Imatinib Research Articles

Proteomic Characterization Identifies Clinically Relevant Subgroups of Gastrointestinal Stromal Tumors

Gastrointestinal stromal tumor (GIST) is the most common mesenchymal tumor of the gastrointestinal tract, and it has high metastatic and recurrence rates. We aimed to characterize the proteomic features of GIST to understand biological processes and treatment vulnerabilities. Quantitative proteomics and phosphoproteomics analyses were performed on 193 patients with GIST to reveal the biological characteristics of GIST. Data-driven hypotheses were tested by performing functional experiments using both GIST cell lines and xenograft mouse models. Proteomic analysis revealed differences in the molecular features of GISTs from different locations or with different histological grades. MAPK7 was identified and functionally proved to be associated with tumor cell proliferation in GIST. Integrative analysis revealed that increased SQSTM1 expression inhibited the patient response to imatinib mesylate. Proteomics subtyping identified 4 clusters of tumors with different clinical and molecular attributes. Functional experiments confirmed the role of SRSF3 in promoting tumor cell proliferation and leading to poor prognosis. Our study provides a valuable data resource and highlights potential therapeutic approaches for GIST.

Fabrication, characterization and performance evaluation of an amplified electrochemical sensor based on MOFs nanocomposite for leukemia drug Imatinib determination

In this research, the synthesis, fabrication steps and characterization of a new modified glassy carbon electrode (GCE) with CuFe2O4 magnetic nanoparticles combined with zeolitic imidazolate framework (ZIF-8) embedded graphene quantum dots (GQDs), (CuFe2O4/ZIF-8@GQDs), for electrodetermination of the imatinib (IMB), anti-cancer drug, are reported. The synthesized nanocomposite was characterized using X-ray powder diffraction (XRD), energy dispersive X-ray spectroscopy (EDX) and field emission scanning electron microscopy (FE-SEM). The GCE modified with CuFe2O4/ZIF-8@GQDs nanocomposite shows high electrocatalytic activity toward the oxidation of IMB compared with the bare GCE, GQDs/GCE, ZIF-8@GQDs/GCE, CuFe2O4/GCE and CuFe2O4@GQDs/GCE. The resulted electrocatalytic activity of the CuFe2O4/ZIF-8@GQDs/GCE can be attributed to the synergistic effect of the outstanding magnetic, electrical properties of the CuFe2O4/ZIF-8@GQDs and high conductivity of GQDs, as well as the high electron transport rate of the nanocomposite. Under optimized conditions, the developed sensor, CuFe2O4/ZIF-8@GQDs/GCE, has static properties such as wide linear range responses (0.02–11.85 and 11.85–94.20 μM), low detection limit (1.2 nM), high sensitivity (5.655 μA μM−1), long-term signal stability and reproducibility (RSD = 2.23%). It should be noted that the CuFe2O4/ZIF-8@GQDs/GCE sensor could be used for determination of IMB in biological and pharmaceutical samples, indicating its feasibility for real analysis.

Unraveling the Mechanisms of Sensitivity to Anti-FGF Therapies in Imatinib-Resistant Gastrointestinal Stromal Tumors (GIST) Lacking Secondary KIT Mutations.

