Indigenous Horse Breeds Research Articles

Study on the origin of the Baise horse based on whole-genome resequencing.

The Baise horse, an indigenous horse breed mainly distributed in the Baise region of Guangxi province in southwest China, has a long history as draft animal. However, there is a lack of research regarding the origin and ancestral composition of the Baise horse. In this study, whole-genome resequencing data from 236 horses of seven Chinese indigenous horse breeds, five foreign horse breeds, and four Przewalski's horses were used to investigate the relationships between the Baise horse and other horse breeds. The results showed that foreign horse breeds had no significant impact on the formation of the Baise horse. The two southwestern horse populations, the Debao pony and the Jinjiang horse, exhibit the closest genetic affinity with the Baise horse. This is consistent with their adjacent geographical distribution. Analysis of the migration route revealed a gene flow from the Chakouyi horse into the Baise horse. In summary, our results confirm that the formation of the Baise horse did not involve participation from foreign breeds. Geographical distance emerges as a crucial factor in determining the genetic relationships with the Baise horse. Gene flows of indigenous horse breeds along ancient routes of trade activities had played a role in the formation of the Baise horse.

Genetic Association of MSTN Gene Variant (18:66493737T>C) with Track Performance & Muscle Development in Pakistani Horses

The horse, revered for its diverse traits including racing prowess, gaitedness, and distinctive behavior, plays a pivotal role in various sports. Numerous studies have linked racing performance in horses to the MSTN gene across global populations. Objectives: To investigate the genetic variability of the 18:66493737T>C variant in Pakistani random-bred horses. Methods: ARMS-PCR was employed where 24 horses sourced from UVAS equine clinic were genotyped. Results: Revealing a population distribution of 54% homozygous wild-type (TT), 41% heterozygous (TC), and 4% homozygous mutant (CC) at this locus. The alternative allele frequency within elite performers and control horses stood at 0.36 and 0.12, respectively. Application of the Chi-Square association test using the PLINK data toolset yielded a highly significant p-value of 7.832×10-6. Conclusions: This underscores significant genetic variability at the locus in the Pakistani horse population, aligning with global patterns. Future studies are advocated, incorporating racing performance data and encompassing diverse indigenous horse breeds with substantial sample sizes. Identification of subject markers can inform targeted breeding strategies, contributing to the enhancement and preservation of desirable traits across various horse breeds

Unravelling of the genetic diversity, population structure, and phylogenetic relationships of the indigenous horse breeds of Pakistan

The current study aimed to evaluate the genetic diversity, level of admixture, and phylogenetic relationship, of the Pakistani horse breeds, along with their morphological characterization. Data for the body measurements showed that Morna horses had the highest values of body height, body length, chest girth, leg length, and head length, whereas the Baluchi horses had the lowest values for these traits. For the genetic diversity 64 animals, 15/breed except for Baluchi(14) and Topras(05), were genotyped by using the 17-plex equine genotyping kit. The AMOVA results showed that 13% of genetic diversity was explained by breed differences, whereas 27% and 60% came from among and within individuals respectively. The highest values of genetic diversity parameters including Na(7.29±0.29), Ne(5.73±0.28), Ho(0.74±0.05) and He(0.82±0.01) were observed for Morna, whereas their lowest values were found for Topras. However, the highest value of inbreeding coefficient (Fis) was found for Baluchi and the lowest for KB horses. Among the markers, CA425 was found as the most polymorphic and ASB23 as the least polymorphic and highly fixed marker. Results of structure analysis revealed that, except Topras, each local horse breed had very admixed genetic structure perhaps due to their continuous crossing with other breeds in the past. Moreover, the structure analysis also showed that Morna and Shiean breeds had mixing of each other which was also confirmed by the lowest value of their pairwise Fst values and likewise the phylogenetic analysis also showed their close genetic relationship with each other. The phylogenetic analysis also revealed that Shiean breed had close genetic relationship with Arabian horses. Collectively, our data showed that Morna is the largest and genetically most diverse horse breed of Pakistan, whereas Baluchi horses are the smallest in size and have the highest values of inbreeding coefficient. And the phylogeny analysis showed that Shiean breed had close genetic relationship with the Arabian.

