Imino Proton Research Articles

Protein-induced B-Z transition of DNA duplex containing a 2′-OMe guanosine

Structural transformation of the canonical right-handed helix, B-DNA, to the non-canonical left-handed helix, Z-DNA, can be induced by the Zα domain of the human RNA editing enzyme ADAR1 (hZαADAR1). To characterize the site-specific preferences of binding and structural changes in DNA containing the 2′-O-methyl guanosine derivative (mG), titration of the imino proton spectra and chemical shift perturbations were performed on hZαADAR1 upon binding to Z-DNA. The structural transition between B–Z conformation as the changing ratio between DNA and protein showed a binding affinity of the modified DNA onto the Z-DNA binding protein similar to wild-type DNA or RNA. The chemical shift perturbation results showed that the overall structure and environment of the modified DNA revealed DNA-like properties rather than RNA-like characteristics. Moreover, we found evidence for two distinct regimes, “Z-DNA Sensing” and “Modification Sensing”, based on the site-specific chemical shift perturbation between the DNA (or RNA) binding complex and the modified DNA–hZαADAR1 complex. Thus, we propose that modification of the sugar backbone of DNA with 2′-O-methyl guanosine promotes the changes in the surrounding α3 helical structural segment as well as the non-perturbed feature of the β-hairpin region.

Structural basis for stabilization of human telomeric G-quadruplex [d-(TTAGGGT)]4 by anticancer drug epirubicin

Anthracycline anticancer drugs show multiple strategies of action on gene functioning by regulation of telomerase enzyme by apoptotic factors, e.g. ceramide level, p53 activity, bcl-2 protein levels, besides inhibiting DNA/RNA synthesis and topoisomerase-II action. We report binding of epirubicin with G-quadruplex (G4) DNA, [d-(TTAGGGT)]4, comprising human telomeric DNA sequence TTAGGG, using 1H and 31P NMR spectroscopy. Diffusion ordered spectroscopy, sequence selective changes in chemical shift (~0.33 ppm) and line broadening in DNA signals suggest formation of a well-defined complex. Presence of sequential nuclear Overhauser enhancements at all base quartet steps and absence of large downfield shifts in 31P resonances preclude intercalative mode of interaction. Restrained molecular dynamics simulations using AMBER force field incorporating intermolecular drug to DNA interproton distances, involving ring D protons of epirubicin depict external binding close to T1-T2-A3 and G6pT7 sites. Binding induced thermal stabilization of G4 DNA (~36 °C), obtained from imino protons and differential scanning calorimetry, is likely to come in the way of telomerase association with telomeres. The findings pave the way for drug-designing with modifications at ring D and daunosamine sugar.

Reduction in Dynamics of Base pair Opening upon Ligand Binding by the Cocaine-Binding Aptamer

We have used magnetization transfer NMR experiments to measure the exchange rate constant (kex) of the imino protons in the unbound, cocaine-bound, and quinine-bound forms of the cocaine-binding DNA aptamer. Both long-stem 1 (MN4) and short-stem 1 (MN19) variants were analyzed, corresponding to structures with a prefolded secondary structure and ligand-induced-folding versions of this aptamer, respectively. The kex values were measured as a function of temperature from 5 to 45°C to determine the thermodynamics of the base pair opening for MN4. We find that the base pairs close to the ligand-binding site become stronger upon ligand binding, whereas those located away from the binding site do not strengthen. With the buffer conditions used in this study, we observe imino 1H signals in MN19 not previously seen, which leads us to conclude that in the free form, both stem 2 and parts of stem 3 are formed and that the base pairs in stem 1 become structured or more rigid upon binding. This is consistent with the kex values for MN19 decreasing in both stem 1 and at the ligand-binding site. Based on the temperature dependence of the kex values, we find that MN19 is more dynamic than MN4 in the free and both ligand-bound forms. For MN4, ligand-binding results in the reduction of dynamics that are localized to the binding site. These results demonstrate that an aptamer in which the base pairs are preformed also experiences a reduction in dynamics with ligand binding.

