Immediate-early Transcription Research Articles

Transcripts expressed in cytomegalovirus latency coding for an antigenic IE/E phase peptide that drives "memory inflation".

Roizman's definition of herpesviral latency, which applies also to cytomegaloviruses (CMVs), demands maintenance of reactivation-competent viral genomes after clearance of productive infection. It is more recent understanding that failure to complete the productive viral cycle for virus assembly and release does not imply viral gene silencing at all genetic loci and all the time. It rather appears that CMV latency is transcriptionally "noisy" in that silenced viral genes get desilenced from time to time in a stochastic manner, leading to "transcripts expressed in latency" (TELs). If a TEL happens to code for a protein that contains a CD8 T cell epitope, protein processing can lead to the presentation of the antigenic peptide and restimulation of cognate CD8 T cells during latency. This mechanism is discussed as a potential driver of epitope-selective accumulation of CD8 T cells over time, a phenomenon linked to CMV latency and known as "memory inflation" (MI). So far, expression of an epitope-encoding TEL was shown only for the major immediate-early (MIE) gene m123/ie1 of murine cytomegalovirus (mCMV), which codes for the prototypic MI-driving antigenic peptide YPHFMPTNL that is presented by the MHC class-I molecule Ld. The only known second MI-driving antigenic peptide of mCMV in the murine MHC haplotype H-2d is AGPPRYSRI presented by the MHC-I molecule Dd. This peptide is very special in that it is encoded by the early (E) phase gene m164 and by an overlapping immediate-early (IE) transcript governed by a promoter upstream of m164. If MI is driven by presentation of TEL-derived antigenic peptides, as the hypothesis says, one should find corresponding TELs. We show here that E-phase and IE-phase transcripts that code for the MI-driving antigenic peptide AGPPRYSRI are independently and stochastically expressed in latently infected lungs.

Gardenia jasminoides Ellis inhibit white spot syndrome virus replication in red swamp crayfish Procambarus clarkii

As one of the most dangerous pathogens in the aquaculture of crustaceans, white spot syndrome virus (WSSV) induces a high mortality rate and huge economic losses in crustacean industries. Up to now, there are no commercially available drugs to control the virus. Thus, it is important to find an antiviral drug to combat highly lethal WSSV outbreaks. In the present study, the anti-WSSV activities of 23 medicinal plant extracts were investigated in crayfish Procambarus clarkii. In order to better evaluate the antiviral activities of plant extracts, it was important to build a WSSV infection model in crayfish first. The results of WSSV infection showed that WSSV could infect most tissues of crayfish, and the heaviest infected tissue is the gills. The time course curve of WSSV amount change in crayfish assumed a very similar shape with the typical viral one-step growth curve. On the basis of virus infection model, the anti-WSSV activities of 23 plant extracts were investigated. Among these plants, Gardenia jasminoides showed the highest inhibition on WSSV replication, with 92.31%. A further study showed that G. jasminoides improved survival rate of WSSV-challenged crayfish. Mechanistically, G. jasminoides reduced Hsp70 expression and virus immediate-early gene ie1, early gene DNApol, late gene VP28 transcript, indicating that G. jasminoides inhibited WSSV replication via blocking the immediate-early stage gene ie1 transcript. Furthermore, the expression of antioxidants (cMnSOD, mMnSOD, CAT and GST) and apoptosis-related factors (Bax and Bax-inhibitor-1) were significantly increased in G. jasminoides-treated crayfish, suggesting that G. jasminoides could modulate apoptosis-related factors and possessed anti-oxidative activity in crayfish. Taken together, G. jasminoides could inhibit WSSV replication and improve survival rate of WSSV-challenged crayfish. This outcome offers a scientific basis for the use of extracts of G. jasminoides against WSSV, and it is worth focusing on the isolation and identification of effective active compounds from G. jasminoides.

The Cellular Coactivator HCF-1 Is Required for Glucocorticoid Receptor-Mediated Transcription of Bovine Herpesvirus 1 Immediate Early Genes.

