Incidence Of Disease Research Articles

AGE-RELATED CHARACTERISTICS OF ISCHEMIC HEART DISEASE INCIDENCE IN UKRAINE: A TWO-CENTER STUDY

Purpose of this study is to investigate the age-related characteristics of the incidence of coronary heart disease in Ukraine, considering sex differences. Materials and Methods: The study included patients with coronary heart disease who underwent coronary artery bypass surgery on a beating heart (n = 3,674), comprising 3,061 males and 613 females. The average age of the participants was 60.6 ± 0.8 years. The analysis was based on data obtained from primary medical documentation, including medical histories, anamnestic information, and extracts from patients’ outpatient cards. The research design categorized participants by age group according to the World Health Organization age classification and by sex. Results: The article presents the incidence rates of coronary artery disease based on patient age groups, classified according to the World Health Organization, and sex. The distribution of patients by age groups was analyzed while considering sex, and the frequencies and average ages of the patients were determined. It was found that the incidence of coronary artery disease was highest among the most prevalent age groups in Ukraine's population: middle-aged and elderly patients. The frequency of early postoperative mortality was 0.6%, and it correlated with age-related incidence rates of coronary heart disease. Notably, early postoperative mortality was significantly higher in age groups with the highest incidence of coronary heart disease, specifically among middle-aged and elderly patients (p = 0.03, χ² = 4.69). Conclusions: In this retrospective two-center study of patients with coronary heart disease, it was determined that male patients were affected five times more frequently than female patients. The most common age groups for patients with coronary heart disease were identified as middle-aged and elderly. Early postoperative mortality following coronary artery bypass surgery on a beating heart was found to be 0.6%, with the highest rates observed in elderly (54.6%) and middle-aged (31.8%) patients. The frequency ratios demonstrated statistical significance favoring elderly patients (p = 0.03, χ² = 4.69). The frequency of early postoperative mortality was significantly higher among male patients (p = 0.0001, χ² = 40.33).

Evaluate the effect of exercise core strength training on antioxidant enzyme activity in women from a biomechanical perspective

At present, the incidence rate of chronic diseases is increasing year by year. A variety of antioxidant enzymes in the human body, such as Superoxide Dismutase (SOD), Nitric Oxide Synthase (NOS), Glutathione Peroxidase (GSH Px), Malonic Dialdehyde (MDA) and Catalase (CAT), help to inhibit the generation of oxygen free radicals and play a certain role in preventing the occurrence of chronic diseases. The research on the activity of antioxidant enzymes and the delivery of antioxidant drugs has gradually become the focus of relevant scholars. The physical quality of women is lower than that of men, so it is of great practical significance to study the antioxidant enzyme activity of women. Therefore, this paper explores the influence of exercise core strength training on women’s antioxidant enzyme activity from a biomechanical perspective and concludes that core strength training can improve female students’ SOD content level by 2.58%, and can improve female students’ NOS content level, GSH-Px content level, and MDA content level. Sports core strength training has a positive impact on women’s antioxidant enzyme activity.

INVESTIGATING ETIOPATHOGENETIC FACTORS OF LEFT VENTRICULAR REMODELING AS THE UNDERLYING MECHANISM OF ISCHEMIC MITRAL REGURGITATION

The purpose of this study is to determine the etiopathogenetic features of the development of ischemic mitral regurgitation in patients with coronary heart disease by investigating the mechanisms of left ventricular remodeling. Materials and Methods. The study included 140 patients (99 male, 41 female) with ischemic mitral regurgitation who underwent myocardial revascularization and mitral valve reconstruction (either repair or replacement). The average age of participants was 65.9 ± 4.0 years, and all had a history of coronary heart disease and ischemic mitral regurgitation. All patients in the sample underwent operations for myocardial revascularization and mitral valve reconstruction (replacement). The data analyzed were obtained from primary medical documentation, including medical histories, patient medical charts, findings of physical and clinical examinations, laboratory and instrumental evaluations, as well as echocardiography findings. The data obtain were processed statistically. Results. This article presents an analysis of the etiopathogenetic features associated with the development of ischemic mitral regurgitation under the clinical course of coronary heart disease. The study examined several etiopathogenetic factors, including the presence of arterial hypertension, left ventricular hypertrophy, and the type of left ventricle remodeling. It was found that 39.1% of patients in the experimental group and 40.8% in the control group had hypertension (p ≥ 0.05). The most prevalent condition was grade II arterial hypertension, which occurred in 52.3% of the experimental group and 60.6% of the control group (p ≥ 0.05). When analyzing the occurrence rate of left ventricular hypertrophy, mild hypertrophy was significantly more common in the experimental group (44.9%) compared to the control group (26.8%) (p = 0.03, χ² = 4.27). Moderate left ventricular hypertrophy was found to be significantly higher in the control group (45.1%) compared to the experimental group (27.5%) (p = 0.04, χ² = 3.92). Eccentric hypertrophy of the left ventricle was prevalent in both groups, with values of 79.7% in the experimental group and 80.3% in the control group. In contrast, the frequency of concentric hypertrophy was higher in the control group (8.4%) compared to the experimental group (2.9%) (p ≥ 0.05). Conclusions: The study has established that the incidence of ischemic heart disease and ischemic mitral regurgitation is significantly associated with sex, with men being affected more frequently than women. Analysis of arterial hypertension revealed that 39.1% of patients in the experimental group and 40.8% in the control group were affected, with grade II arterial hypertension being the most common. Moderate and severe left ventricular hypertrophy, as well as concentric remodeling of the left ventricle, were characteristic of patients who underwent mitral valve replacement. These findings underscore the importance of left ventricular remodeling in determining the appropriate surgical treatment for mitral valve conditions.

