Infected Grapevines Research Articles

Comparison of the Molecular Responses of Tolerant, Susceptible and Highly Susceptible Grapevine Cultivars During Interaction With the Pathogenic Fungus Eutypa lata.

Eutypa lata is the causal agent of eutypa dieback, one of the most destructive grapevine trunk disease that causes severe economic losses in vineyards worldwide. This fungus causes brown sectorial necrosis in wood which affect the vegetative growth. Despite intense research efforts made in the past years, no cure currently exists for this disease. Host responses to eutypa dieback are difficult to address because E. lata is a wood pathogen that causes foliar symptoms several years after infection. With the aim to classify the level of susceptibility of grapevine cultivars to the foliar symptoms caused by E. lata, artificial inoculations of Merlot, Cabernet Sauvignon, and Ugni Blanc were conducted over 3 years. Merlot was the most tolerant cultivar, whereas Ugni Blanc and Cabernet Sauvignon exhibited higher and differential levels of susceptibility. We took advantage of their contrasting phenotypes to explore their defense responses, including the activation of pathogenesis-related (PR) genes, oxylipin and phenylpropanoid pathways and the accumulation of stilbenes. These analyses were carried out using the millicell system that enables the molecular dialogue between E. lata mycelium and grapevine leaves to take place without physical contact. Merlot responded to E. lata by inducing the expression of a large number of defense-related genes. On the contrary, Ugni Blanc failed to activate such defense responses despite being able to perceive the fungus. To gain insight into the role of carbon partitioning in E. lata infected grapevine, we monitored the expression of plant genes involved in sugar transport and cleavage, and measured invertase activities. Our results evidence a coordinated up-regulation of VvHT5 and VvcwINV genes, and a stimulation of the cell wall invertase activity in leaves of Merlot elicited by E. lata, but not in Ugni Blanc. Altogether, this study indicates that the degree of cultivar susceptibility is associated with the activation of host defense responses, including extracellular sucrolytic machinery and hexose uptake during the grapevine/E. lata interaction. Given the role of these activities in governing carbon allocation through the plant, we postulate that the availability of sugar resources for either the host or the fungus is crucial for the outcome of the interaction.

Pathogenicity of <i>Ilyonectria pseudodestructans </i>propagules to grapevine rootstocks

Black foot disease of grapevines is a major economic issue for the viticulture industry, with several Dactylonectria and Ilyonectria species identified as causal agents worldwide. This study aimed to confirm the pathogenicity of an Ilyonectria pseudodestructans isolate recovered from a symptomatic grapevine in a nationwide survey. An initial pot experiment inoculated callused and root-wounded grapevine propagation material of varieties ‘101- 14’ and ‘5C’ with I. pseudodestructans conidia. The second pot experiment compared the pathogenicity of I. pseudodestructans conidial, chlamydospore and mycelial inocula. Disease incidence, severity and root and shoot dry weights were determined after 4–5 months of growth. Ilyonectria pseudodestructans was recovered from inoculated plants resulting in higher disease incidence and severity compared with the uninoculated control. Disease severity and incidence was higher for callused compared to rooted propagation material, but did not differ between grapevine varieties. Conidial inoculum caused greater disease incidence and severity compared with chlamydospore and mycelial inocula. Ilyonectria pseudodestructans propagules infected grapevine plant material via the callused basal ends or wounded roots, indicating this species is a potentially important pathogen of grapevines both in nurseries and vineyards.

Quambalaria cyanescens, a new fungal trunk pathogen associated with grapevine decline in Iran