Following productive infection, bovine herpesvirus 1 (BoHV-1) establishes latency in sensory neurons. As in other alphaherpesviruses, expression of BoHV-1 immediate early (IE) genes is regulated by an enhancer complex containing the viral IE activator VP16, the cellular transcription factor Oct-1, and transcriptional coactivator HCF-1, which is assembled on an IE enhancer core element (TAATGARAT). Expression of the IE transcription unit that encodes the viral IE activators bICP0 and bICP4 may also be induced by the activated glucocorticoid receptor (GR) via two glucocorticoid response elements (GREs) located upstream of the enhancer core. Strikingly, lytic infection and reactivation from latency are consistently enhanced by glucocorticoid treatment in vivo As the coactivator HCF-1 is essential for IE gene expression of alphaherpesviruses and recruited by multiple transcription factors, we tested whether HCF-1 is required for glucocorticoid-induced IE gene expression. Depletion of HCF-1 reduced GR-mediated activation of the IE promoter in mouse neuroblastoma cells (Neuro-2A). More importantly, HCF-1-mediated GR activation of the promoter was dependent on the presence of GRE sites but independent of the TAATGARAT enhancer core element. HCF-1 was also recruited to the GRE region of a promoter lacking the enhancer core, consistent with a direct role of the coactivator in mediating GR-induced transcription. Similarly, during productive lytic infection, HCF-1 and GR occupied the IE region containing the GREs. These studies indicate HCF-1 is critical for GR activation of the viral IE genes and suggests that glucocorticoid induction of viral reactivation proceeds via an HCF-1-GR mechanism in the absence of the viral IE activator VP16.IMPORTANCE BoHV-1 transcription is rapidly activated during stress-induced reactivation from latency. The immediate early transcription unit 1 (IEtu1) promoter is regulated by the GR via two GREs. The IEtu1 promoter regulates expression of two viral transcriptional regulatory proteins, infected cell proteins 0 and 4 (bICP0 and bICP4), and thus must be stimulated during reactivation. This study demonstrates that activation of the IEtu1 promoter by the synthetic corticosteroid dexamethasone requires HCF-1. Interestingly, the GRE sites, but not the IE enhancer core element (TAATGARAT), were required for HCF-1-mediated GR promoter activation. The GR and HCF-1 were recruited to the IEtu1 promoter in transfected and infected cells. Collectively, these studies indicate that HCF-1 is critical for GR activation of the viral IE genes and suggest that an HCF-1-GR complex can stimulate the IEtu1 promoter in the absence of the viral IE activator VP16.

NPAS4 recruits CCK basket cell synapses and enhances cannabinoid-sensitive inhibition in the mouse hippocampus.

Experience-dependent expression of immediate-early gene transcription factors (IEG-TFs) can transiently change the transcriptome of active neurons and initiate persistent changes in cellular function. However, the impact of IEG-TFs on circuit connectivity and function is poorly understood. We investigate the specificity with which the IEG-TF NPAS4 governs experience-dependent changes in inhibitory synaptic input onto CA1 pyramidal neurons (PNs). We show that novel sensory experience selectively enhances somatic inhibition mediated by cholecystokinin-expressing basket cells (CCKBCs) in an NPAS4-dependent manner. NPAS4 specifically increases the number of synapses made onto PNs by individual CCKBCs without altering synaptic properties. Additionally, we find that sensory experience-driven NPAS4 expression enhances depolarization-induced suppression of inhibition (DSI), a short-term form of cannabinoid-mediated plasticity expressed at CCKBC synapses. Our results indicate that CCKBC inputs are a major target of the NPAS4-dependent transcriptional program in PNs and that NPAS4 is an important regulator of plasticity mediated by endogenous cannabinoids.

Human cytomegalovirus reprograms hematopoietic progenitor cells into immunosuppressive monocyte to achieve latency

Abstract The precise cell type hosting latent human cytomegalovirus (HCMV) remains elusive. Here we report that HCMV reprograms human hematopoietic progenitor cells (HPCs) into a unique monocyte subset to achieve latency. Unlike conventional monocytes, this monocyte subset possesses higher levels of B7-H4, IL-10 and iNOS, longer lifespan and strong immunosuppressive capacity. Cell sorting of peripheral blood from latently infected human donors confirms that only this monocyte subset, representing less than 0.1% of peripheral mononuclear cells, is HCMV genome-positive but immediate-early (IE)-negative. Mechanistic studies demonstrate that HCMV promotes the differentiation of HPCs into this monocyte subset by activating cellular signal transducer and activator of transcription 3 (STAT3). In turn, this monocyte subset generates high level of nitric oxide (NO) to silence HCMV IE transcription and promote viral latency. By contrast, US28-knockout HCMV mutant incapable of activating STAT3, fails to reprogram the HPCs and achieve latency. Our findings reveal that HCMV differentiates human HPCs into long-life, immunosuppressive monocyte subset for viral latency via activating STAT3/iNOS/NO axis.