Structural basis for stabilization of human telomeric G-quadruplex [d-(TTAGGGT)]4 by anticancer drug adriamycin

Besides inhibiting DNA duplication, DNA dependent RNA synthesis and topoisomerase-II enzyme action, anticancer drug adriamycin is found to cause telomere dysfunction and shows multiple strategies of action on gene functioning. We present evidence of binding of adriamycin to parallel stranded intermolecular [d-(TTAGGGT)]4 G-quadruplex DNA comprising human telomeric DNA by proton and phosphorus-31 nuclear magnetic resonance spectroscopy. Diffusion ordered spectroscopy shows formation of complex between the two molecules. Changes in chemical shift and line broadening of DNA and adriamycin protons suggest participation of specific chemical groups/moieties in interaction. Presence of sequential nuclear Overhauser enhancements at all base quartet steps and absence of large downfield shifts in 31P resonances give clear proof of absence of intercalation of adriamycin chromophore between base quartets. Restrained molecular dynamics simulations using observed 15 short intermolecular inter proton distance contacts depict stacking of ring D of adriamycin with terminal G6 quartet by displacing T7 base and external groove binding close to T1–T2–A3 bases. The disappearance of imino protons monitored as a function of temperature and differential scanning calorimetry experiments yield thermal stabilization of 24 °C, which is likely to come in the way of telomerase association with telomeres. The findings pave the way for design of alternate anthracycline based drugs with specific modifications at ring D to enhance induced thermal stabilization and use alternate mechanism of binding to G-quadruplex DNA for interference in functional pathway of telomere maintenance by telomerase enzyme besides their well known action on duplex DNA. Communicated by Ramaswamy H. Sarma

Transcription Factor Binding in Embryonic Stem Cells Is Constrained by DNA Sequence Repeat Symmetry

Transcription factor (TF) recognition is dictated by the underlying DNA motif sequence specific for each TF. Here, we reveal that DNA sequence repeat symmetry plays a central role in defining TF-DNA-binding preferences. In particular, we find that different TFs bind similar symmetry patterns in the context of different developmental layers. Most TFs possess dominant preferences for similar DNA repeat symmetry types. However, in some cases, preferences of specific TFs are changed during differentiation, suggesting the importance of information encoded outside of known motif regions. Histone modifications also exhibit strong preferences for similar DNA repeat symmetry patterns unique to each type of modification. Next, using an in vivo reporter assay, we show that gene expression in embryonic stem cells can be positively modulated by the presence of genomic and computationally designed DNA oligonucleotides containing identified nonconsensus-repetitive sequence elements. This supports the hypothesis that certain nonconsensus-repetitive patterns possess a functional ability to regulate gene expression. We also performed a solution NMR experiment to probe the stability of double-stranded DNA via imino proton resonances for several double-stranded DNA sequences characterized by different repetitive patterns. We suggest that such local stability might play a key role in determining TF-DNA binding preferences. Overall, our findings show that despite the enormous sequence complexity of the TF-DNA binding landscape in differentiating embryonic stem cells, this landscape can be quantitatively characterized in simple terms using the notion of DNA sequence repeat symmetry.

Cytosine epigenetic modification modulates the formation of an unprecedented G4 structure in the WNT1 promoter.

Time-resolved imino proton nuclear magnetic resonance spectra of the WT22m sequence d(GGGCCACCGGGCAGTGGGCGGG), derived from the WNT1 promoter region, revealed an intermediate G-quadruplex G4(I) structure during K+-induced conformational transition from an initial hairpin structure to the final G4(II) structure. Moreover, a single-base C-to-T mutation at either position C4 or C7 of WT22m could lock the intermediate G4(I) structure without further conformational change to the final G4(II) structure. Surprisingly, we found that the intermediate G4(I) structure is an atypical G4 structure, which differs from a typical hybrid G4 structure of the final G4(II) structure. Further studies of modified cytosine analogues associated with epigenetic regulation indicated that slight modification on a cytosine could modulate G4 structure. A simplified four-state transition model was introduced to describe such conformational transition and disclose the possible mechanism for G4 structural selection caused by cytosine modification.

Refining RNA solution structures with the integrative use of label-free paramagnetic relaxation enhancement NMR

NMR structure calculation is inherently integrative, and can incorporate new experimental data as restraints. As RNAs have lower proton densities and are more conformational heterogenous than proteins, the refinement of RNA structures can benefit from additional types of restraints. Paramagnetic relaxation enhancement (PRE) provides distance information between a paramagnetic probe and protein or RNA nuclei. However, covalent conjugation of a paramagnetic probe is difficult for RNAs, thus limiting the use of PRE NMR for RNA structure characterization. Here, we show that the solvent PRE can be accurately measured for RNA labile imino protons, simply with the addition of an inert paramagnetic cosolute. Demonstrated on three RNAs that have increasingly complex topologies, we show that the incorporation of the solvent PRE restraints can significantly improve the precision and accuracy of RNA structures. Importantly, the solvent PRE data can be collected for RNAs without isotope enrichment. Thus, the solvent PRE method can work integratively with other biophysical techniques for better characterization of RNA structures.