Genetic diversity and signatures of selection in four indigenous horse breeds of Iran

Indigenous Iranian horse breeds were evolutionarily affected by natural and artificial selection in distinct phylogeographic clades, which shaped their genomes in several unique ways. The aims of this study were to evaluate the genetic diversity and genomewide selection signatures in four indigenous Iranian horse breeds. We evaluated 169 horses from Caspian (n = 21), Turkmen (n = 29), Kurdish (n = 67), and Persian Arabian (n = 52) populations, using genomewide genotyping data. The contemporary effective population sizes were 59, 98, 102, and 113 for Turkmen, Caspian, Persian Arabian, and Kurdish breeds, respectively. By analysis of the population genetic structure, we classified the north breeds (Caspian and Turkmen) and west/southwest breeds (Persian Arabian and Kurdish) into two phylogeographic clades reflecting their geographic origin. Using the de-correlated composite of multiple selection signal statistics based on pairwise comparisons, we detected a different number of significant SNPs under putative selection from 13 to 28 for the six pairwise comparisons (FDR < 0.05). The identified SNPs under putative selection coincided with genes previously associated with known QTLs for morphological, adaptation, and fitness traits. Our results showed HMGA2 and LLPH as strong candidate genes for height variation between Caspian horses with a small size and the other studied breeds with a medium size. Using the results of studies on human height retrieved from the GWAS catalog, we suggested 38 new putative candidate genes under selection. These results provide a genomewide map of selection signatures in the studied breeds, which represent valuable information for formulating genetic conservation and improved breeding strategies for the breeds.

Genome-Wide Assessment of Runs of Homozygosity by Whole-Genome Sequencing in Diverse Horse Breeds Worldwide.

In the genomes of diploid organisms, runs of homozygosity (ROH), consecutive segments of homozygosity, are extended. ROH can be applied to evaluate the inbreeding situation of individuals without pedigree data and to detect selective signatures via ROH islands. We sequenced and analyzed data derived from the whole-genome sequencing of 97 horses, investigated the distribution of genome-wide ROH patterns, and calculated ROH-based inbreeding coefficients for 16 representative horse varieties from around the world. Our findings indicated that both ancient and recent inbreeding occurrences had varying degrees of impact on various horse breeds. However, recent inbreeding events were uncommon, particularly among indigenous horse breeds. Consequently, the ROH-based genomic inbreeding coefficient could aid in monitoring the level of inbreeding. Using the Thoroughbred population as a case study, we discovered 24 ROH islands containing 72 candidate genes associated with artificial selection traits. We found that the candidate genes in Thoroughbreds were involved in neurotransmission (CHRNA6, PRKN, and GRM1), muscle development (ADAMTS15 and QKI), positive regulation of heart rate and heart contraction (HEY2 and TRDN), regulation of insulin secretion (CACNA1S, KCNMB2, and KCNMB3), and spermatogenesis (JAM3, PACRG, and SPATA6L). Our findings provide insight into horse breed characteristics and future breeding strategies.

Whole-Genome Sequence Analysis Reveals the Origin of the Chakouyi Horse.

The Chakouyi horse is an ancient Chinese indigenous horse breed distributed in Gansu Province in northwestern China, and is also one of the key breeds protected by the government. However, the origin of the Chakouyi horse remains unclear. As it is distributed in a key region of the Silk Road, it was speculated that the origin of the Chakouyi horse might involve the foreign horse breeds found along this ancient commercial artery. In this study, whole-genome resequencing data of 12 horse breeds, including both indigenous and foreign horses, were applied to reveal the genetic relationships between the Chakouyi horse and other breeds, as well as the ancestry of this ancient breed. An analysis of the population structure and admixture showed that there is no close genetic affinity between the Chakouyi horse and the foreign horses while Chinese indigenous horse populations were grouped together in accordance with their geographic locations, and the Chakouyi horse showed a closer relationship with Kazak horses, Mongolian horses, and Tibetan horses. The results from the ancestral composition prediction indicated that the Kazak horse and the Mongolian horse might be two ancestors of the Chakouyi horse. Furthermore, the genome-wide selection signature analysis revealed that the DMRT3 gene was positively selected in the Chakouyi horse and related to the gait trait of the breed. Our results provide insights into the native origin of the Chakouyi horse and indicate that Kazak and Mongolian horses played important roles in the formation of the Chakouyi horse. Genetic communication between the Chakouyi horse and other horse populations could be attributed, at least partially, to population migrations and trade activities along the ancient commercial routes.