Human cytomegalovirus reprogrammes haematopoietic progenitor cells into immunosuppressive monocytes to achieve latency.

The precise cell type hosting latent human cytomegalovirus (HCMV) remains elusive. Here, we report that HCMV reprogrammes human haematopoietic progenitor cells (HPCs) into a unique monocyte subset to achieve latency. Unlike conventional monocytes, this monocyte subset possesses higher levels of B7-H4, IL-10 and inducible nitric oxide synthase (iNOS), a longer lifespan and strong immunosuppressive capacity. Cell sorting of peripheral blood from latently infected human donors confirms that only this monocyte subset, representing less than 0.1% of peripheral mononuclear cells, is HCMV genome-positive but immediate-early-negative. Mechanistic studies demonstrate that HCMV promotes the differentiation of HPCs into this monocyte subset by activating cellular signal transducer and activator of transcription 3 (STAT3). In turn, this monocyte subset generates a high level of nitric oxide (NO) to silence HCMV immediate-early transcription and promote viral latency. By contrast, the US28-knockout HCMV mutant, which is incapable of activating STAT3, fails to reprogramme the HPCs and achieve latency. Our findings reveal that via activating the STAT3-iNOS-NO axis, HCMV differentiates human HPCs into a longevous, immunosuppressive monocyte subset for viral latency.

Transcriptional Elongation of HSV Immediate Early Genes by the Super Elongation Complex Drives Lytic Infection and Reactivation from Latency

The cellular transcriptional coactivator HCF-1 is required for initiation of herpes simplex virus (HSV) lytic infection and for reactivation from latency in sensory neurons. HCF-1 stabilizes the viral Immediate Early (IE) gene enhancer complex and mediates chromatin transitions to promote IE transcription initiation. In infected cells, HCF-1 was also found to be associated with a network of transcription elongation components including the super elongation complex (SEC). IE genes exhibit characteristics of genes controlled by transcriptional elongation, and the SEC-P-TEFb complex is specifically required to drive the levels of productive IE mRNAs. Significantly, compounds that enhance the levels of SEC-P-TEFb also potently stimulated HSV reactivation from latency both in a sensory ganglia model system and invivo. Thus, transcriptional elongation of HSV IE genes is a key limiting parameter governing both the initiation of HSV infection and reactivation of latent genomes.

Long and Short Isoforms of the Human Cytomegalovirus UL138 Protein Silence IE Transcription and Promote Latency.

The UL133-138 locus present in clinical strains of human cytomegalovirus (HCMV) encodes proteins required for latency and reactivation in CD34(+) hematopoietic progenitor cells and virion maturation in endothelial cells. The encoded proteins form multiple homo- and hetero-interactions and localize within secretory membranes. One of these genes, UL136 gene, is expressed as at least five different protein isoforms with overlapping and unique functions. Here we show that another gene from this locus, the UL138 gene, also generates more than one protein isoform. A long form of UL138 (pUL138-L) initiates translation from codon 1, possesses an amino-terminal signal sequence, and is a type one integral membrane protein. Here we identify a short protein isoform (pUL138-S) initiating from codon 16 that displays a subcellular localization similar to that of pUL138-L. Reporter, short-term transcription, and long-term virus production assays revealed that both pUL138-L and pUL138-S are able to suppress major immediate early (IE) gene transcription and the generation of infectious virions in cells in which HCMV latency is studied. The long form appears to be more potent at silencing IE transcription shortly after infection, while the short form seems more potent at restricting progeny virion production at later times, indicating that both isoforms of UL138 likely cooperate to promote HCMV latency. Latency allows herpesviruses to persist for the lives of their hosts in the face of effective immune control measures for productively infected cells. Controlling latent reservoirs is an attractive antiviral approach complicated by knowledge deficits for how latently infected cells are established, maintained, and reactivated. This is especially true for betaherpesviruses. The functional consequences of HCMV UL138 protein expression during latency include repression of viral IE1 transcription and suppression of virus replication. Here we show that short and long isoforms of UL138 exist and can themselves support latency but may do so in temporally distinct manners. Understanding the complexity of gene expression and its impact on latency is important for considering potential antivirals targeting latent reservoirs.

Herpesvirus Late Gene Expression: A Viral-Specific Pre-initiation Complex Is Key.

