated HIV infection with increased hypogonadism. However, the prevalence of hypogonadism remained poorly defined and widely ranging in various studies. This study aims to evaluate the serum gonadal hormonal levels and hypogonadism in antiretroviral therapy (ART) naïve newly diagnosed HIV infected-males in Mwanza, Tanzania.MethodsThis was a comparison study involving 81 ART naïve newly diagnosed HIV-infected adult males as study group and 81 apparently healthy HIV-negative males as comparison group. The participants in the study group and comparison group were matched by body mass index and age. Serum hormones [Total testosterone (TT), follicle stimulating hormone (FSH), luteinizing hormone (LH) and estradiol (E) were estimated. Serum testosterone < 300 ng/dl, or testosterone > 300 ng/dl with high LH and FSH (compensatory hypogonadism) were taken as markers of hypogonadism. Data were analyzed using STATA version 15.ResultsThe median serum testosterone level among ART naïve newly diagnosed HIV-infected adult males was significantly lower as compared to their comparison group (447 [259–534] versus 517 [396–605]; p = 0.0074) and shown to decrease with decreasing CD4 level. The median [IQR] serum FSH level among ART naïve newly diagnosed HIV-infected adult males was significantly higher than among their comparison group (3.8 [2.1–6.5] versus 2.6 [1.8–4.2]; p = 0.0086). The differences in serum LH and Estradiol were not statistically significant. Furthermore, the proportion of hypogonadism was significantly higher among ART naïve newly diagnosed HIV-infected adult males than in their comparison group (37.0% [30/81] versus 14.8% [12/81]; p = 0.0006). Out of these 30, 24 HIV-infected males had secondary hypogonadism, one had primary, and the remaining five had compensatory hypogonadism.ConclusionSerum testosterone was lower and follicle stimulating hormone was higher among ART naïve HIV-infected males as compared to the HIV negative controls. Hypogonadism, mainly secondary, is common endocrine abnormality among ART naïve HIV-infected male patients in this study. HIV is associated with variations in gonadal hormones which may lead to sexual dysfunction in infected individuals.

Sex-structured disease transmission model and control mechanisms for visceral leishmaniasis (VL).

Leishmaniasis are a group of diseases caused by more than 20 species of the protozoan that are transmitted through the bite of female sand fly. The disease is endemic to 98 countries of the world. It affects most commonly the poorest of the poor and mainly males. Several research has been conducted to propose disease control strategies. Effective medical care, vector control, environmental hygiene, and personal protection are the mainstays of the current preventative and control methods. The mathematical models for the transmission dynamics of the disease studied so far did not consider the sex-biased burden of the disease into consideration. Unlike the previous VL works, this study introduces a new deterministic sex-structured model for understanding the transmission dynamics of visceral leishmaniasis. Basic properties of the model including basic reproduction number ([Formula: see text]), and conditions for the existence of backward bifurcation of the model are explored. Baseline parameter values were estimated after the model was fitted to Ethiopia's VL data. Sensitivity analysis of the model was performed to identify the parameters that significantly impact the disease threshold. Numerical simulations were performed using baseline parameter values, and scenario analysis is performed by changing some of these parameters as appropriate. The analysis of the model shows that there is a possibility for a backward bifurcation for [Formula: see text], which means bringing [Formula: see text] to less than unity may not be enough to eradicate the disease. Our numerical result shows that the implementation of disease-preventive strategies, as well as effectively treating the affected ones can significantly reduce the disease prevalence if applied for more proportion of the male population. Furthermore, the implementation of vector management strategies also can considerably reduce the total prevalence of the disease. However, it is demonstrated that putting more effort in treating affected reservoir animals may not have any significant effect on the overall prevalence of the disease as compared to other possible mechanisms. The numerical simulation infers that a maximum of 60% of extra preventative measures targeted to only male population considerably reduces the total prevalence of VL by 80%. It is also possible to decrease the total prevalence of VL by 69.51% when up to 50% additional infected males receive treatment with full efficacy. Moreover, applying a maximum of 15% additional effort to reduce the number of vectors, decreases the total VL prevalence by 57.71%. Therefore, in order to reduce the disease burden of visceral leishmaniasis, public health officials and concerned stakeholders need to give more emphasis to the proportion of male humans in their intervention strategies.

Effects of an entomopathogenic fungus on the reproductive potential of Drosophila males.