During surveys on grapevines trunk diseases in vineyards at different localities in East and WestAzerbaijan and Ardabil provinces, Iran, wood samples (two, three year-old cordons) were collected from grapevine showing decline symptoms, including leaf yellowing and necrosis, stunted growth, internal wood necrosis, black vascular discolouration. Nine fungal isolates with similar morphology were recovered from grapevines with decline symptoms in five different areas, which one-third of the isolates were recovered as the sole fungal agents. The identity of fungal isolates was determined as Quambalaria cyanescens based on the combination of cultural and morphological characteristics and DNA phylogeny. Pathogenicity trials based on excised shoot assay and potted grapevine under greenhouse conditions confirmed Q. cyanescens being pathogenic on grapevines; the isolates induced symptoms similar to those observed in naturally infected grapevines. Our findings confirm Q. cyanescens as a new fungal trunk pathogen of grapevine. Members of the genus Quambalaria are known to cause leaf spot, shoot blight and canker disease on Eucalyptus and its relative Corymbia. The current study is the first regarding pathogenicity of the Q. cyanescens on woody hosts; in previous studies Q. cyanescens has proven to be non-pathogenic to Corymbia spp. The host range, extent of geographical distribution and economic significance of this new pathogen on grapevine remains to be studied.

Molecular Detection of Grape Decline Phytoplasma in Leafhopper Species Associated with Infected Grapevines in Iran

Following recent detection of ‘Candidatus Phytoplasma fraxini’, ‘Ca. P. aurantifolia’, ‘Ca. P. solani’ and ‘Ca. P. phoenicium’-related strains in Iranian vineyards, a survey was conducted in 2016–2017 in vineyards located in Qazvin province of Iran. Nested PCR analysis was performed to identify phytoplasma strains in leafhopper species. The overall, less than 5% of grapevine trees shows phytoplasma symptoms and phyto-plasma was detected in all symptomatic samples. Phytoplasma DNA was detected in two leafhopper species. Most leafhopper species in which phytoplasma DNA were detected are recorded to be grass feeders, among which, Stolbur phytoplasma vectors, i.e. Psammotettix alienus (Dahlbom 1851) and Agallia ribauti (Ossian-nilsson, 1938), showed a strong potential ability for ‘Ca. P. solani’ transmission in Qazvin vineyards. The possibility of phytoplasma transmission between leafhoppers and grapevines is discussed.

Seasonal dynamics and spatial distribution of main Grapevine viruses in field-grown grapevine cultivars

Propagation of uninfected plant material is one of the most effective ways for controlling grapevine disease. Different diagnostic methods are available for testing viral infections, including serological techniques such as enzyme-linked immunosorbent assay (ELISA) and molecular techniques based on reverse transcription polymerase chain reaction (RT-PCR) and reverse transcription quantitative PCR (RT-qPCR). The objective of this study was to examine seasonal dynamics and spatial distribution of grapevine viruses within field-grown grapevine cultivars, in order to make more efficient virus detection by ELISA and RT-PCR, by identifying and selecting proper plant material and sampling time. For this purpose, a systematic investigation, considering different plant tissues and phenological stages, has been carried out through a multi-year study. Eight grapevine plants with single or multiple viral infections were selected and their state of infection was firstly monitored during the 2007 growing season, followed by a final infection assessment occurred after 5 years. Our results confirmed a strong erratic distribution of viruses within the vines, regardless of sampling stages, tissue type and/or different plant parts. For what concerns seasonal dynamics, our results on long-term infected grapevine plants corroborated the hypothesis that viruses behave differently from each other with respect to their irregular or rather homogeneous spatial distribution. Thus, an accurate sanitary status check of any grapevine must provide several random samples from different plant parts that have to be carried out several times both during a single growing season and through the years, removing infected vines, and taking vector populations under control.

Visible-near infrared spectroradiometry-based detection of grapevine leafroll-associated virus 3 in a red-fruited wine grape cultivar