During their productive cycle, herpesviruses exhibit a strictly regulated temporal cascade of gene expression that can be divided into three general stages: immediate-early (IE), early (E), and late (L). This expression program is the result of a complex interplay between viral and cellular factors at both the transcriptional and post-transcriptional levels, as well as structural differences within the promoter architecture for each of the three gene classes. Since the cellular enzyme RNA polymerase II (RNAP-II) is responsible for the transcription of herpesvirus genes, most viral promoters contain DNA motifs that are common with those of cellular genes, although promoter complexity decreases from immediate-early to late genes. Immediate-early and early promoters contain numerous cellular and viral cis-regulating sequences upstream of a TATA box, whereas late promoters differ significantly in that they lack cis-acting sequences upstream of the transcription start site (TSS). Moreover, in the case of the β- and γ-herpesviruses, a TATT box motif is frequently found in the position where the consensus TATA box of eukaryotic promoters usually localizes. The mechanisms of transcriptional regulation of the late viral gene promoters appear to be different between α-herpesviruses and the two other herpesvirus subfamilies (β and γ). In this review, we will compare the mechanisms of late gene transcriptional regulation between HSV-1, for which the viral IE transcription factors – especially ICP4 – play an essential role, and the two other subfamilies of herpesviruses, with a particular emphasis on EBV, which has recently been found to code for its own specific TATT-binding protein.

HCF1 and OCT2 Cooperate with EBNA1 To Enhance OriP-Dependent Transcription and Episome Maintenance of Latent Epstein-Barr Virus.

ABSTRACTEpstein-Barr virus (EBV) establishes latent infections as multicopy episomes with complex patterns of viral gene transcription and chromatin structure. The EBV origin of plasmid replication (OriP) has been implicated as a critical control element for viral transcription, as well as viral DNA replication and episome maintenance. Here, we examine cellular factors that bind OriP and regulate histone modification, transcription regulation, and episome maintenance. We found that OriP is enriched for histone H3 lysine 4 (H3K4) methylation in multiple cell types and latency types. Host cell factor 1 (HCF1), a component of the mixed-lineage leukemia (MLL) histone methyltransferase complex, and transcription factor OCT2 (octamer-binding transcription factor 2) bound cooperatively with EBNA1 (Epstein-Barr virus nuclear antigen 1) at OriP. Depletion of OCT2 or HCF1 deregulated latency transcription and histone modifications at OriP, as well as the OriP-regulated latency type-dependent C promoter (Cp) and Q promoter (Qp). HCF1 depletion led to a loss of histone H3K4me3 (trimethylation of histone H3 at lysine 4) and H3 acetylation at Cp in type III latency and Qp in type I latency, as well as an increase in heterochromatic H3K9me3 at these sites. HCF1 depletion resulted in the loss of EBV episomes from Burkitt's lymphoma cells with type I latency and reactivation from lymphoblastoid cells (LCLs) with type III latency. These findings indicate that HCF1 and OCT2 function at OriP to regulate viral transcription, histone modifications, and episome maintenance. As HCF1 is best known for its function in herpes simplex virus 1 (HSV-1) immediate early gene transcription, our findings suggest that EBV latency transcription shares unexpected features with HSV gene regulation.IMPORTANCE EBV latency is associated with several human cancers. Viral latent cycle gene expression is regulated by the epigenetic control of the OriP enhancer region. Here, we show that cellular factors OCT2 and HCF1 bind OriP in association with EBNA1 to maintain elevated histone H3K4me3 and transcriptional enhancer function. HCF1 is known as a transcriptional coactivator of herpes simplex virus (HSV) immediate early (IE) transcription, suggesting that OriP enhancer shares aspects of HSV IE transcription control.

RT-qPCR-based microneutralization assay for human cytomegalovirus using fibroblasts and epithelial cells