Use of Disinfectants and Cleaning Products Associated with Respiratory Disease: A Scoping Review

Introduction: there is extensive evidence on the harmful respiratory effects of exposure to disinfectants and cleaning products. Methodology: an exploratory systematic review was carried out in five databases: LILACS, PubMed, MEDLINE and BIREME. Twenty articles from 2013 to 2024 were selected for the present review. Results: chemical compounds present in some disinfectants and cleaning products such as Polyhexamethylene guanidine (PHMG) and Chloromethylisothiazolinone/Methylisothiazolinone (CMIT/MIT) influence the development of Humidifier Respiratory Distress Syndrome (HDRS) and increased incidence of asthma and Chronic Obstructive Pulmonary Disease (COPD) in adults. Conclusions: There is a relationship between exposure to chemical compounds in certain disinfectants and lung health impairment. It is imperative to increase the general population’s awareness of the effects of these substances will lead to improved self-care in those who are in daily contact with these elements.

In utero, childhood, and adolescence tobacco smoke exposure, physical activity, and chronic kidney disease incidence in adulthood: evidence from a large prospective cohort study

BackgroundThe adverse effects of early-life tobacco smoke exposure on chronic kidney disease (CKD) risk remain unclear. This study aimed to investigate the associations of early-life tobacco smoke exposure with CKD incidence in adulthood, and further explore the modification effects of physical activity (PA).MethodsA total of 352,883 participants were included from the UK Biobank. The information on early-life tobacco smoke exposure was assessed by employing in utero tobacco smoke exposure and age of smoking initiation. Weekly moderate-to-vigorous physical activity (MVPA) was calculated for each individual. Cox proportional hazard regression was fitted to estimate the hazard ratio (HR) and 95% confidence interval (CI) of CKD risk, and to investigate the modification effects of MVPA.ResultsCKD incidence significantly increased in participants with in utero tobacco smoke exposure (HR: 1.08, 95% CI: 1.04, 1.12). Compared with never-smokers, we found a monotonic increase in the risk of CKD with smoking initiation across adulthood (HR: 1.21, 95% CI: 1.16, 1.27), adolescence (HR: 1.29, 95% CI: 1.24, 1.35), and childhood (HR: 1.34, 95% CI: 1.25, 1.43) (P trend < 0.001). Additionally, we identified joint cumulative effects of MVPA and early-life tobacco smoke exposure on incident CKD. Compared with never-smokers with recommended MVPA, prenatal or childhood tobacco smokers without recommended MVPA had the highest CKD risk, and the HRs (95% CIs) were 1.17 (1.10, 1.24) and 1.51 (1.36, 1.68), respectively.ConclusionsEarly-life tobacco smoke exposure may contribute to CKD incidence in adulthood, and the observed associations could be modified by MVPA. These findings provide important information on CKD prevention in the participant’s early life while urging a more rapid and powerful need for tobacco control among pregnant couples, children, and adolescents.

Nepal Family Cohort study: a study protocol

IntroductionThe Nepal Family Cohort study uses a life course epidemiological approach to collect comprehensive data on children’s and their parents’ environmental, behavioural and metabolic risk factors. These factors can affect...

Scab Intensity in Pecan Trees in Relation to Hedge-Pruning Methods.