Novel 13 C-detected NMR Experiments for the Precise Detection of RNA Structure.

Up to now, NMR spectroscopic investigations of RNA have utilized imino proton resonances as reporters for base pairing and RNA structure. The nucleobase amino groups are often neglected, since most of their resonances are broadened beyond detection due to rotational motion around the C–NH2 bond. Here, we present 13C‐detected NMR experiments for the characterization of all RNA amino groups irrespective of their motional behavior. We have developed a C(N)H‐HDQC experiment that enables the observation of a complete set of sharp amino resonances through the detection of proton‐NH2 double quantum coherences. Further, we present an “amino”‐NOESY experiment to detect NOEs to amino protons, which are undetectable by any other conventional NOESY experiment. Together, these experiments allow the exploration of additional chemical shift information and inter‐residual proton distances important for high‐resolution RNA secondary and tertiary structure determination.

Proton Transfer Accompanied by the Oxidation of Adenosine.

Despite numerous experimental and theoretical studies, the proton transfer accompanying the oxidation of 2'-deoxyadenosine 5'-monophosphate 2'-deoxyadenosine 5'-monophosphate (5'-dAMP, A) is still under debate. To address this issue, we have investigated the oxidation of A in acidic and neutral solutions by using transient absorption (TA) and time-resolved resonance Raman (TR3 ) spectroscopic methods in combination with pulse radiolysis. The steady-state Raman signal of A was significantly affected by the solution pH, but not by the concentration of adenosine (2-50 mm). More specifically, the A in acidic and neutral solutions exists in its protonated (AH+ (N1+H+ )) and neutral (A) forms, respectively. On the one hand, the TA spectral changes observed at neutral pH revealed that the radical cation (A.+ ) generated by pulse radiolysis is rapidly converted into A. (N6-H) through the loss of an imino proton from N6. In contrast, at acidic pH (<4), AH.2+ (N1+H+ ) generated by pulse radiolysis of AH+ (N1+H+ ) does not undergo the deprotonation process owing to the pKa value of AH.2+ (N1+H+ ), which is higher than the solution pH. Furthermore, the results presented in this study have demonstrated that A, AH+ (N1+H+ ), and their radical species exist as monomers in the concentration range of 2-50 mm. Compared with the Raman bands of AH+ (N1+H+ ), the TR3 bands of AH.2+ (N1+H+ ) are significantly down-shifted, indicating a decrease in the bond order of the pyrimidine and imidazole rings due to the resonance structure of AH.2+ (N1+H+ ). Meanwhile, A. (N6-H) does not show a Raman band corresponding to the pyrimidine+NH2 scissoring vibration due to diprotonation at the N6 position. These results support the final products generated by the oxidation of adenosine in acidic and neutral solutions being AH.2+ (N1+H+ ) and A. (N6-H), respectively.

Nuclear Magnetic Resonance Reveals That GU Base Pairs Flanking Internal Loops Can Adopt Diverse Structures

RNA thermodynamics play an important role in determining the two- and three-dimensional structures of RNA. Internal loops of the sequence 5'-GMNU/3'-UNMG are relatively unstable thermodynamically. Here, five duplexes with GU-flanked 2 × 2 nucleotide internal loops were structurally investigated to reveal determinants of their instability. The following internal loops were investigated: 5'-GCAU/3'-UACG, 5'-UUCG/3'-GCUU, 5'-GCUU/3'-UUCG, 5'-GUCU/3'-UCUG, and 5'-GCCU/3'-UCCG. Two-dimensional nuclear magnetic resonance spectra indicate the absence of GU wobble base pairing in 5'-GCUU/3'-UUCG, 5'-GUCU/3'-UCUG, and 5'-GCCU/3'-UCCG. The 5'-GCUU/3'-UUCG loop has an unusual conformation of the GU base pairs, in which U's O2 carbonyl forms a bifurcated hydrogen bond with G's amino and imino protons. The internal loop of 5'-GUCU/3'-UCUG displays a shifted configuration in which GC pairs flank a U-U pair and several U's are in fast exchange between positions inside and outside the helix. In contrast, 5'-GCAU/3'-UACG and 5'-UUCG/3'-GCUU both have the expected GU wobble base pairs flanking the internal loop. Evidently, GU base pairs flanking internal loops are more likely to display atypical structures relative to Watson-Crick base pairs flanking internal loops. This appears to be more likely when the G of the GU pair is 5' to the loop. Such unusual structures could serve as recognition elements for biological function and as benchmarks for structure prediction methods.