Human cytomegalovirus (HCMV) is a leading cause of congenital infection that can result in serious disabilities in affected children. To facilitate HCMV vaccine development, a microscale neutralization assay based on reverse transcription quantitative PCR (RT-qPCR) was developed to quantify HCMV-neutralizing antibodies. Our approach relies on the generation of crude lysates from virus-infected cells that are amenable to direct analysis by RT-qPCR, thereby circumventing rate-limiting procedures associated with sample RNA extraction and purification. By serial passaging of the laboratory HCMV strain AD169 in epithelial cells (ARPE-19), a revertant virus with restored epithelial cell tropism, designated AD169wt131, was obtained. AD169 and AD169wt131 were evaluated in both epithelial cells (ARPE-19) and fibroblasts (MRC-5) by one-step RT-qPCR targeting the immediate-early gene IE1 transcript of HCMV. Expression kinetics indicated that RT-qPCR assessment could be conducted as early as 6h post-infection. Human serum samples (n=30) from healthy donors were tested for HCMV-specific IgG using a commercially available ELISA and for HCMV-neutralizing activity using our RT-qPCR-based neutralization assay. In agreement with the ELISA results, higher neutralizing activity was observed in the HCMV IgG seropositive group when compared with the HCMV IgG seronegative group. In addition, HCMV IgG seropositive human sera exhibited higher neutralizing titers using epithelial cells compared with using fibroblasts (geometric mean titers of 344 and 8 in ARPE-19 cells and MRC-5 cells, respectively). Our assay was robust to variation in input virus dose. In addition, a simple lysis buffer containing a non-ionic detergent was successfully demonstrated to be a less costly alternative to commercial reagents for cell-lysate preparation. Thus, our rapid HCMV neutralization assay may be a straightforward and flexible high-throughput tool for measuring antibody responses induced by vaccination and natural infection.

ORF45-Mediated Prolonged c-Fos Accumulation Accelerates Viral Transcription during the Late Stage of Lytic Replication of Kaposi's Sarcoma-Associated Herpesvirus.

Kaposi's sarcoma-associated herpesvirus (KSHV) encodes multiple viral proteins that activate extracellular signal-regulated kinase (ERK)-mitogen-activated protein kinase (MAPK) cascades. One of these viral proteins, ORF45, mediates sustained ERK-p90 ribosomal S6 kinase (RSK) activation during KSHV lytic replication and facilitates viral translation through the phosphorylation of a eukaryotic translation initiation factor, eIF4B. The importance of ERK-RSK activation for KSHV viral transcription has been shown; however, which transcription factor senses the sustained MAPK signaling and leads to viral transcription remains poorly understood. Here we show that the presence of ORF45 leads to the prolonged accumulation of c-Fos during the late stage of KSHV lytic replication through ERK-RSK-dependent phosphorylation and stabilization and that the depletion of c-Fos disrupts viral lytic transcription. Genome-wide screening revealed that c-Fos directly binds to multiple viral gene promoters and enhances viral transcription. Mutation of the ERK-RSK phosphorylation sites of c-Fos restrains KSHV lytic gene expression and virion production. These results indicate that the prolonged accumulation of c-Fos promotes the progression of viral transcription from early to late stages and accelerates viral lytic replication upon sustained ORF45-ERK-RSK activation during the KSHV lytic life cycle. During KSHV lytic replication, transient activation and sustained activation of ERK-RSK induce viral immediate early (IE) transcription and late transcription, respectively. Studies have revealed that ERK-RSK activates several transcription factors involved in IE gene expression, including Ets, AP-1, CREB, and C/EBP, which lead to the transient ERK-RSK activation-dependent IE transcription. Whereas c-Fos acts as a sensor of sustained ERK-RSK activation, ORF45-ERK-RSK signaling mediates c-Fos phosphorylation and accumulation during late KSHV lytic replication, consequently promoting viral transcription through the direct binding of c-Fos to multiple KSHV promoters. This finding indicates that c-Fos mediates distinct viral transcriptional progression following sustained ERK-RSK signaling during the KSHV lytic life cycle.

Loss of Egr-1 sensitizes pancreatic β-cells to palmitate-induced ER stress and apoptosis.