Changes in the genetic variability of the Furioso-North Star population between 1989 and 2019

The Furioso-North Star (FNS) is one of the indigenous Hungarian horse breeds, originated from Mezőhegyes Stud. The aim of this work was to analyze the pedigree diversity and inbreeding of the registered Hungarian Furioso-North Star population in two different time points: the first was the active population in 1989, the second was the active population in 2019. Pedigree data was analyzed using Endog 4.8 software. The pedigree completeness was calculated in three different ways. In the past 30 years the pedigrees became more complete. In the population 2019 were 5 horses with ancestor in the 40th generation. Only 17–17 animals covered the 50% of the genetic variability for the two population. The most important ancestor was Herod xx in both reference populations. The FNS breed has English Thoroughbred background, that might be the reason of having several horses form this breed in the database. There were six animals among the ten most important ancestors in both reference populations. The average inbreeding coefficient was 3.31 in 1989 and 4.22 in 2019. Animals with highest inbreeding coefficient were born from the mating of close relatives (typically father-daughter). The Bart Furioso III-84 Boglár had the highest inbreeding coefficient (0.299) in the population 2019.

Effect of foreign stallions on the Hungarian Furioso-North Star breed

The most common aim of animal conservation programs is to maintain genetic diversity. Furioso-North Star is an indigenous Hungarian horse breed originated from Mezőhegyes Stud. The breed is based on two founder stallions, Furioso Senior and North Star Senior. The aim of this research study was to analyze the effect of the foreign breeding stallions to the genetic structure of Hungarian Furioso-North Star breed. The genetic structure of the breed was studied from pedigree data what was received from the Furioso-North Star Horse Breeding Association. Foals born between 2015–2018 were chosen as reference population. Every breeding stallion was marked by nationality (Austrian, Czech, German, Hungarian, Romanian or Slovak) according to their birth place. The population was described with genetic variability, what was calculated using Endog software. The Furioso-North Star breed is popular in Central Europe and nearby countries. The stallion imports and the stallion transfers were necessary and useful as they made changes in the composition of the genetic variability. The new genes and the new lines have refreshed the genetic structure. There were several breeds, like the Nonius, Shagya Arabian and English Thoroughbred, whose had an impact on the genetic structure of the Furioso-North Star breed.

Optimum contribution selection (OCS) analyses prompted successful conservation actions for Faroese Horse population

The Faroese horse, an endangered indigenous horse breed, is a part of the cultural and societal heritage of the Faroe Islands. Population history describes a severe bottleneck, prompting for quantification of the genetic diversity (level of inbreeding, probability of gene origin, effective population size) and assessment of sustainable conservation potential (Optimum Contribution Selection, OCS) of the Faroese horse population. The pedigree completeness (PCI) of the Faroese horse is adequate for a realistic estimation of the level of inbreeding (PCI5 = 0.96). In concordance with the known population history, the average inbreeding is exceptionally high; in the last cohort, it was equal to 26.8%. An estimate of the effective population size, based on individual increase in inbreeding and coancestry, accounting for the whole population history, was eight. OCS offers a tool to understand and control the increase in the average relationships in the population. Within a fixed number of matings, the repetitive use of stallions resulted in the lowest level of average relationships. Successful follow-up of mating schemes planned together with a holistic assessment of the suitability of an individual as a breeding candidate, will minimize the increase in inbreeding in future generations and maximize the possibility to increase the census size of the Faroese horse population.

Genome-Wide Detection of Copy Number Variants in Chinese Indigenous Horse Breeds and Verification of CNV-Overlapped Genes Related to Heat Adaptation of the Jinjiang Horse.