NMR Investigation of the Interaction between the RecQ C-Terminal Domain of Human Bloom Syndrome Protein and G-Quadruplex DNA from the Human c-Myc Promoter

Bloom syndrome protein (BLM) is one of five human RecQ helicases that participate in DNA metabolism. RecQ C-terminal (RQC) domain is the main DNA binding module of BLM and specifically recognizes G-quadruplex (G4) DNA structures. Because G4 processing by BLM is essential for regulating replication and transcription, both G4 and BLM are considered as potential targets for anticancer therapy. Although several studies have revealed the detailed mechanism of G4 unwinding by BLM, the initial recognition of the G4 structure by the RQC domain is unclear. Here, we investigated the interaction between BLM RQC and the G4 DNA from the c-Myc promoter by NMR spectroscopy. While the signals broadened upon reciprocal titrations, the β-wing of RQC had significant chemical shift perturbations and experienced millisecond timescale dynamics upon G4 binding. A point mutation in the β-wing (N1164A) reduced G4 binding affinity. Our hydrogen–deuterium exchange data indicate that imino protons of G4 were exchanged with deuterium much faster in the presence of RQC. We suggest that RQC binds to G4 by using the β-wing as a separating pin to destabilize the G4. By providing information about the RQC–G4 interaction, our study yields insight into potential strategies for preventing G4 processing by BLM.

Conformational analyses for hydrated oligopeptides by quantum chemical calculation (QCC): effects of intra-molecular hydrogen bonds

The structures and energies of anhydrate and hydrate (hydrate rate: h of 1) states of l-alanine (LA), glycine (G), l-proline (LP), and N-methyl glycine (MG) pentamers were calculated by quantum chemical calculation using B3LYP/6-31G(d,p), for four kinds of conformers (β-extended: φ/ψ = t−/t+, PPII: g−/t+, PPII-like: g−/g+, and α-helix: g−/g−). In LA and G, which have imino proton (NH), three conformation types of β-extended, PPII-like, and α-helix were obtained, and water molecules were mainly inserted between intra-molecular hydrogen bond of CO···HN in PPII-like and α-helix and attached to CO group in β-extended. In LA and G, PPII-like conformers were the most stable in the anhydrate and hydrate states, and the result for LA was different from some experimental and theoretical results reported by other works reporting that the main stable conformation of alanine oligopeptide was PPII. On the other hand, in LP and MG, which have no imino proton, two conformers (PPII and PPII-like) and three conformers (PPII, PPII-like, and α-helix) were obtained, respectively. PPII conformers were the most stable in the anhydrate and hydrate states, and the result for LP supported the reported experimental results that the main conformation of proline oligomer was PPII. It was found that the formation pattern and stability of conformation of oligopeptide were strongly dominated by the presence/absence of intra-molecular hydrogen bonding of CO···HN or the presence/absence of NH2 group in the starting amino acid.

Triazoles as T2 -Exchange Magnetic Resonance Imaging Contrast Agents for the Detection of Nitrilase Activity.

We characterized the T2 -exchange (T2ex ) magnetic resonance imaging (MRI) contrast of azole protons that have large chemical shifts from the water proton resonance as a function of pH, temperature, and chemical modification. Our results showed that 1,2,4-triazoles could be tuned into excellent diamagnetic T2ex contrast agents, with an optimal exchange-based relaxivity r2ex of 0.10 s-1 mm-1 at physiological pH and B0 =9.4 T. A fit of r2ex data to the Swift-Connick equation indicated that imino proton exchange of triazoles is dominated by a base-catalyzed process at higher pH values and an acid-catalyzed process at lower pH. The magnitude of r2ex was also found to be heavily dependent on chemical modifications, that is, enhanced by electron-donating groups, such as amines and methyls, or by intramolecular hydrogen bonding between the imino proton and the carboxyl, and weakened by electron-withdrawing groups like bromo, cyano, and nitro. In light of these findings, we applied T2ex MRI to assess the activity of nitrilase, an enzyme catalyzing the hydrolysis of 1,2,4-triazole-3-carbonitrile to 1,2,4-triazole-3-carboxylic acid, resulting in the enhancement of R2ex . Our findings suggest that 1,2,4-triazoles have potential to provide sensitive and tunable diagnostic probes for MRI.