Pancreatic β-cells are particularly susceptible to fatty-acid-induced endoplasmic reticulum (ER) stress and apoptosis. To understand how β-cells sense fatty acid stimuli and translate into a long-term adaptive response, we investigated whether palmitic acid (PA) regulates early growth response-1 (Egr-1), an immediate-early transcription factor, which is induced by many environmental stimuli and implicated in cell proliferation, differentiation, and apoptosis. We found that Egr-1 was rapidly and transiently induced by PA in MIN6 insulinoma cells, which was accompanied by calcium influx and ERK1/2 phosphorylation. Calcium chelation and MEK1/2 inhibition blocked PA-induced Egr-1 upregulation, suggesting that PA induces Egr-1 expression through a calcium influx-MEK1/2-ERK1/2 cascade. Knockdown of Egr-1 increased PA-induced caspase-3 activation and ER stress markers and decreased PA-induced Akt phosphorylation and insulin secretion and signaling. Akt replenishment and insulin supplementation rescued PA-induced apoptosis in Egr-1 knockdown cells. These results suggest that the absence of Egr-1 loses its ability to couple the short-term insulin/Akt pathway to long-term survival adaptation. Finally, Egr-1-deficient mouse islets are more susceptible to ex vivo stimuli of apoptosis. In human pancreatic tissues, EGR1 expression correlated with expression of ER stress markers and anti-apoptotic gene. In conclusion, Egr-1 is induced by PA and further attempts to rescue β-cells from ER stress and apoptosis through improving insulin/Akt signaling. Our study underscores Egr-1 as a critical early sensor in pancreatic β-cells to translate fatty acid stimuli into a cellular adaptation mechanism. PA stimulates Egr-1 expression via a calcium influx-MEK1/2-ERK1/2-Elk-1 cascade. Egr-1 attenuates PA-induced ER stress and apoptosis. Egr-1 maintains Akt survival pathway to protect β-cells from PA-induced apoptosis. Egr-1-deficient islets are prone to ex vivo stimuli of apoptosis. Human EGR1 expression correlates with genes for ER stress and anti-apoptosis.

Identification of a c-Jun homolog from Litopenaeus vannamei as a downstream substrate of JNK in response to WSSV infection

c-Jun, a major substrate of c-Jun N-terminal kinase (JNK), participates in regulating gene transcription in response to various stimuli, including cytokines, stress signals, bacterial and viral infection. Results from our previous studies suggested that Litopenaeus vannamei JNK (LvJNK) could be utilized by white spot syndrome virus (WSSV) to facilitate viral replication and gene expression. In this article, a c-Jun homolog from Litopenaeus vannamei (designated as Lvc-Jun) was cloned and its role in WSSV infection was studied. Sequence analysis displayed that Lvc-Jun was a novel homolog of c-Jun family, which contained characteristic Jun and basic leucine zipper (bZIP) domains, and two conserved serine phosphorylation sites (Ser49/59). Semi-quantitative RT-PCR analysis showed that Lvc-Jun mRNAs were expressed in all examined tissues. Further investigation determined that Lvc-Jun was located in the nucleus through self-interaction and its phosphorylation levels could be reduced by JNK inhibitor, suggesting that Lvc-Jun could be regulated by LvJNK through phosphorylation and function as a transcription regulator in a homodimer. During the process of WSSV infection, the transcription levels of Lvc-Jun were up-regulated associating with the raising expression and phosphorylation levels of its protein. Moreover, TPA (12-O-tetradecanoylphorbol-13-acetate), a potent inducer of c-Jun, could remarkably promote viral immediate-early gene wsv069 transcription in crayfish hemocytes. Conclusively, our results provided experimental evidences that Lvc-Jun was engaged in WSSV infection and further implied that JNK-c-Jun signaling pathway might be important for WSSV replication and viral gene expression.

Survival rates and prognostic factors of Epstein-Barr virus-associated hydroa vacciniforme and hypersensitivity to mosquito bites

Epstein-Barr virus (EBV)-associated T/natural-killer lymphoproliferative disorders form a group of diseases that includes classical and systemic hydroa vacciniforme (HV) and hypersensitivity to mosquito bites (HMB). Patients with systemic HV (sHV) and HMB often have a poor prognosis, although little is known about the prognostic factors. To elucidate the prognostic factors of HV and HMB. We studied clinicopathological manifestations, routine laboratory findings, anti-EBV titres, EBV DNA load and EBV-encoded gene expression, including expression of BZLF1, in 50 patients with classical HV (cHV), sHV, HMB only and HMB with HV (HMB+HV), and further analysed 30 patients who were available for follow-up. The median age of disease onset was 5years (range 1-74). A follow-up study indicated that fatal outcomes were observed in three of eight patients with sHV, two of six patients with HMB only, and two of five patients with HMB+HV. The main causes of death were complications from haematopoietic stem-cell transplantation and multiorgan failure. There were no fatalities among the 11 patients with cHV. Univariate analysis revealed two poor prognostic indicators: (i) onset age >9years and (ii) the expression of an EBV-encoded immediate-early gene transcript, BZLF1 mRNA, in the skin lesions (P<0·001 and P=0·003, respectively). No prognostic correlation was observed in EBV-infected lymphocyte subsets, anti-EBV antibody titres or EBV DNA load. Late onset and EBV reactivation are both related to more severe phenotypes of the disease, and thus may predict a poor prognosis.