Pecan is a valuable nut crop cultivated in the southeastern United States. Among the major yield-limiting factors in the region is scab, caused by the plant pathogenic fungus Venturia effusa. Managing scab in tall trees (15 to 25+ m) in pecan orchards is challenging because of the limitations of getting sufficient spray coverage throughout the canopy. We explored the effects of hedge pruning on scab in three orchards: 14-m-tall cv. Desirable trees winter hedge pruned on alternate sides to 11 m (site 1), 18-m-tall cv. Stuart trees hedge pruned on both sides simultaneously to 11 m (site 2), and 15-m-tall cv. Caddo trees winter hedge pruned in winter versus summer to 11 m (site 3). At site 1 and 2, hedge-pruned trees were compared with nonpruned control trees. All trees received recommended fungicide applications to control scab via an air-blast sprayer. Disease incidence and/or severity was assessed at different sample heights on shoots, foliage, and fruit during three seasons (2020, 2021, and 2022). At site 1 the hedge-pruned trees often had significantly or numerically more severe scab on foliage and fruit compared with the control trees, although the differences were mostly small. The frequency of mature fruit with scab severity <10% was greatest on control trees in 2021 and 2022. At site 2, there were few differences between hedge-pruned and control trees (on fruit, scab severity was either significantly less on hedge-pruned trees or not different from the control), but the frequency of mature fruit with scab severity <10% was consistently greatest on hedge-pruned trees. At site 3, scab intensity was low, and there were no significant differences in scab severity between winter- and summer-pruning treatments. At sites 1 and 2, there was generally more severe scab at greater sample heights compared with low in the canopy. At site 3 there was little effect of height on disease. The benefit of hedge pruning likely increases with tree height in scab-susceptible cultivars. If a tree is taller than ∼15 m, a greater proportion of the fruit will be within reach of efficacious spray coverage from air-blast sprayers.

Cancer survivors and cardiovascular diseases: from preventive strategies to treatment

During the last decades, progress in the treatment of oncological diseases has led to an increase in the survival of cancer patients: cancer survivors (CS). Thus, the incidence of CS has increased enormously, in both adult CS and childhood and adolescent CS. Unfortunately, CS treated with anthracyclines, chest radiotherapy (RT) and other potentially cardiotoxic drugs have a higher risk of cardiovascular (CV) toxicity: heart failure with reduced ejection fraction (HFrEF), valve diseases, coronary artery diseases, vascular diseases and pericardial diseases. In fact, chest irradiation can cause coronary artery diseases that can be latent until at least 10 years after exposure; also, valvular heart diseases can appear after &gt;20 years following irradiation; heart failure may appear later, several years after anticancer drugs or RT. Therefore, it is very important to stratify the CV risk of cancer patients at the end of cardiotoxic drugs, to plan the most appropriate long-term surveillance program, in accordance with 2022 ESC Guidelines on Cardio-Oncology, to prevent late cardiovascular complications. Monitoring of cancer patients must not stop during anticancer treatment but it must continue afterwards, depending on the patient's CV risk. CV toxicity risk should be reassessed 5 years after therapy to organize long-term follow-up. Considering late cardiotoxicity in CS, our review aims to evaluate the incidence of cardiovascular diseases in CS, their mechanisms, surveillance protocols, preventive strategies, diagnosis and treatment.

Evaluating Treatment and Management Strategies for Diarrhea and Typhoid Fever in Uganda

Diarrhea and typhoid fever remain significant public health challenges in Uganda, contributing to high morbidity and mortality, particularly among vulnerable populations. This review evaluates current treatment and management strategies for these diseases, focusing on standard protocols, rehydration therapy, and the escalating issue of antibiotic resistance. Diarrhea, primarily caused by infectious agents, accounts for a substantial portion of childhood morbidity and mortality, while typhoid fever, caused by Salmonella enterica serotype Typhi, poses severe health risks, particularly in urban areas with poor sanitation. Effective management relies on timely interventions, including rehydration therapy, which significantly reduces the risk of dehydration-related complications. However, the emergence of antibiotic resistance complicates treatment efficacy, necessitating ongoing evaluation and adaptation of management strategies. This review highlights the importance of integrated public health approaches that combine treatment, prevention, and community education to address the interplay of these diseases in Uganda. Key recommendations include the exploration of novel treatment modalities, robust surveillance of resistance patterns, and understanding the impact of climate change on disease incidence. Keywords: Diarrhea, Typhoid fever, Uganda, Public health, Rehydration therapy, Antibiotic resistance.