A putative G-quadruplex structure in the proximal promoter of VEGFR-2 has implications for drug design to inhibit tumor angiogenesis

Tumor angiogenesis is mainly regulated by vascular endothelial growth factor (VEGF) produced by cancer cells. It is active on the endothelium via VEGF receptor 2 (VEGFR-2). G-quadruplexes are DNA secondary structures formed by guanine-rich sequences, for example, within gene promoters where they may contribute to transcriptional activity. The proximal promoter of VEGFR-2 contains a G-quadruplex, which has been suggested to interact with small molecules that inhibit VEGFR-2 expression and thereby tumor angiogenesis. However, its structure is not known. Here, we determined its NMR solution structure, which is composed of three stacked G-tetrads containing three syn guanines. The first guanine (G1) is positioned within the central G-tetrad. We also observed that a noncanonical, V-shaped loop spans three G-tetrad planes, including no bridging nucleotides. A long and diagonal loop, which includes six nucleotides, connects reversal double chains. With a melting temperature of 54.51 °C, the scaffold of this quadruplex is stabilized by one G-tetrad plane stacking with one nonstandard bp, G3-C8, whose bases interact with each other through only one hydrogen bond. In summary, the NMR solution structure of the G-quadruplex in the proximal promoter region of the VEGFR-2 gene reported here has uncovered its key features as a potential anticancer drug target.

Simultaneous Binding of Hybrid Molecules Constructed with Dual DNA-Binding Components to a G-Quadruplex and Its Proximal Duplex.

A G-quadruplex (quadruplex) is a nucleic acid secondary structure adopted by guanine-rich sequences and is considered to be relevant to various pharmacological and biological contexts. Although a number of researchers have endeavored to discover and develop quadruplex-interactive molecules, poor ligand designability originating from topological similarity of the skeleton of diverse quadruplexes has remained a bottleneck for gaining specificity for individual quadruplexes. This work reports on hybrid molecules that were constructed with dual DNA-binding components, a cyclic imidazole/lysine polyamide (cIKP), and a hairpin pyrrole/imidazole polyamide (hPIP), with the aim toward specific quadruplex targeting by reading out the local duplex DNA sequence adjacent to designated quadruplexes in the genome. By means of circular dichroism (CD), fluorescence resonance energy transfer (FRET), surface plasmon resonance (SPR), and NMR techniques, we showed the dual and simultaneous recognition of the respective segment via hybrid molecules, and the synergistic and mutual effect of each binding component that was appropriately linked on higher binding affinity and modest sequence specificity. Monitoring quadruplex and duplex imino protons of the quadruplex/duplex motif titrated with hybrid molecules clearly revealed distinct features of the binding of hybrid molecules to the respective segments upon their simultaneous recognition. A series of the systematic and detailed binding assays described here showed that the concept of simultaneous recognition of quadruplex and its proximal duplex by hybrid molecules constructed with the dual DNA-binding components may provide a new strategy for ligand design, enabling targeting of a large variety of designated quadruplexes at specific genome locations.

Structured DNA Aptamer Interactions with Gold Nanoparticles.

DNA aptamers that bind biomolecular targets are of interest as the recognition element in colorimetric sensors based on gold nanoparticles (AuNP), where sensor functionality is related to changes in AuNP colloidal stability upon target binding. In order to understand the role of target binding on DNA-AuNP colloidal stability, we have used high-resolution NMR to characterize the interactions of the 36 nucleotide cocaine-binding aptamer (MN4) and related aptamers with AuNPs, cocaine, and cocaine metabolites. Changes in the aptamer imino proton NMR spectra with low (20 nM) concentrations of AuNP show that the aptamers undergo fast-exchange adsorption on the nanoparticle surface. An analysis of the spectral changes and the comparison with modified MN4 aptamers shows that the AuNP binding domain is localized on stem two of the three-stemmed aptamer. The identification of an AuNP recognition domain allows for the incorporation of AuNP binding functionality into a wide variety of aptamers. AuNP-induced spectral changes are not observed for the aptamer-AuNP mixtures in the presence of cocaine, demonstrating that aptamer absorption on the AuNP surface is modulated by aptamer-target interactions. The data also show that the DNA-AuNP interactions and sensor functionality are critically dependent on aptamer folding.

Mechanistic insights into the photogeneration and quenching of guanine radical cation via one-electron oxidation of G-quadruplex DNA.