Biological Features of Herpes Simplex Virus Type 1 Latency in Mice According to Experimental Conditions and Type of Neurones

To compare the biological patterns of viral transcripts during herpes simplex virus type 1 (HSV1) latent infection according to experimental conditions. Two types of murine models of HSV1 infection were used: the corneal scarification model, often used in studies of HSV1 latency, and the oro-ocular murine model. Two strains of HSV1 were used for the inoculation: SC16, a wild type strain considered as highly neuroinvasive, and KOS, previously described as poorly neurovirulent. The amounts of viral genomes, and those of four types of viral transcripts (immediate-early, early and late, together with latency-associated transcripts [LATs]), were measured by quantitative PCR and RT-PCR in the main sites of HSV1 latent infection at 6 days, 1 and 3 months post inoculation, and the number of LAT-expressing neurons was assessed by in-situ hybridization on histological sections of trigeminal ganglia (TG). Using the SC16 strain of HSV1 in the oro-ocular model, immediate-early transcripts were still present at 1 month post inoculation (early stage of latent infection), but were not detected at 3 months (late stage of latent infection). In both cases, early and late viral genes transcripts were not detected, demonstrating the latent nature of the infection with this combination of experimental conditions. In contrast, such progress in the viral gene expression was not observed in the corneal scarification model, particularly when the KOS strain of HSV1 was used. These results highlight that the behavior of the virus in the nervous system depends on the method inoculation, and the viral strain. All these parameters are likely to influence the establishment of latent infection.

Early and late response of Nematostella vectensis transcriptome to heavy metals.

Environmental contamination from heavy metals poses a global concern for the marine environment, as heavy metals are passed up the food chain and persist in the environment long after the pollution source is contained. Cnidarians play an important role in shaping marine ecosystems, but environmental pollution profoundly affects their vitality. Among the cnidarians, the sea anemone Nematostella vectensis is an advantageous model for addressing questions in molecular ecology and toxicology as it tolerates extreme environments and its genome has been published. Here, we employed a transcriptome-wide RNA-Seq approach to analyse N.vectensis molecular defence mechanisms against four heavy metals: Hg, Cu, Cd and Zn. Altogether, more than 4800 transcripts showed significant changes in gene expression. Hg had the greatest impact on up-regulating transcripts, followed by Cu, Zn and Cd. We identified, for the first time in Cnidaria, co-up-regulation of immediate-early transcription factors such as Egr1, AP1 and NF-κB. Time-course analysis of these genes revealed their early expression as rapidly as one hour after exposure to heavy metals, suggesting that they may complement or substitute for the roles of the metal-mediating Mtf1 transcription factor. We further characterized the regulation of a large array of stress-response gene families, including Hsp, ABC, CYP members and phytochelatin synthase, that may regulate synthesis of the metal-binding phytochelatins instead of the metallothioneins that are absent from Cnidaria genome. This study provides mechanistic insight into heavy metal toxicity in N.vectensis and sheds light on ancestral stress adaptations.

The 19S proteasome activator promotes human cytomegalovirus immediate early gene expression through proteolytic and nonproteolytic mechanisms.

Proteasomes are large, multisubunit complexes that support normal cellular activities by executing the bulk of protein turnover. During infection, many viruses have been shown to promote viral replication by using proteasomes to degrade cellular factors that restrict viral replication. For example, the human cytomegalovirus (HCMV) pp71 protein induces the proteasomal degradation of Daxx, a cellular transcriptional repressor that can silence viral immediate early (IE) gene expression. We previously showed that this degradation requires both the proteasome catalytic 20S core particle (CP) and the 19S regulatory particle (RP). The 19S RP associates with the 20S CP to facilitate protein degradation but also plays a 20S CP-independent role promoting transcription. Here, we present a nonproteolytic role of the 19S RP in HCMV IE gene expression. We demonstrate that 19S RP subunits are recruited to the major immediate early promoter (MIEP) that directs IE transcription. Depletion of 19S RP subunits generated a defect in RNA polymerase II elongation through the MIE locus during HCMV infection. Our results reveal that HCMV commandeers proteasome components for both proteolytic and nonproteolytic roles to promote HCMV lytic infection. Importance: Proteasome inhibitors decrease or eliminate 20S CP activity and are garnering increasing interest as chemotherapeutics. However, an increasing body of evidence implicates 19S RP subunits in important proteolytic-independent roles during transcription. Thus, pharmacological inhibition of the 20S CP as a means to modulate proteasome function toward therapeutic effect is an incomplete capitalization on the potential of this approach. Here, we provide an additional example of nonproteolytic 19S RP function in promoting HCMV transcription. These data provide a novel system with which to study the roles of different proteasome components during transcription, a rationale for previously described shifts in 19S RP subunit localization during HCMV infection, and a potential therapeutic intervention point at a pre-immediate early stage for the inhibition of HCMV infection.