Clinical significance of the modified Hinchey classification of acute diverticulitis

BACKGROUND: In recent decades, there has been a widespread increase in the incidence of diverticular disease by more than 10 times and an increase in the frequency of its complications in the range from 5 to 25%. AIM: To present the clinical experience of implementing the classification of acute diverticulitis according to E.J. Hinchey (1978) modified by A.M. Kaiser (2005). MATERIALS AND METHODS: The srudy considered the hospitalizations of 314 patients with complicated diverticulitis; the patients were divided according to the Hinchey’s classification into 6 groups depending on the complications. RESULTS: This classification allows not only to stage the disease depending on the severity of the complications, but also to verify these complications with the results of X-ray computed tomography. The modern methods of their correction, which were applied in the Republican Clinical Hospital (Kazan), are given. CONCLUSIONS: The widespread use of the classification by therapists, surgeons, coloproctologists, and emergency doctors will ensure timely and effective treatment tactics, predict the dynamics of the inflammatory process, and manage the flow of patients with this pathology.

How Attitudes, Perceptions, Culture, and Gender Influence the Incidence of Chronic Kidney Disease? A Mixed-Method Study in Surakarta, Indonesia

How Attitudes, Perceptions, Culture, and Gender Influence the Incidence of Chronic Kidney Disease? A Mixed-Method Study in Surakarta, Indonesia

Whole Genome Sequencing and Biocontrol Potential of Streptomyces luteireticuli ASG80 Against Phytophthora Diseases

Phytophthora-induced crop diseases, commonly known as “plant plagues”, pose a significant threat to global food security. In this study, strain ASG80 was isolated from sisal roots and demonstrated a broad-spectrum antagonistic activity against several Phytophthora species and fungal pathogens. Strain ASG80 was identified as Streptomyces luteireticuli via phylogenetic analysis, digital DNA–DNA hybridization (dDDH), and average nucleotide identity (ANI). Whole-genome sequencing identified 40 biosynthetic gene clusters (BGCs) related to secondary metabolite production, including antimicrobial compounds. Strain ASG80 extract exhibited broad-spectrum inhibitory activity against Phytophthora nicotianae, P. vignae, P. cinnamomi, and P. sojae. Pot experiments showed that strain ASG80 extract significantly reduced sisal zebra disease incidence, with an efficacy comparable to the fungicide metalaxyl. These findings suggest that strain ASG80 is a promising biocontrol agent with substantial potential for managing Phytophthora-related diseases in agriculture.

Status of HPV disease and vaccination programmes in LMICs: Introduction to special issue

Sexually transmitted human papillomavirus (HPV) infections are extremely common in both men and women and while most will clear naturally, some may progress to cervical cancer and other cancers. Despite the availability of prophylactic vaccines and well-established screening and treatment practices, the global burden of HPV-related disease remains high, particularly in low-and-middle-income countries (LMICs). We outline the current global epidemiology of cervical cancer disease incidence and mortality, with the highest burden in Africa and Asia. As part of a strategy to eliminate cervical cancer as a public health problem, the WHO recommends a 3-fold approach combining the use of prophylactic vaccines with cervical cancer screening and treatment. This overview focuses on the globally available HPV vaccines and current status of vaccine introduction in LMICs. We describe decreased HPV vaccination coverage in recent years and highlight the need for emphasis on new vaccine introductions and existing vaccine programme strengthening in order to reach goals for the elimination of cervical cancer as a public health problem. It is estimated that US$3.20 will be returned on each dollar invested in cervical cancer prevention efforts through 2050 [1]. Success for these initiatives centers on strategic vaccine delivery and collaborations that foster political support and engagement with civil society organisations and educational sector stakeholders. Recent increases in vaccine supply and single-dose efficacy evidence pave the way for cervical cancer elimination through vaccination coupled with screening and treatment. Subsequent manuscripts in this supplement will outline case studies and lessons from two symposia held in Africa and South Asia by the Coalition to Strengthen the HPV Immunization Community in 2022 including evidence for a one-dose strategy, the challenges of maintaining vaccine programmes during the COVID-19 pandemic, and progress in cervical cancer screening programmes.

Exploring phyllosphere fungal communities of 29 alpine meadow plant species: composition, structure, function, and implications for plant fungal diseases

The phyllosphere of plants hosts diverse fungal microbial communities. Despite the significant impact of plant fungal diseases on productivity and community ecology, the relationship between phyllosphere fungal communities and plant health in natural environments remains poorly understood. This study utilized high-throughput sequencing and field investigations to explore the composition, dynamics, and incidence of fungal diseases across 29 plant species from four functional groups (forbs, grasses, legumes, and sedges) in alpine meadow plant communities of the Qinghai-Tibetan Plateau. We identified Ascomycetes and Basidiomycetes as the predominant phyllosphere fungi. Significant differences were observed in the Shannon diversity index, β-diversity, indicator fungi, and hub fungi among the functional groups. With the exception of the sedge group, the incidence of fungal diseases in other groups was positively correlated with the proportion of pathogens in the phyllosphere fungal community. Predictive analyses revealed that Ascochyta was strongly associated with high disease incidence in grasses, Cercospora in forbs, and Podosphaera in legumes, while Calophoma was associated with low disease incidence in sedges. These findings enhance our understanding of how plant phyllosphere fungal communities assemble in natural environments and improve our ability to predict and manage foliar fungal diseases in alpine meadows.