Grapevine leafroll disease (GLD) is one of the major threats to wine grapes (Vitis vinifera) causing substantial economic losses to the growers. This study was undertaken to evaluate the applicability of visible and near infrared (VIS-NIR) spectroradiometery as a rapid, robust and non–destructive optical sensing method for the detection of Grapevine leafroll-associated virus 3 (GLRaV-3) at different phenological stages in a red-berried wine grape cultivar. Using VIS-NIR spectroradiometer, data was collected from the healthy and GLRaV-3-infected leaf samples from cv. Cabernet Sauvignon for two seasons at specific intervals during asymptomatic and symptomatic stages of the disease. Fiber optic leaf clip was used to collect spectral responses from grapevine leaves under field conditions. Salient feature extraction using stepwise multilinear regression and partial least square regression methods showed significant differences between healthy and virus–infected leaves in the visible (351, 377, 501, 526, 626 and 676 nm) and near infrared (701, 726, 826, 901, 951, 976, 1001, 1027, 1052 and 1101 nm) regions. Spectral wavelengths from near infrared region (1001, 1027 and 1052 nm) were validated at different phenological stages spanning both asymptomatic and symptomatic stages of the disease. Selected spectral wavelengths demonstrated robustness in virus detection with overall classification accuracies in the range of 75–99% using quadratic discriminant analysis (QDA) classifier. QDA based classification accuracies for healthy, infected and overall classes were significantly higher compared to Naïve Bayes classifier. The accuracy for virus detection during asymptomatic stages was not significantly different from the symptomatic phase, indicating reliability of the selected features for early detection of GLRaV–3–infected grapevines.

Agroinoculation of Grapevine Pinot Gris Virus in tobacco and grapevine provides insights on viral pathogenesis.

The Grapevine Pinot Gris disease (GPG-d) is a novel disease characterized by symptoms such as leaf mottling and deformation, which has been recently reported in grapevines, and mostly in Pinot gris. Plants show obvious symptoms at the beginning of the growing season, while during summer symptom recovery frequently occurs, manifesting as symptomless leaves. A new Trichovirus, named Grapevine Pinot gris virus (GPGV), which belongs to the family Betaflexiviridae was found in association with infected plants. The detection of the virus in asymptomatic grapevines raised doubts about disease aetiology. Therefore, the primary target of this work was to set up a reliable system for the study of the disease in controlled conditions, avoiding interfering factor(s) that could affect symptom development. To this end, two clones of the virus, pRI::GPGV-vir and pRI::GPGV-lat, were generated from total RNA collected from one symptomatic and one asymptomatic Pinot gris grapevine, respectively. The clones, which encompassed the entire genome of the virus, were used in Agrobacterium-mediated inoculation of Vitis vinifera and Nicotiana benthamiana plants. All inoculated plants developed symptoms regardless of their inoculum source, demonstrating a correlation between the presence of GPGV and symptomatic manifestations. Four months post inoculum, the grapevines inoculated with the pRI::GPGV-lat clone developed asymptomatic leaves that were still positive to GPGV detection. Three to four weeks later (i.e. ca. 5 months post inoculum), the same phenomenon was observed in the grapevines inoculated with pRI::GPGV-vir. This observation perfectly matches symptom progression in infected field-grown grapevines, suggesting a possible role for plant antiviral mechanisms, such as RNA silencing, in the recovery process.

Analysis of Kalmusia variispora associated with grapevine decline in Iran

Between March and September 2012, grapevines in vineyards of Meshginshahr county located in Ardabil province as well as Azarshahr, Ajab Shir, and Malekan counties located in East Azerbaijan province, north-western Iran represented general decline symptoms and in some cases black vascular discoloration. Annular or irregular discoloration, dark vascular streaking, and V-shaped unilateral canker or brown necrosis were observed in the pit and vascular tissues of the infected stems. These symptoms were accompanied with necrotic and wilted leaves. Nine fungal isolates having analogous morphological traits were recovered from symptomatic tissues on potato dextrose agar culture medium. Morphological and molecular characterizations confirmed the identity of all nine isolates as Kalmusia variispora (formerly known as Dendrothyrium variisporum). Random amplified polymorphic DNA (RAPD) and inter-simple sequence repeat (ISSR) analyses were conducted for genetic diversity assessment of 13 K. variispora isolates from grapevine, one isolate from Rosa hybrida and one isolate from Pinus eldarica and the results indicated the existence of polymorphism among the isolates (77.27% and 81.25% for RAPD and ISSR, respectively). The clustering of RAPD and ISSR analyses revealed that there was no correlation between the isolates and their geographical as well as host origins. A pathogenicity assay confirmed K. variispora to be pathogenic on grapevine plants (cv. Keshmeshi) causing similar symptoms as those observed in naturally infected grapevines. Kalmusia variispora is associated with grapevine decline symptoms and grapevine trunk disease in Iran.