While mortality is often the primary focus of pathogen virulence, non-lethal consequences, particularly for male reproductive fitness, are less understood; however, they are essential for understanding how sexual selection contributes to promoting resistance. We investigated how the fungal pathogen Metarhizium brunneum affects mating ability, fertility, and seminal fluid protein (SFP) expression of male Drosophila melanogaster paired with highly receptive virgin females in non-competitive settings. Depending on sex and dose, there was a 3-6-day incubation period after infection, followed by an abrupt onset of mortality. Meanwhile, the immune response was strongly induced already 38 h after infection and continued to increase as infection progressed. Latency to mate somewhat increased during the incubation period compared to sham-treated males, but even on Day 5 post infection >90% of infected males mated within 2 h. During the incubation period, M. brunneum infection reduced male reproductive potential (the number of offspring sired without mate limitation) by 11%, with no clear increase over time. Approaching the end of the incubation period, infected males had lower ability to convert number of mating opportunities into number of offspring. After repeated mating, infected males had lower SFP expression than sham controls, more so in males that mated with few mates 24 h earlier. Overall, despite strong activation of the immune response, males' mating ability and fertility remained surprisingly little affected by the fungal infection, even shortly before the onset of mortality. This suggests that the selection for resistance acts mainly through mortality, and the scope for fertility selection to enhance resistance in non-competing settings is rather limited.

Sexual Dimorphism in the Physiopathology and Immune Response during Acute Toxocara canis Infection.

Toxocara canis (T. canis) is a helminth parasite of zoonotic and veterinary health significance that causes the disease known as Toxocariasis. This disease has been associated with conditions of poverty, especially in tropical climate zones throughout the world. Although it rarely causes important clinical manifestations, T. canis can lead to blindness, meningoencephalitis, or other nervous manifestations in humans. Moreover, some studies show its importance in the development of tumor growth, which have been associated with the parasite's ability to modulate the host's immune response. While different studies have evaluated the immune response during this disease, currently, there are no studies where the infection is analyzed from the perspective of sexual dimorphism. To evaluate sex differences in susceptibility, we analyzed lesions and parasite loads in lung and liver at 7 days post-infection. In addition, immune cell subpopulations were analyzed in spleen, mesenteric and peripheral lymph nodes. Finally, the production of cytokines and specific antibodies were determined in the serum. Statical analyses were performed using a Two-way ANOVA and a post-hoc Bonferroni multiple comparison test. Female rats had a higher number of larvae in the liver, while male rats had them in the lungs. The percentages of immune cells were evaluated, and in most cases, no significant differences were observed. Regarding the cytokines production, infection can generate a decrease in Th1 such as IL-1β in both sexes and IL-6 only in females. In the case of Th2, IL-4 increases only in infected males and IL-5 increases in males while decreasing in females due to the effect of infection. IL-10 also decreases in both sexes as a consequence of the infection, and TGF-β only in females. Finally, the infection generates the production of antibodies against the parasite, however, their quantity is lower in females. This study demonstrates that T. canis infection is dimorphic and affects females more than males. This is due to a polarization of the inadequate immune response, which is reflected as a higher parasite load in this sex.

Infection‐related sexual conflict in mating behaviors of wolf spiders

AbstractResistance to mating by females has been hypothesized as a tactic to assess potential mates and avoid undesirable ones. Previous studies show infection with the pathogenic bacteria, Pseudomonas aeruginosa, triggers a costly immune response and negatively impacts fitness in the wolf spider Schizocosa ocreata (Hentz 1844). Studies also show that infection can be transmitted during copulation, suggesting that there are potential fitness costs associated with mating with an infected individual. We examined impacts of infection on mating interactions of male and female S. ocreata. As studies show infection can be detected through chemical cues, we tested whether males or females avoid mating with infected individuals when given the opportunity. We paired infected and uninfected (control) males and females and recorded their behavior. We found that mating outcome was independent of infection for males and females. While higher male courtship rates and more frequent female receptivity displays were associated with successful mating, we saw no direct effect of infection status on mating outcome. However, among spider pairs that did not mate, females were found to be significantly more resistant and aggressive toward infected males than control males. Male aggression, on the other hand, was greater in pairs that did result in mating. These results suggest that sexual conflict in mating can be related to infection status, and that females can recognize infected males and alter their behavior in response.