In the present study, genome-wide CNVs were detected in a total of 301 samples from 10 Chinese indigenous horse breeds using the Illumina Equine SNP70 Bead Array, and the candidate genes related to adaptability to high temperature and humidity in Jinjiang horses were identified and validated. We determined a total of 577 CNVs ranging in size from 1.06 Kb to 2023.07 Kb on the 31 pairs of autosomes. By aggregating the overlapping CNVs for each breed, a total of 495 CNVRs were detected in the 10 Chinese horse breeds. As many as 211 breed-specific CNVRs were determined, of which 64 were found in the Jinjiang horse population. By removing repetitive CNV regions between breeds, a total of 239 CNVRs were identified in the Chinese indigenous horse breeds including 102 losses, 133 gains and 4 of both events (losses and gains in the same region), in which 131 CNVRs were novel and only detected in the present study compared with previous studies. The total detected CNVR length was 41.74 Mb, accounting for 1.83% of the total length of equine autosomal chromosomes. The coverage of CNVRs on each chromosome varied from 0.47% to 15.68%, with the highest coverage on ECA 12, but the highest number of CNVRs was detected on ECA1 and ECA24. A total of 229 genes overlapping with CNVRs were detected in the Jinjiang horse population, which is an indigenous horse breed unique to the southeastern coast of China exhibiting adaptability to high temperature and humidity. The functional annotation of these genes showed significant relation to cellular heat acclimation and immunity. The expression levels of the candidate genes were validated by heat shock treatment of various durations on fibroblasts of horses. The results show that the expression levels of HSPA1A were significantly increased among the different heat shock durations. The expression level of NFKBIA and SOCS4 declined from the beginning of heat shock to 2 h after heat shock and then showed a gradual increase until it reached the highest value at 6 h and 10 h of heat shock, respectively. Breed-specific CNVRs of Chinese indigenous horse breeds were revealed in the present study, and the results facilitate mapping CNVs on the whole genome and also provide valuable insights into the molecular mechanisms of adaptation to high temperature and humidity in the Jinjiang horse.

Evaluation of Traditional and Indigenous Horse Breeds for Wider Intended Use: Case Study from Slovenia

In this work, a new multi-criteria model for the evaluation of traditional and indigenous horse breeds, the HORQUAL model, was developed by applying the DEX (Decision Expert) method. The idea for this study culminated from brainstorming among researchers who had the importance of conserving traditional and indigenous horse breeds in Slovenia and their universal uses (recreative and sport) in mind. The conservation of native domestic animal breeds is one of the important indicators of sustainable agricultural development in particular countries. Here, the assessment process considered the horse breeds in terms of lifestyle, expectations, requirements and experiences. The development process was based on the multi-criteria decision analysis approach, and it was applied to seven traditional and indigenous Slovenian horse breeds. The horse breeds were classified into four groups of breed ratings according to the chosen criteria. The horse breeds were categorised as follows: “does not correspond to the criteria”, “less correspondence with the criteria”, “corresponds to the criteria” and “completely corresponds to the criteria”. The results of the HORQUAL model clearly show that it is easier and more effective to choose the most suitable breeds for specific purposes (i.e., recreative/sport horses with the potential for breeding along with acceptable costs, favourable temperament and suitable price) as they can easily be analysed or compared with each other, according to the criteria chosen in this paper. The rating by group takes the criteria for the multi-attribute evaluation that were identified by an expert group into account and balances between the assessment of recreational and sports needs for riders and the life expectancy for breeders. Additionally, incorporating the Plus-minus-1 analysis proved to be a useful support tool to analyse the assessments and to further improve horse breeding plans.

The maintenance of genetic diversity in a local cattle breed through optimal contribution selection

The maintenance of genetic diversity in a local cattle breed through optimal contribution selection

High Frequencies of TNC and COL5A1 Genotypes Associated With Low Risk for Superficial Digital Flexor Tendinopathy in Greek Indigenous Horse Breeds Compared With Warmblood Horses

Tendinopathies constitute a very common category of musculoskeletal disorders, causing economic losses in the equine industry and animal welfare issues in horse populations. Sport and racehorses are in general sensitive to tendinopathies, whereas local indigenous horse populations are often more tolerant to various disorders. Particularly, indigenous Greek horse breeds have evolved and adapted in the rough topographic features of mountainous and semimountainous Greek terrain and are less prone to develop tendinopathies. Susceptibility to tendinopathy has been proposed to be associated with three specific variants in the tenascin-C and collagen type 5 α-1 genes. The present study was designed to analyze these genes and estimate the frequency of the aforementioned variants in three indigenous Greek horse populations, namely the pinia (peneia) breed, the Messara breed, and the nondescript Macedonian pacer, in comparison with a population of warmbloods. Results revealed high frequencies of genotypes with high risk for tendinopathy in the warmblood population and high frequency of low risk genotypes in the Greek breeds. Apart from the three variants, two novel polymorphisms were detected, one of which may also be associated with risk for tendinopathy. Our findings (a) are in agreement with previous ones demonstrating that risk for tendinopathies is associated with particular gene variants and also (b) highlight the value of Greek indigenous horse breeds as a genetic resource that (c) may be used in selective breeding schemes for decreasing the risk for tendinopathies in genetically improved breeds.