Grapevine Red Blotch Virus May Reduce Carbon Translocation Leading to Impaired Grape Berry Ripening.

Grapevine red blotch virus (GRBV) is suspected to alter berry ripening and chemistry. This study performed a physiological characterization of GRBV infected grapevines with attention to the factors leading to chemical changes during ripening of Cabernet Sauvignon in two rootstocks, 110R and 420A. RB(+) grapevines had transiently lower net photosynthesis; however, berry total soluble solids (TSS) accumulation was consistently reduced in the two years of study. Accumulation of anthocyanins and loss of titratable acidity and proanthocyanins were also delayed in RB(+) plants. However, the comparison of samples with the same TSS led to lower pH and anthocyanins content. The reduction in carbon import into berries under mild and transient reductions in carbon fixation suggested an impairment of translocation mechanisms with RB(+), leading into a desynchronization of ripening-related processes.

Elimination of the Crown Gall Pathogen, Agrobacterium vitis, from Systemically Infected Grapevines by Tissue Culture

Agrobacterium vitis causes crown gall, a serious disease of grapevines that is common in grape growing regions worldwide. Tissue culture approaches were previously tested for elimination of the bacterium from grapevines, but the detection methods for assessing their effectiveness were much less sensitive than the recently developed magnetic capture hybridization real-time PCR. The latter method was applied in this study to evaluate the elimination of A. vitis from cuttings propagated from severely crown gall-diseased Vitis vinifera cv. Riesling vines by dissecting and culturing apical and axillary buds, as well as meristems, from shoot tips and micropropagating them in tissue culture to recover plantlets. Although the distribution of A. vitis in infected mother vines varied greatly, apparently bacteria-free meristematic tissues were successfully used for the establishment of vines for which bacterial populations were undetectable, even after a dormancy period. It is anticipated that the production and use of clean grapevines in vineyards will delay the early onset of crown gall and contribute to vineyard productivity.

Phytoplasma cultivation: lights and shadows

The possibility to grow phytoplasmas in complex media was first demonstrated using micropropagated infected periwinkle shoots and then carried out employing naturally infected field collected plant samples. Phytoplasmas belonging to diverse ribosomal groups were isolated from infected grapevine and coconut palm tissues and in some cases also from asymptomatic tissues, especially from trees or plants growing in severely infected areas. In particular aster yellows and “stolbur” phytoplasmas, group 16SrI and 16SrXII respectively, were consistently grown among other phytoplasmas from the different plant sources employed and the first biochemical and biological characterization of some of these isolates was obtained.

Methyl jasmonate triggers metabolic responses and gene expression on Vitis vinifera cultivar Loureiro infected with “flavescence dorée”

“Flavescence doree” (FD) is a grapevine epidemic quarantine phytoplasma disease associated with high yield losses. This study aimed to evaluate the effect of methyl jasmonate (MeJA) on the induction of defence mechanisms of grapevines cultivar Loureiro against FD, comparing defence metabolites production (proline and saponins) and gene expression patterns in healthy and infected grapevine plants. The MeJA treatments significantly increased saponin and proline synthesis only in infected plants. Moreover, they induced gene expression of rubisco activase and pathogen-related proteins (PBSP, CHITC4c and PIN) quantified 6 hours after the MeJA application.