We showed previously that inhibition of KIT signaling in GISTs activates FGFR-signaling pathway rendering cancer cells resistant to receptor tyrosine kinase inhibitor (RTKi) imatinib mesylate (IM) (Gleevec) despite of absence of secondary KIT mutations and thereby illustrating a rationale for the combined (e.g., KIT- and FGFR-targeted) therapies. We show here that long-term culture of IM-resistant GISTs (GIST-R1) with IM substantially down-regulates KIT expression and induces activation of the FGFR-signaling cascade, evidenced by increased expression of total and phosphorylated forms of FGFR1 and 2, FGF-2, and FRS-2, the well-known adaptor protein of the FGF-signaling cascade. This resulted in activation of both AKT- and MAPK-signaling pathways shown on mRNA and protein levels, and rendered cancer cells highly sensitive to pan-FGFR-inhibitors (BGJ 398, AZD 4547, and TAS-120). Indeed, we observed a significant decrease of IC50 values for BGJ 398 in the GIST subclone (GIST-R2) derived from GIST-R1 cells continuously treated with IM for up to 12 months. An increased sensitivity of GIST-R2 cells to FGFR inhibition was also revealed on the xenograft models, illustrating a substantial (>70%) decrease in tumor size in BGJ 398-treated animals when treated with this pan-FGFR inhibitor. Similarly, an increased intra-tumoral apoptosis as detected by immunohistochemical (IHC)-staining for cleaved caspase-3 on day 5 of the treatment was found. As expected, both BGJ 398 and IM used alone lacked the pro-apoptotic and growth-inhibitory activities on GIST-R1 xenografts, thereby revealing their resistance to these TKis when used alone. Important, the knockdown of FGFR2, and, in much less content, FGF-2, abrogated BGJ 398's activity against GIST-R2 cells both in vitro and in vivo, thereby illustrating the FGF-2/FGFR2-signaling axis in IM-resistant GISTs as a primary molecular target for this RTKi. Collectively, our data illustrates that continuous inhibition of KIT signaling in IM-resistant GISTs lacking secondary KIT mutations induced clonal heterogeneity of GISTs and resulted in accumulation of cancer cells with overexpressed FGF-2 and FGFR1/2, thereby leading to activation of FGFR-signaling. This in turn rendered these cells extremely sensitive to the pan-FGFR inhibitors used in combination with IM, or even alone, and suggests a rationale to re-evaluate the effectiveness of FGFR-inhibitors in order to improve the second-line therapeutic strategies for selected subgroups of GIST patients (e.g., IM-resistant GISTs lacking secondary KIT mutations and exhibiting the activation of the FGFR-signaling pathway).

Mild traumatic brain injury induces pericyte detachment independent of stroke vulnerability

Mild traumatic brain injury (mTBI) is an independent risk factor for ischemic stroke and can result in poorer outcomes- an effect presumed to involve the cerebral vasculature. Here we tested the hypothesis that mTBI-induced pericyte detachment from the cerebrovascular endothelium is responsible for worsened stroke outcomes. We performed a mild closed-head injury and/or treated C57/bl6 mice with imatinib mesylate, a tyrosine kinase inhibitor that induces pericyte detachment. The time course of pericyte detachment was assessed 7, 14, and 28 days post injury (DPI). To test the role of pericytes in TBI-induced exacerbation of ischemic stroke outcomes, we induced mTBI and/or treated mice with imatinib for one week prior to transient middle cerebral artery occlusion. We found that injury promoted pericyte detachment from the vasculature commensurate with the levels of detachment seen in imatinib-only treated animals, and that the detachment persisted for at least 14DPI, but recovered to sham levels by 28DPI. Further, mTBI, but not imatinib-induced pericyte detachment, increased infarct volume. Thus, we conclude that the transient detachment of pericytes caused by mTBI may not be sufficient to exacerbate subsequent ischemic stroke damage. These data have important implications for understanding cerebrovascular dysfunction following mTBI and potential mechanisms of increased risk for future ischemic strokes.