Horse Breeds of Nepal

This article is a review on the horse breeds of Nepal. The contents in this article is obtained from google books, blogs, online articles and conference papers. Information about indigenous horse breeds on Nepal is limited and papers on this topic has not been published yet which made the review task challenging. In Nepal, six types of horse and pony breeds is known of indigenous origin: Jumli, Chyanta, Tanghan, Terai, Tattu and Bhotia. Most area of the country is covered with Hill and mountains where horses are commonly used for transportation, cart-pulling, riding, carrying goods and bricks. They are also used for trekking or as pet animals and during festivals like marriages, Ghode Jatra, Yartung festival. Being a developing country as well as from religious point of view, horse rearing is found common in certain parts of Nepal. However, lack of breeding programme, conservation and poor nutrition has resulted in the decline of horse population in Nepal. Therefore, proper study, research and conservation strategies on these local horse breeds is necessary.

Breeding systematization of indigenous breed Medjimurje horse

Medjimurje horse is critically endangered breed (Ne = 14.17) and is one of three Croatian indigenous horse breeds. The aim of this research is to systematize the Medjimurje horse breeding, defining stallion and mare lines, and analyzing the prevalence of other breeds in Medjimurje breeding horses. The result of systematization is defining 7 stallion lines and 37 mare lines which are the basis for breeding in the future. By analyzing the pedigree, we established higher rate of other breeds in Medjimurje breeding horses, and the fact that the breeding hasn’t been done pure blooded, which is necessary given that it is the indigenous breed since the year 1999, after founding the breeds registry. A large proportion of other horse breeds in the Medjimurje horse registry leads to the conclusion that it is not an indigenous horse breed, but the type of cold-blooded horse, so the status of current population "authenticity" is doubtful.

Whole genome sequencing analysis of horse populations inhabiting the Korean Peninsula and Przewalski's horse.

The Jeju horse is an indigenous horse breed in Korea. However, there is a severe lack of genomic studies on Korean horse breeds. The objective of this study was to report genomic characteristics of domestic horse populations that inhabit South Korea (Jeju, Jeju crossbred, and Thoroughbred) and a wild horse breed (Przewalski's horse). Using the equine reference genome assembly (EquCab 2.0), more than ~ 6.5billion sequence reads were successfully mapped, which generated an average of 40.87-fold coverage throughout the genome. Using these data, we detected a total of 12.88million SNPs, of which 73.7% were found to be novel. All the detected SNPs were deeply annotated to retrieve SNPs in gene regions using the RefSeq and Ensemble gene sets. Approximately 27% of the total SNPs were located within genes, whereas the remaining 73% were found in intergenic regions. Using 129,776 coding SNPs, we retrieved a total of 49,171 nonsynonymous SNPs in 12,351 genes. Furthermore, we identified a total of 10,770 deleterious nonsynonymous SNPs which are predicted to affect protein structure or function. We showed numerous genomic variants from domestic and wild horse breeds. These results provide a valuable resource for further studies on functions of SNP-containing genes, and can aid in determining the molecular basis underlying variation in economically important traits of horses.

The Origin of a Coastal Indigenous Horse Breed in China Revealed by Genome-Wide SNP Data

The Jinjiang horse is a unique Chinese indigenous horse breed distributed in the southern coastal areas, but the ancestry of Jinjiang horses is not well understood. Here, we used Equine SNP70 Bead Array technology to genotype 301 horses representing 10 Chinese indigenous horse breeds, and we integrated the published genotyped data of 352 individuals from 14 foreign horse breeds to study the relationships between Jinjiang horses and horse breeds from around the world. Principal component analysis (PCA), linkage disequilibrium (LD), runs of homozygosity (ROH) analysis, and ancestry estimating methods were conducted to study the population relationships and the ancestral sources and genetic structure of Jinjiang horses. The results showed that there is no close relationship between foreign horse breeds and Jinjiang horses, and Jinjiang horses shared a similar genetic background with Baise horses. TreeMix analysis revealed that there was gene flow from Chakouyi horses to Jinjiang horses. The ancestry analysis showed that Baise horses and Chakouyi horses are the most closely related ancestors of Jinjiang horses. In conclusion, our results showed that Jinjiang horses have a native origin and that Baise horses and Chakouyi horses were key ancestral sources of Jinjiang horses. The study also suggested that ancient trade activities and the migration of human beings had important effects on indigenous horse breeds in China.

Characterization of the Polish Primitive Horse (Konik) maternal lines using mitochondrial D-loop sequence variation.