First Report of Australian grapevine viroid in Grapevine in Thailand

Viroids, among them the Australian grapevine viroid (AGVd) from the genus Apscaviroid in the family Pospiviroidae, are the most common and widely distributed infectious agents in grapevine (Vitis spp.). Grapevine was introduced in Thailand in 1956, and since then many varieties have been grown, for table grape as well as wine production. In 2015 and 2016, surveys were conducted to check for the presence of viroids in Thai vineyards. Grapevine leaves were collected from commercial vineyards in the Saraburi and Ratchaburi provinces of Thailand. The cultivars ‘White Malaka’, ‘Flame Seedless’, ‘Loose Perlette’, and ‘Black Opal’ were tested. The collected samples showed virus-like symptoms like yellowing, leaf reduction, or mosaic. Total RNAs were extracted using the Genup Plant RNA kit (BiotechRabbit, Germany). Reverse transcription polymerase chain reaction (PCR) for the detection of the AGVd was performed using the primer combinations AGV-mF GTCCTCAGGAGAGCACCGG and AGVd-mR GAAAACTGGTTGGGACCGCTG (195 bp, Hajizadeh et al. 2012), and TGGGCACCAACTAG(A/T)GGTTC and GGGCCTCCAAACAGGG(G/A)G (position 1 to 20 and 352 to 370, respectively, on reference sequence KY404213) for the full-length genome. The resulting amplified fragments were cloned into the plasmid pJET1.2 and sequenced (GenBank MH521286 to MH521288). BLASTn analysis of the AGVd full-length sequences of the different Thai isolates of AGVd revealed 96 to 100% identity among themselves and 94 to 100% identity with the corresponding AGVd sequences of isolates from other countries including, among others, Australia, the United States, Tunisia, China, Iran, Italy (Gambino et al. 2014; Jiang et al. 2009; Vargas-Asencio et al. 2017), Chile (GenBank KF007274), and India (GenBank KJ019304). The AGVd was found in 11 out of 41 samples from three out of eight locations. Among the four grapevine varieties tested, it was only found in White Malaka. AGVd was always found in conjunction with other viroids (Grapevine yellow speckle viroid 1 and 2, Hop stunt viroid). Northern blot analysis, with 50 μg of total RNAs being separated in a 1% formaldehyde-agarose gel, blotted, and hybridized with the purified PCR-amplified fragment corresponding to the AGVd and labeled with [α-³²P]dCTP (3,000 Ci/mmol, Perkin-Elmer), confirmed these results, the recorded signals being at the expected size for the linear form of the viroid. To our knowledge, this is the first report of the AGVd in Thailand. The variability found between the different Thai isolates, which were collected from different farms, suggests different sources of introduction of the infected grapevine material.

Production and Partial Purification of the Grapevine Fanleaf Virus Coat Protein 42 Polyclonal Antibody Against Inclusion Body Expressed in Escherichia coli.

BackgroundExpression of virus coat protein (CP) in Escherichia coli often leads to production of partially folded aggregated proteins which are called inclusion bodies. Grapevine fanleaf virus (GFLV) is one of the most serious and widespread grapevine virus diseases around the world and in Iran.ObjectiveThe main objective of this study was to find a simple and brief method for producing polyclonal antibodies (PAbs) to be used for immunodiagnosis of GFLV.Material and MethodsAn antigenic determinant in GFLV CP gene was inserted into pET-28a bacterial expression vector and the construct (pET-28a CP42) was cloned into E. coli strain BL21 (DE3).The recombinant coat protein of GFLV (CP42) was expressed and characterized by SDS-PAGE and western blot analysis using commercial anti-GFLV antibody. Expression of the CP was detected in the form of inclusion bodies in insoluble cytoplasmic fraction. Then, the inclusion bodies were isolated from the bacterial cells and injected into rabbits for PAbs production. The reaction of the antiserum was checked by ELISA assay. In order to analyze efficiency of the produced PAbs, first the infected and uninfected grapevine samples were confirmed based on morphological symptoms then the indirect plate- trapped antigen Enzyme-linked Immunosorbent Assay (IPTA-ELISA) was applied using the commercial anti GFLV antibody. In the next ELISA assay, efficiency of the raised polyclonal antibody was compared with commercial one.ResultsThe expression of recombinant CP42 induced by IPTG was confirmed by the band of 42 kDa in SDS-PAGE and western blot. The antiserum of purified inclusion body immunized rabbit was reacted with CP42 and GFLV infected Grapevine samples. The results revealed an acceptable efficacy for prepared antibodies compared to that of commercial antibody.ConclusionsIt was evident that the recombinant coat protein in the form of inclusion bodies can be prepared and used as the antigen for immunizing animals in order to produce PAbs.