First Report of Lelliottia amnigena Causing Soft Rot on Purple Stem Mustards in China.

The purple stem mustards (Brassica rapa subsp. chinensis var. purpuraria) (Govaerts R, 2003) are widely cultivated along Yangtze River Valley in China, which is famous for its flavorful and nutritious edible stalks (Wang et al., 2022). In February 2023, a disease of soft rot was observed in multiple purple stem mustards planting fields in Wuhan city, Hubei province, China (30.41°N, 114.22°E). Disease incidence rates were almost 20 to 30% in the planting area (5 ha in size), causing severe economic loss. Infected plants displayed water-soaked symptoms at the base of the petioles, emitting a foul soft rot odor. The severely infected petioles, stems and roots exhibit pus symptoms leading to plant death. To identify the causal agent, small pieces of soft rot symptomatic tissue were cut from the margin of necrotic lesions and surface disinfected with 75% (v/v) ethanol for 30 seconds, followed by three successive rinses with sterile distilled water. The exudates from the clipped tissues were serially diluted and then incubated onto nutrient agar (NA) plates to obtain purified strains at 28°C for 48 hours (Koike et al., 2002). After incubation, 15 strains were obtained and the colonies of all strains were Gram-negative, aerobic, small, round, convex, whitish to dull white, and had smooth slimy edges. Three single bacterial strains CT020801 - CT020803, which were individually isolated from three different diseased samples, were selected as representative strains for further study. Biochemical tests using the BIOLOG GENIII microplate system (Biolog, Hayward, CA, USA) revealed that these strains were positive for methyl red, pectin, dextrin, D-Cellobiose, β-galactosidase, citrate, and maltose, but negative for indole, arginine dihydrolase, urease, ornithine decarboxylase, and gelatinase tests. The 16S ribosomal RNA gene and the three housekeeping genes, atpD, rpoB, and recN were amplified using genomic DNA of Lelliottia amnigena NCTC12124T as the template, with specially designed primers. All amplified fragments were sequenced and deposited in GenBank with accession numbers OQ954706-OQ954707, OQ954713, and OQ953873-OQ953881. BLAST alignments of the 16S rRNA, atpD, rpoB and recN sequences revealed that the sequences of Strain CT020801-03 exhibited the highest identity (100%, ≥97.97%, ≥98.85% and ≥94.52%, respectively) with L. amnigena （Figure S2）. Phylogenetic tree analysis based on multilocus sequence joint 16S rRNA - atpD - rpoB - recN revealed that CT020801 - CT020803 and L. amnigena clustered together in the same clade (Carrie et al., 2013). These results were consistent with those reported for Lelliottia amnigena (Osei et al., 2022). To confirm pathogenicity, healthy base petioles of three-week-old purple stem mustards seedlings were stab inoculated with 20 μL bacterial suspensions (approximately 108 CFU/mL) and then incubated at 28°C and 80% relative humidity in a growth chamber. A sterile liquid NB medium served as the negative control. The test was repeated thrice with each test consisting of five seedlings per treatment. After three days, soft rot symptoms appeared on the stem bases of the inoculated plants, consistent with the initial symptoms observed in the field. Control plants showed no symptoms. The strains were successfully re-isolated from symptomatic plants and identified as L. amnigena, fulfilling Koch's postulates. L. amnigena, a member of the Enterobacter genus (Birlutiu et al., 2023; Brady et al., 2013; Izard et al., 1981), is commonly found in soil and has been identified as an opportunistic pathogen responsible for plant soft rot disease (Reyes-García et al., 2020; Schroeder et al., 2009; Wu et al., 2023). Previous studies have linked L. amnigena to soft rot disease in potato tubers in China. However, this study marks the first documented case of L. amnigena causing soft rot disease in purple stem mustards in China. This discovery expands the known host range of the pathogenic bacteria and will help to provide essential information for making effective measures to manage this disease.

First Report of Southern Blight of Epimedium sagittatum Caused by Agroathelia rolfsii in Henan, China.