Psychopathology of latent toxoplasmosis in infected individuals: roles of age, duration of infection, and sex

Background. The present study examined the relationship between latent toxoplasmosis and mental disorders. Methods. The sample included 117 toxoplasma-positive volunteers on Facebook, Twitter, and Instagram. Data were collected online using the 71-item abbreviated form of the Minnesota Multiphasic Personality Inventory (MMPI). Results. According to the results, a) the psychological profile of latent toxoplasmosis patients in the eight clinical scales of MMPI was within the normal range; b) in the male group, ‘duration of infection’ significantly predicted the scores for the four clinical scales of depression, psychopathic deviate, psychasthenia, and schizophrenia; also, ‘age’ predicted the scores for hypochondriasis and schizophrenia in men; c) in the female group, only ‘age’ was able to predict the scores for the scales of hysteria, paranoia, mental weakness, and social deviance; and d) there was no significant difference between male and female groups in any of the clinical scales. Conclusion. Duration of infection with latent toxoplasmosis was associated with depression, psychopathtic deviation, psychasthenia, and schizophrenia in infected males, but this was not the case for the infected females in any of the clinical scales of the 71-item abbreviated form of MMPI. Practical Implications. In mental health screening of individuals with latent toxoplasmosis, males should be screened on the scales of depression, psychopathtic deviation, psychasthenia, and schizophrenia according to the increase in the duration of infection.

A Systematic Review on Dourine (Equine Trypanosomiasis)

Dourine is a chronic infectious disease that affects breeding horses and spreads from animal to animal during coitus. Trypanosoma equiperdum is the causal agent in this case. Both infected males and females have vaginal discharges that contain these protozoa. Trypanosoma equiperdum is mostly found in tissue and is rarely seen in blood, in contrast to other Trypanosoma species. Dourine is the only biological vector capable of dispersing the Trypanosoma infection, as there are no other viable options. Sometimes the disease is passed on to foals by tainted milk or colostrum meal. Primarily, dourine affects mules, horses, and donkeys. However, donkeys and mules are more resilient than horses and could still be employed as covert messengers in the future. The primary symptoms of the illness are vaginal edema, cutaneous plaques, neurological symptoms, and persistent malnourishment. Identification of the parasite and detection of clinical symptoms are prerequisites for making a diagnosis. Horses from locations where the disease is endemic should not be brought in to prevent its spread to areas where it is not present. Not much research has been done on the condition, especially in developing countries where there is a lack of understanding about it, although it has a significant and asymptomatic influence on an animal’s health. Therefore, the objective of this review is to review Dourine (equine trypanosomiasis).

Association between Cyclic Threshold Values and Clinical Symptoms in Patients with COVID-19 at Teaching Hospital, Jumla, Karnali, Nepal

Introduction: The cyclic threshold (CT) value obtained in the reverse transcriptase polymerase chain reaction (RT-PCR) has been used as the surrogate marker of viral load. Therefore, to understand viral kinetics and evaluate the disease severity with clinical symptoms, it is necessary to evaluate cyclic threshold value in COVID-19-infected patients.&#x0D; Aims: To assess association between cyclic threshold value and clinical symptoms in patients with COVID-19.&#x0D; Methods: A descriptive cross- sectional study was conducted on PCR-positive patients (n=208) for six months at Karnali Academy of Health Science, Teaching Hospital Jumla. The RT-PCR was performed and data of the cyclic threshold value of PCR-positive patients was taken from the laboratory in predesigned study proforma. Data entry and analysis were done in SPSS version 20.0.&#x0D; Results: A larger proportion of females (65.9%) than males (43.1%) had a COVID-19 infection symptoms of COVID-19 were present in about equal numbers of infected males (61%) and females (68.7%). Most of the individuals were in the age range of 19 to 39 years. A cyclic threshold value of less than 30 was present in the majority (49%) of patients. Symptoms were present in 65.9% of individuals. Symptoms were present in a large proportion of subjects with cyclic threshold values of 1–19 and 20–29, at 89.5% and 77.9%, respectively.&#x0D; Conclusion: This study provides valuable insights into the association between cyclic threshold values and clinical symptoms of COVID-19 in patients. It also explores the underlying factors like gender disparities and age-specific disease severity. Patients showing symptoms of COVID-19 typically had a cyclic threshold value below 30 and carry a higher amount of the virus compared to those who don't show symptoms. The association between signs and symptoms and the cyclic threshold is highly significant.