Plant Water Stress and Vector Feeding Preference Mediate Transmission Efficiency of a Plant Pathogen.

Pathogen spread by arthropod vectors is the outcome of pathogen-vector-plant interactions, as well as how these interactions are impacted by abiotic and biotic factors. While plant water stress impacts each component of the Pierce's disease pathosystem (Xylella fastidiosa Wells et al., insect vectors, and grapevines), the outcome of interactions in relation to pathogen spread is unknown. The objectives of this study were 1) to determine the role of plant water stress on vector acquisition and inoculation of X. fastidiosa under choice and no-choice conditions for source or recipient vines, and 2) to provide insights into the effects of vineyard irrigation regimes on spread of X. fastidiosa by using a host-vector epidemic model. Under no-choice conditions, pathogen acquisition increased as water stress increased in source plants, while inoculation was not affected by water status of recipient vines. Thus, under no-choice conditions, plant water stress increased transmission of X. fastidiosa. However, when vectors had a choice of an uninfected well-watered versus an infected water-stressed grapevine, transmission efficiency declined as water stress levels increased. While our experimental results produced wide uncertainty estimates, the epidemiological modeling suggested a non-linear relationship between water stress and pathogen spread: moderate water stress enhances pathogen spread but severe or no stress produce equivalent spread. In summary, both host plant condition and vector host preference interacted to determine transmission efficiency of X. fastidiosa.

Quantification of Agrobacterium vitis from Grapevine Nursery Stock and Vineyard Soil using Droplet Digital PCR.

Current detection methodologies for Agrobacterium vitis, causing crown gall of grapevines, are time intensive and lack the ability to quantify pathogen abundance in nursery stock and soil. Information on pathogen abundance is a key component to develop management strategies. The aim of this study was to develop a rapid and sensitive quantification assay for grapevine nursery stock and vineyard soil via droplet digital polymerase chain reaction targeting the virA gene. DNA isolated from roots of dormant grapevines originating from nurseries in Germany, California, and Ontario were tested for virA abundance. Bacterial numbers varied with grapevine origin; plants from California had the highest numbers. In addition, rhizosphere soil from two vineyards in the Okanagan valley in British Columbia was tested over a growing season. Sampling time during the season did not affect virA gene abundance. The older vineyard had higher soil A. vitis populations than the younger vineyard. The assay developed here has potential for use in national clean plant programs to prevent import of infected grapevine nursery stock and to test vineyard soil for abundance of the pathogen before planting.

Up-regulated RxLR effector genes of Plasmopara viticola in synchronized host-free stages and infected leaves of hosts with different susceptibility

Fast recognition of host signals and early activation of infection mechanisms in Plasmopara viticola are decisive for successful infestation of Vitis vinifera. To better understand interactive processes at the first front line of combat between the pathogen and its host, a specific pre-infective stage was generated in a host-free system. Zoospore encystment was triggered within minutes after treatment with CaCl2. Subsequently, high rates of germ tube formation occurred in a synchronized manner. This method was employed to compare development-related gene expression in strains of different virulence. Soon after germination, spores showed strong up-regulation of two effector genes, PvRxLR18 and PvRxLR28, particularly in the high virulence strain. On infected grapevine leaf-discs of cultivars with different susceptibility, a similar up-regulation was found at 6 hours post inoculation (hpi). This effect was much more evident in the high virulence than in the low virulence strain and was significantly higher on leaves of the tolerant cultivar Regent than on Müller-Thurgau. In addition, PvRxLR67 was up-regulated 24 hpi in the high virulence strain indicating that different effectors are active in later infection stages. Differences in the expression pattern of RxLR effector genes between the two strains corroborated with infection symptoms visible by sporulation.