Epimedium [Epimedium sagittatum (Sieb. et Zucc.) Maxim., E. brevicornu Maxim., E. pubescens Maxim., E. koreanum Nakai] plants are perennial herbs and the dry leaves were used in traditional Chinese medicine with different medicinal effects (Chinese Pharmacopoeia, 2020 edition). In early August 2022 (the high temperature was 33 ℃ and the low temperature was 25 ℃ on average with above 70% relative humidity), large necrotized leaf spots were initially observed in one-year and two-year old E. sagittatum plants in Dengzhou (32°35'26.84" N, 112°11'8.37" E), Henan province, China. White mycelia, yellow and brown sclerotia were observed along the petioles and colonized to the back of leaves and also on soil-petioles interface around the diseased Epimedium plants. White mycelia spread rapidly from the disease plants as a center to neighboring plants and the infected plants eventually wilted. The disease incidence was 16.0% and 28.0% in the surveyed cultivation fields in Dengzhou (Henan) and Danjiangkou (Hubei), respectively, which resulted in above 20% of yield loss. The symptomatic tissues (petioles, n≥10) were cut into 0.5 cm sections with autoclaved scissors and surface sterilized with 75% ethanol for 30 s, followed by 3 min in 1% NaClO, rinsed three times with distilled sterile water, plated on autoclaved filter paper to remove excess moisture in a biological laminar hood, transferred onto potato dextrose agar (PDA) plates and incubated at 28℃ in incubator in the dark for 3-5 days. Twelve fungal isolates with white radial colony morphology were obtained and purified by hyphal-tip method. The isolates formed radial colonies showing abundant aerial mycelia with a growth rate of 19.25 to 22.25 mm/day (mean = 21.67 ± 0.77 mm; n = 36) and white abundant sclerotia were observed after 5-7 days post inoculation at 28℃. The hyphae of the isolates were hyaline, branched with clamp connections at septa. The isolates formed dark brown sclerotia on PDA plate post 10-14 days incubation. The diameter of mature brown sclerotia ranged from 1.31 to 3.07 mm (mean = 1.91 ± 0.39 mm; n = 40) and 13 to 45 sclerotia (mean = 28; n = 24) were observed on each Petri dish. The isolates were tentatively identified as Agroathelia rolfsii based on morphological characteristics (Yi Y., et al. 2024) and isolate YYHBJ1 was selected as representative isolate for molecular identification and pathogenicity test. The genomic DNA was extracted using CTAB method. For molecular identification, ITS region, translation elongation factor-1alpha (TEF-1α) and nuclear large-subunit ribosomal DNA (nLSU-rDNA) were amplified (White et al. 1990, Wendland and Kothe, 1997). The sequences 684-bp ITS (OR428367), 534-bp TEF1α (OR485567), and 965-bp nLSU-rDNA (OR426612) of isolate YYHBJ1 were deposited in GenBank. Sequence analysis revealed that ITS, TEF1α and nLSU-rDNA sequences of YYHBJ001 showed 100%, 99.63%, and 100% identity to ITS (MN380242 and JF819727), EF1α (MN262527) and nLSU-rDNA (MT225781 and AY635773) sequences of Agroathelia rolfsii (Sacc.) Redhead & Mullineux (Redhead and Mullineux 2023). Pathogenicity tests was confirmed by inoculating 1 year-old E. sagittatum plants grown in pots with sterile soil. PDA plug (5 mm diameter) colonized with 3 brown sclerotia and the fungal culture which was cultivated for 12 days was deposited beside the petiole on the surface of the soil. The control plants were inoculated with PDA plugs without the pathogen. Five plants were used in each treatment. The plants were cultivated in incubator at 28℃ with 80% relative humidity. Fourteen days later, white mycelia growing out from the sclerotia and spread along the petioles to the leave and the infected leaves were yellow. After 21 to 24 days, all inoculated plants displayed symptoms like those observed in field, while no symptoms were observed on the controls. The fungus was re-isolated from the inoculated plants as described above, fulfilling Koch's postulates. The pathogenicity tests were repeated three times. Based on morphological feature and DNA sequences, the pathogen of southern blight on Epimedium plants was identified as A. rolfsii (anamorph S. rolfsii). The pathogen A. rolfsii usually infect kinds of crops and cause southern blight, such as peanuts, chili peppers, green onion and so on (Daunde et al. 2018). To our knowledge, this is the first report of A. rolfsii causing southern blight on E. sagittatum plants in Henan in China.