Additive effect of TGF-ß with TNF-α on type VII collagen gene expression to activate the expression of an extracellular matrix-related gene

Type VII collagen is the predominant, if not the exclusive, component of the anchoring fibrils, attachment structures stabilizing the association of the cutaneous basement membrane to the underlying dermis. In the skin, type VII collagen is synthesized by both dermal fibroblasts and epidermal keratinocytes. Alterations in the type VII collagen protein structure or lack of its expression due to mutations in the corresponding gene COL7A1 are the hallmark of dystrophic epidermolysis bullosa, a mechano-bullous skin disease characterized by extreme fragility of the skin and leading to development of sub-lamina densa blisters. In this study, we have examined whether the additive effect of TGF-ß with TNF-α on type VII collagen gene expression is exerted at the transcriptional level by activation of the corresponding a promoter. Specifically, we demonstrate that the TNF-α effect is mediated by NF-kB1/RelA (p50/p65) and RelA/RelA (p65/p65) NF-kB complexes binding the TNF-α response element (TaRE) located in the region [7252/7230], with RelA acting as the transcriptional activator. We provide definitive evidence for the role of both TGF-ß and TNF-α response elements as enhancer sequences, functioning in the context of a heterologous promoter in an additive manner in response to TGF-ß and TNF-α. This study provides the functional interaction between the two immediate-early transcription factors, SMAD and NF-kB, to activate the expression of an extracellular matrix-related gene, COL7A1.

CTCF binding to the first intron of the major immediate early (MIE) gene of human cytomegalovirus (HCMV) negatively regulates MIE gene expression and HCMV replication.

Human cytomegalovirus (HCMV) gene expression during infection is highly regulated, with sequential expression of immediate-early (IE), early (E), and late (L) gene transcripts. To explore the potential role of chromatin regulatory factors that may regulate HCMV gene expression and DNA replication, we investigated the interaction of HCMV with the cellular chromatin-organizing factor CTCF. Here, we show that HCMV-infected cells produce higher levels of CTCF mRNA and protein at early stages of infection. We also show that CTCF depletion by short hairpin RNA results in an increase in major IE (MIE) and E gene expression and an about 50-fold increase in HCMV particle production. We identified a DNA sequence (TTAACGGTGGAGGGCAGTGT) in the first intron (intron A) of the MIE gene that interacts directly with CTCF. Deletion of this CTCF-binding site led to an increase in MIE gene expression in both transient-transfection and infection assays. Deletion of the CTCF-binding site in the HCMV bacterial artificial chromosome plasmid genome resulted in an about 10-fold increase in the rate of viral replication relative to either wild-type or revertant HCMV. The CTCF-binding site deletion had no detectable effect on MIE gene-splicing regulation, nor did CTCF knockdown or overexpression of CTCF alter the ratio of IE1 to IE2. Therefore, CTCF binds to DNA within the MIE gene at the position of the first intron to affect RNA polymerase II function during the early stages of viral transcription. Finally, the CTCF-binding sequence in CMV is evolutionarily conserved, as a similar sequence in murine CMV (MCMV) intron A was found to interact with CTCF and similarly function in the repression of MCMV MIE gene expression mediated by CTCF. Our findings that CTCF binds to intron A of the cytomegalovirus (CMV) major immediate-early (MIE) gene and functions to repress MIE gene expression and viral replication are highly significant. For the first time, a chromatin-organizing factor, CTCF, has been found to facilitate human CMV gene expression, which affects viral replication. We also identified a CTCF-binding motif in the first intron (also called intron A) that directly binds to CTCF and is required for CTCF to repress MIE gene expression. Finally, we show that the CTCF-binding motif is conserved in CMV because a similar DNA sequence was found in murine CMV (MCMV) that is required for CTCF to bind to MCMV MIE gene to repress MCMV MIE gene expression.