Herein, mechanistic aspects of the photogeneration and quenching of guanine radical cation through one-electron oxidation of the G-quadruplex of G2T2G2TGTG2T2G2 (TBA) sequence were investigated by a combined quantum mechanical/molecular mechanical (QM/MM) approach at the CASPT2//CASSCF/AMBER level of theory. Herein, one electron promotion of the oxygen lone pair of the photo-excited photosensitizer peroxydisulfate to its O-O σ* orbital was first demonstrated to become tunable through the varied reduction ability of the G base in the presence or absence of interbase hydrogen bonding, thereby dynamically controlling the deprotonation site in G-quadruplex TBA. The quenching of G radical cation mediated by the formation of SO42-via photoinduced electron transfer can be triggered effectively by the deprotonation reaction of free proton rather than that of the hydrogen-bonded proton in G-G (G-quartet) and G-T (loop) aqueous surrounding. By calculating the deprotonation paths for the G radical cation, the deprotonation reactions in G-quadruplex TBA were verified to proceed predominantly along the site of imino proton (N1-H) in the loop moiety; this showed the coexisting occurrence of amino (N2-H) deprotonation in the G-quartet part. The mechanistic features discussed in this study represent significant advances in the understanding of DNA radical chemistry.

Rotation of Guanine Amino Groups in G-Quadruplexes: A Probe for Local Structure and Ligand Binding

Nucleic acids are dynamic molecules whose functions may depend on their conformational fluctuations and local motions. In particular, amino groups are dynamic components of nucleic acids that participate in the formation of various secondary structures such as G-quadruplexes. Here, we present a cost-efficient NMR method to quantify the rotational dynamics of guanine amino groups in G-quadruplex nucleic acids. An isolated spectrum of amino protons from a specific tetrad-bound guanine can be extracted from the nuclear Overhauser effect spectroscopy spectrum based on the close proximity between the intra-residue imino and amino protons. We apply the method in different structural contexts of G-quadruplexes and their complexes. Our results highlight the role of stacking and hydrogen-bond interactions in restraining amino-group rotation. The measurement of the rotation rate of individual amino groups could give insight into the dynamic processes occurring at specific locations within G-quadruplex nucleic acids, providing valuable probes for local structure, dynamics, and ligand binding.

Impact of spin label rigidity on extent and accuracy of distance information from PRE data.

Paramagnetic relaxation enhancement (PRE) is a versatile tool for NMR spectroscopic structural and kinetic studies in biological macromolecules. Here, we compare the quality of PRE data derived from two spin labels with markedly different dynamic properties for large RNAs using the I-A riboswitch aptamer domain (78 nt) from Mesoplamsa florum as model system. We designed two I-A aptamer constructs that were spin-labeled by noncovalent hybridization of short spin-labeled oligomer fragments. As an example of a flexible spin label, UreidoU-TEMPO was incorporated into the 3' terminal end of helix P1 while, the recently developed rigid spin-label Çm was incorporated in the 5' terminal end of helix P1. We determined PRE rates obtained from aromatic 13C bound proton intensities and compared these rates to PREs derived from imino proton intensities in this sizeable RNA (~78 nt). PRE restraints derived from both imino and aromatic protons yielded similar data quality, and hence can both be reliably used for PRE determination. For NMR, the data quality derived from the rigid spin label Çm is slightly better than the data quality for the flexible UreidoTEMPO as judged by comparison of the structural agreement with the I-A aptamer crystal structure (3SKI).

NMR monitoring of the SELEX process to confirm enrichment of structured RNA

RNA aptamers are RNA molecules that bind to a target molecule with high affinity and specificity using uniquely-folded tertiary structures. RNA aptamers are selected from an RNA pool typically comprising up to 1015 different sequences generated by iterative steps of selection and amplification known as Systematic Evolution of Ligands by EXponential enrichment (SELEX). Over several rounds of SELEX, the diversity of the RNA pool decreases and the aptamers are enriched. Hence, monitoring of the enrichment of these RNA pools is critical for the successful selection of aptamers, and several methods for monitoring them have been developed. In this study, we measured one-dimensional imino proton NMR spectra of RNA pools during SELEX. The spectrum of the initial RNA pool indicates that the RNAs adopt tertiary structures. The structural diversity of the RNA pools was shown to depend highly on the design of the primer-binding sequence. Furthermore, we demonstrate that enrichment of RNA aptamers can be monitored using NMR. The RNA pools can be recovered from the NMR tube after measurement of NMR spectra. We also can monitor target binding in the NMR tubes. Thus, we propose using NMR to monitor the enrichment of structured aptamers during the SELEX process.