The Polish Primitive Horse (PPH, Konik) is a Polish native horse breed managed through a conservation program mainly due to its characteristic phenotype of a primitive horse. One of the most important goals of PPH breeding strategy is the preservation and equal development of all existing maternal lines. However, until now there was no investigation into the real genetic diversity of 16 recognized PPH dam lines using mtDNA sequence variation. Herein, we describe the phylogenetic relationships between the PPH maternal lines based upon partial mtDNA D-loop sequencing of 173 individuals. Altogether, 19 mtDNA haplotypes were detected in the PPH population. Five haplotypes were putatively novel while the remaining 14 showed the 100% homology with sequences deposited in the GenBank database, represented by both modern and primitive horse breeds. Generally, comparisons found the haplotypes conformed to 10 different recognized mtDNA haplogroups (A, B, E, G, J, M, N, P, Q and R). A multi-breed analysis has indicated the phylogenetic similarity of PPH and other indigenous horse breeds derived from various geographical regions (e.g., Iberian Peninsula, Eastern Europe and Siberia) which may support the hypothesis that within the PPH breed numerous ancestral haplotypes (found all over the world) are still present. Only in the case of five maternal lines (Bona, Dzina I, Geneza, Popielica and Zaza) was the segregation of one specific mtDNA haplotype observed. The 11 remaining lines showed a higher degree of mtDNA haplotype variability (2–5 haplotypes segregating in each line). This study has revealed relatively high maternal genetic diversity in the small, indigenous PPH breed (19 haplotypes, overall HapD = 0.92). However, only some traditionally distinguished maternal lines can be treated as genetically pure. The rest show evidence of numerous mistakes recorded in the official PPH pedigrees. This study has proved the importance of maternal genetic diversity monitoring based upon the application of molecular mtDNA markers and can be useful for proper management of the PPH conservation program in the future.

Polysaccharide Storage Myopathy (PSSM) – A Genetically Determined Disease in Horses

Abstract In Romanian horse breeds there is little information about Polysaccharide Storage Myopathy disease and therefore the objective of this study was to do a first evaluation of two indigenous horse breeds for presence of polymorphism in the GYS1 gene, associated with the disease. In this purpose, a number of 14 biological samples were collected from two breeds : Semigreu Romanesc and Lipitan. The genomic DNA was isolated from hair samples with Quick-gDNA Mini Prep kit, according to the manufacturer’s protocol. A 229 bp fragment, targeting the polymorphic region of GYS1 gene, was amplified with a set of specific primers and the PCR products were digested with HpyCH4 V restriction enzyme. The resulting fragments were separated in 3% agarose gel. Two fragments, of 151 and 78 bp, which correspond to the GG genotype, were identified, while four fragments (151, 97, 78 and 54 bp) were obtained in the case of heterozygous AG genotypes. All analysed Lipitan horses were homozygous for the G allele, while all Semigreul Romanesc horses were heterozygous, carrying the A allele which are associated with PSSM. To establish more accurate results in Romanian horse breeds, further studies, on a larger number of horses, are needed.

Species specific mitochondrial Cytochrome c oxidase gene sequence of Manipuri pony

The Manipuri pony, a unique indigenous horse breed of India, is known for its fastness, intelligence, surefooted moves and high endurance. The use of DNA barcodes, short DNA sequences from a standardized region of the mitochondrial (mt) genome, has recently been proposed as a tool to facilitate species identification. However, for this emblematic species, there is lacking in the development of DNA barcode which will remain as the molecular tag in the future. A specific molecular identification tag of Manipuri pony was developed under the Accession no. JN228963, and analysis within this family found that the individuals of a single species grouped closely together. Using a set of primer (forward-5´CCAACCACAAAGACATTGGCAC 3´ and reverse- 5´ CTTCTGGGTGGCAA AGAATCA 3´), PCR amplification based on the total genomic DNA extracted from hair samples of Manipuri pony gave an amplification product of 669bp which lies within the barcode region of COI gene of the mitochondrial genome. The partial sequence of COI gene, which is the DNA barcode of Manipuri pony will remain as the molecular identification mark for this species in the future. Additionally, it will also enhance the conservation of genetic resources of Manipuri pony. COI sequence divergence for conspecific individuals of Equidae family was 0.46%, whereas those for congeneric species averaged 6.75% (3.3% to 9.5%). The present finding reaffirmed a very close genetic similarity among the Equidae species. The results showed that analysis based on mt COI gene can be useful for explaining the phylogenetic relationships in the family Equidae.