Serological detection of Grapevine leafroll-associated virus 4 in grapevine growing areas of India using polyclonal antiserum raised against the recombinant coat protein

Grapevine leafroll disease (GLD), caused by a complex of serologically and genetically distinct or related viral species termed as Grapevine leafroll associated viruses (GLRaVs), is a serious threat to the grape production worldwide. Recently, Grapevine leafroll-associated virus 4 (GLRaV-4) has been reported in the Indian vineyards, mostly as a mixed infection with GLRaV-3 and GLRaV-1. In order to screen the planting material, a polyclonal antiserum against the in vitro expressed coat protein (CP) of GLRaV-4 was produced. The antiserum, purified IgGs and conjugated IgGs detected GLRaV-4 in crude saps of infected grapevines and purified coat protein when used in antigen coated plate enzyme-linked immunosorbent assay (ACP-ELISA), double antibody sandwich enzyme-linked immunosorbent assay (DAS-ELISA), Western blotting and dot immunobinding assay (DIBA). GLRaV-4 could be detected in 54% (39 out of 72) of symptomatic grapevine samples from different grape growing regions of India using DAS-ELISA. The validation of DAS-ELISA results was done by RT-PCR using GLRaV-4 CP-specific primers. To the best of our knowledge, this is the first report of a polyclonal antiserum against the in vitro expressed CP of GLRaV-4 and its successful application in diagnosis of the virus in grape vineyards of India.

Severe Pruning of Infected Grapevines Has Limited Efficacy for Managing Pierce’s Disease

After the initial infection, bacterial plant pathogens often localize to specific tissues or within certain parts of their hosts. In such cases, it may be possible to clear the infection by removing the infected portion and retraining the plant from the base of the trunk. We tested the efficacy of severe pruning at clearing grapevine infections by Xylella fastidiosa, the causal agent of Pierce’s disease. We surveyed vines in six Northern California vineyards and rated them on a scale of disease severity from 0 to 3. Next, we aggressively pruned vines by removing the trunk 10 cm above the graft union and we monitored their retrained canopies over time. Although 82% (284/346) of severely pruned vines appeared disease free the following season, the prevalence of symptoms in conventionally pruned control vines suggests that more than one-third (112/324) of vines would have recovered without severe pruning—at least those with less advanced symptoms. Moreover, for five of the six vineyards, the majority of severely pruned vines showed symptoms of Pierce’s disease by the time vines were retrained, two seasons after pruning (as high as 81%, 86/106; 71% overall, 245/346). These results suggest that severe pruning does not clear X. fastidiosa infection from grapevines to an extent that would justify its adoption for disease management.

Causative Role of Grapevine Red Blotch Virus in Red Blotch Disease.

Grapevine red blotch virus (GRBV) has a monopartite single-stranded DNA genome and is the type species of the genus Grablovirus in the family Geminiviridae. To address the etiological role of GRBV in the recently recognized red blotch disease of grapevine, infectious GRBV clones were engineered from the genome of each of the two previously identified phylogenetic clades for Agrobacterium tumefaciens-mediated inoculations of tissue culture-grown Vitis spp. plants. Following agroinoculation and one or two dormancy cycles, systemic GRBV infection was detected by multiplex polymerase chain reaction (PCR) in Vitis vinifera exhibiting foliar disease symptoms but not in asymptomatic vines. Infected rootstock genotype SO4 (V. berlandieri × V. riparia) exhibited leaf chlorosis and cupping, while infection was asymptomatic in agroinoculated 110R (V. berlandieri × V. rupestris), 3309C (V. riparia × V. rupestris), and V. rupestris. Spliced GRBV transcripts of the replicase-associated protein coding region accumulated in leaves of agroinfected vines, as shown by reverse-transcription PCR; this was consistent with systemic infection resulting from virus replication. Additionally, a virus progeny identical in nucleotide sequence to the infectious GRBV clones was recovered from agroinfected vines by rolling circle amplification, cloning, and sequencing. Concomitantly, subjecting naturally infected grapevines to microshoot tip culture resulted in an asymptomatic plant progeny that tested negative for GRBV in multiplex PCR. Altogether, our agroinoculation and therapeutic experiments fulfilled Koch's postulates and revealed the causative role of GRBV in red blotch disease.