Least absolute shrinkage and selection operator regression used to select important features when predicting wheat yield from various genotype groups

Abstract Bread wheat and durum wheat genotypes were grown in field experiments at two locations in New South Wales, Australia across several years and using two sowing times (‘early’ v. ‘late’). Genotypes were grouped based on genetic similarity. Grain yield, grain size, soil characteristics and daily weather data were collected. The weather data were used to calculate water and heat stress indices for four key growth periods around flowering. Least absolute shrinkage and selection operator (LASSO) was used to predict grain yield and to identify the most influential features (a combination of index and growth period). A novel approach involving the crop water supply–demand ratio effectively summarized water relations during growth. LASSO predicted grain yield quite well (adjusted R2 from 0.57 to 0.98), especially in a set of durum genotypes. However, the addition of other important variables such as lodging score, disease incidence, weed incidence and insect damage could have improved modelling results. Growth period 2 (30 days pre-flowering up to flowering) was the most sensitive for yield loss from heat stress and water stress for most features. Although one group of bread wheat genotypes was more sensitive to water stress (drought) in period 3 (20 days pre-flowering to 10 days post-flowering). Evapotranspiration was a significant positive feature but only in the vegetative phase (pre-flowering, period 1). This study confirms the usefulness of LASSO modelling as a technique to make predictions that could be used to identify genotypes that are suitable candidates for further investigation by breeders for their stress-tolerance ability.

Evaluating the causal effects between Grave’s disease and diabetes mellitus: a bidirectional Mendelian randomization study

BackgroundGraves’ disease (GD) is an autoimmune disease associated with an increased incidence of other autoimmune diseases. To investigate the causality between GD and Diabetes mellitus (DM), we designed bidirectional two-sample Mendelian randomization (MR) and multivariable MR (MVMR) studies.MethodsSingle-nucleotide polymorphisms (SNPs) associated with GD, thyroid peroxidase (TPO), thyroglobulin (Tg), thyroid-stimulating hormone (TSH), type 1 diabetes (T1D), and type 2 diabetes (T2D) were obtained from the IEU Open GWAS and FinnGen biobank databases. For the forward MR study, we used GD (sample size = 458,620) as the exposure and T1D (sample size = 520,580) and T2D (sample size = 211,766) as the outcomes. Next, high risk of T1D and T2D were used as exposure variables, and GD was used as the outcome variable for the reverse MR analysis. Finally, MVMR analysis was conducted to investigate the probable relationship between DM and indicators for thyroid function like TPO, Tg, and TSH. The inverse variance weighting (IVW) was used as the main method. Finally, the heterogeneity and sensitivity were assessed.ResultsThere were 27, 88, and 55 SNPs associated with GD, T1D, and T2D, respectively. A significant causal connection between higher genetic liability of GD and the risk of T2D (OR [95% CI] = 1.059 [1.025–1.095], P = 5.53e-04) was found in the forward MR analysis. Comparatively, the significant causal relationship between higher genetic liability of GD and the risk of T1D was not demonstrated (OR [95% CI] = 0.998[0.927,1.074], P=0.949). However, reverse MR suggested that there was a genetic susceptibility to T1D that increased the likelihood of developing GD (OR [95% CI] = 1.173[1.117,1.231], P = 1.913e-10), while T2D did not (OR [95% CI] = 0.963 [0.870–1.066], P = 0.468). Furthermore, there was inadequate evidence to suggest that abnormal TSH, TPO, and Tg levels increase the risk of incident T1D or T2D in individuals with GD. MVMR revealed no causal relationship among Tg, TSH, TPO, T1D, or T2D.ConclusionThere was no increased risk of T1D with an increase in genetic susceptibility to GD, although higher genetic susceptibility to T1D has been shown to be associated with increased risk of developing GD. A unidirectional causal relationship between the genetic liability for GD and increased risk of T2D was observed using MR analyses. MVMR analysis showed no statistically relevant causality between the genetic liability for TSH, TPO, or Tg and the risk of either T1D or T2D.

First Report of Root-knot Nematode, Meloidogyne enterolobii, on Luffa cylindrica (L.) in Guangxi, China.

Luffa cylindrica (L.), an annual climbing herb of the Cucurbitaceae family, has a long planting history in China and is deeply loved by people due to its nutritional and medicinal value (Partap S, Kumar A et al., 2012). April 2023, symptoms such as plant dwarfism, decreased yield and serious root-knots appeared on L. cylindrica sampled from a commercial production base in Beihai, Guangxi, China (GPS 21°55'79″ N;109°49'61″ E). The investigated area of L. cylindrica was about 1.3 ha, the incidence of root-knot nematode disease was almost 90%. The roots of 20 L. cylindrica were dug up and many root-knots and egg masses were found. Nematodes in samples at different stages were collected by shallow dish method, and morphological identification was caried out. Males were worm-like, annulated, with the anterior part slightly conical. Females were globular to pyriform. The perineal pattern was oval, with the dorsal arch being moderately high to tall. The tail of the second-stage juvenile (J2) was very slender with a sharp tip. The transparent tail end was clearly visible. Morphological measurements of females (n = 20): body length = 677.2 ± 34.4 μm, body width = 512.8 ± 45.4 μm, stylet = 13.7 ± 0.5 μm, dorsal pharyngeal gland orifice to stylet base (DGO) = 5.7 ± 0.8 μm. The measurements of J2s (n = 20): body length = 412.5 ± 19.4 μm, body wide = 16.2 ± 1.3 μm, stylet lengths = 12.6 ± 0.92 μm, DGO length = 3.1 ± 0.3 μm. Average tail length = 45.44 ± 4.1μm. The observed typical characteristics of M. enterolobii were consistent with those previously described by Yang & Eisenback (1983) and EPPO (2016). J2s hatched by single egg mass were used for DNA extraction and identification of molecular biology. Me-F/Me-R (AACTTTTGTGAAAGTGCCGCTG/TCAGTTCAGGCAGGATCAACC), the specific primers of M. enterolobii, was used to validate this pathogen (Long et al., 2006). Consistent with that described before, the target amplification product was about 236 bp, and no product was obtained from the negative control, M. incognita and M. javanica (Chen et al., 2023). Using V5367/26S (TTGATTACGTCCCTGCCCTTT/TTTCACTCGCCGTTACTAAGG), the rDNA ITS region was obtained and sequenced (Vrain et al., 1992). The target product was 765 bp (GenBank accession no. PQ205316), which was 100% homologous to those M. enterolobii ITS sequence available in the GenBank (KX823372, KJ146863). Koch's postulates were used to verify the pathogenicity of M. enterolobii on L. cylindrica, twelve 2-week-old L. cylindrica were planted in sterilized soil and inoculated with M. enterolobii J2s at a rate of 3,000 individuals per plant. The plants were grown at 26°C in a greenhouse, with non-inoculated controls set up. After 8 weeks, the roots of the non-inoculated plants (n = 12) showed no root-knot and grew well, while all inoculated plants developed root-knots and exhibited stunted growth. The average reproduction factor of the inoculated plants was 19.5, and the average root-knot rating was 7.2 (on a scale of 0 to 10) (Bridge and Page 1980), confirming the pathogenicity of M. enterolobii on L. cylindrica. We found that this is consistent with the description of M. enterolobii infecting Coriandrum sativum in Shanxi, China (Pan et al., 2024) and the infection of Selenicereus costaricensis in Guangxi, China by M. enterolobii (Wu et al., 2023). To our knowledge, this is the first report of M. enterolobii parasitizing L. cylindrica in Guangxi, China. With the increase of vegetable planting area, root-knot nematodes are becoming more and more serious and have become a limiting factor on vegetable production. This finding is of significant importance for vegetable growers to control M. enterolobii in this region, based on which suitable management measures will be taken.

Incidence of infectious diseases in infants under one year in the Astrakhan region in 2017-2021

The purpose of the study. To analyze the epidemiological situation of “childhood infections” among children under 1 year old for 2017–2021 in the Astrakhan region. Materials and methods. There were analyzed, epidemiological maps of infants with “children’s” infections as well as maps of inpatient sick infants who were treated in an infectious hospital. The results of the study. The main complaints of the majority of patients were fever — 87.8% and exanthema syndrome — 84.6%. In rare cases, patients showed catarrhal phenomena of the upper respiratory tract — 13.2%. Dyspeptic phenomena were observed in 15.9% of children. In rare cases, patients had angina — 0.5% and lymphadenopathy — 8.9%. Conjunctivitis and scleritis were observed in 9.6% of infants, including twelve cases with whooping cough, four with chickenpox and 58 with measles. The phenomena of meningitis were observed in one child — 0.1% with chickenpox. Lesions of the lower respiratory tract in the form of bronchitis — in 18.5% of infants, including two infants with chickenpox, 117 infants with whooping cough and 24 infants with measles. Research limitations. Epidemiological maps of infants with “childhood” infections identified in them were studied, during which data on the structure of the incidence of measles, scarlet fever, whooping cough and chickenpox were analyzed. Conclusions. The leading place in the incidence in infants falls on chickenpox, group outbreaks of which were repeatedly recorded over 2017 and 2018. There is a decrease in the incidence of infections such as scarlet fever and whooping cough among infants under the age of 1 year. During 2020–2021, against the background of general well-being, there is an increase in the number of cases of measles among children of different age groups, including among infants under the age of 1 year. The main complaints were fever and exanthema syndrome.