A gist on an obscure neoplasm in Ghana: gastrointestinal stromal tumours

BackgroundGastrointestinal Stromal Tumour is a rare but potentially curable tumour of the gastrointestinal tract accounting for up to 1% of all gastrointestinal tumours. The discovery of Imatinib mesylate, a novel tyrosine kinase inhibitor has improved the chances even for unresectable, recurrent, or metastatic diseases.MethodsThis study sought to document the clinical and pathological characteristics of GISTs from two tertiary hospitals in Ghana that have undergone immunohistochemistry confirmation between 2014 and 2021.ResultsThe median age of the subjects was 50 years with most of them (28.0%) being above 61 years. There were more females than males (64.0% vs. 36.0%). Abdominal mass and abdominal pain made up the majority of the clinical presentations. The majority of the subjects had partial gastrectomy (32.0%) which was followed by wedge resection (28.0%). Appendectomy and sleeve gastrectomy were the least performed procedures (8% each). Four of the 25 patients (16.0%) had resections of involved contiguous organs done with splenectomy being the most common procedure. The majority of GISTs were found in the stomach (68.0%) followed by the appendix (12.0%) and small bowel (12.0%). Gastrointestinal bleeding (55.8%) and abdominal pain (38.5%) were the most reported symptoms. Free resection margins were observed in 84.0% of the subjects and only 3/25 (12.0%) experienced tumour recurrence.ConclusionGIST is a potentially curable tumour that once was obscure but currently gaining popularity. Surgical resection offers the hope of a cure for localized disease while targeted therapies is a viable option for recurrent, metastatic, or unresectable tumours.

Asciminib (ASC) in Combination with Imatinib (IMA), Nilotinib (NIL), or Dasatinib (DAS) May be a Potential Treatment (Tx) Option in Patients (Pts) with Philadelphia Chromosome-Positive Chronic Myeloid Leukemia in Chronic Phase or Accelerated Phase (Ph+ CML-CP/AP): Final Results from the Asciminib Phase 1 Study

Asciminib (ASC) in Combination with Imatinib (IMA), Nilotinib (NIL), or Dasatinib (DAS) May be a Potential Treatment (Tx) Option in Patients (Pts) with Philadelphia Chromosome-Positive Chronic Myeloid Leukemia in Chronic Phase or Accelerated Phase (Ph+ CML-CP/AP): Final Results from the Asciminib Phase 1 Study

The Use of 2 nd Generation TKIs As First Line Therapy Does Not Prevent CML Related Deaths: Results of an Italian CML Campus Prospective Study in 1277 Patients Treated First Line with Imatinib or 2 nd Generation TKIs

Background: In the last decades prognosis and survival of chronic myeloid leukemia (CML) patients have dramatically improved, thanks to a wider therapeutic armamentarium. Molecular responses are the milestones that guide clinical decisions; however, some information is still lacking and what we know derives mainly from investigational trials: it is still unclear if real-life management could lead to comparable results. For this reason, a prospective observational study was conducted by a CML Italian network to analyze molecular responses in a real-life setting. Methods: A web-based database (www.epiclin.it/lmc) was used to collect clinical and biological data on newly diagnosed CML prospective consecutive patients enrolled in 24 Italian Hematology Centers from January 2013 onwards. Patients were treated according to the policy of the center and the molecular data were obtained by performing tests in accordance with the IS% parameters. Results: A total of 1277 patients were enrolled (Tab. 1) with a median follow up of 4,1 years. There was a significant difference in the median age of patients who started with imatinib (IMA) or 2 nd gen TKIs (II-TKI): 70 vs 52, respectively. The Overall Survival (OS) of the whole cohort at 5 years was 80% for the IMA and 94% for II-TKI treated patients respectively. Out of the total 86 deaths observed in the IMA treated cohort only 11 (12.7%) were due to CML related causes, whereas out of the 32 deaths observed in the II-TKI treated cohort 12 (37.5%) were due to CML. Out of the 607 patients who were on first line IMA, 422/607 (69%) did not switch therapy and have an OS of 81% at 5 years. One hundred and eighty-five out of 607 (31%) changed therapy and showed an OS of 80% at 5 years. Out of 670 patients who started with II-TKI, 492 (73%) continued the same treatment and 178/670 (27%) changed therapy, showing a 5-year OS of 96% and 89%, respectively. In summary, patients who remain in the same type of therapy in which they were initially started show a 5-year OS of 81% and 96% for IMA and II-TKI respectively and only 9 of the total 73 deaths observed in this group of 914 patients were CML related (8 of 58 II-TKI treated patients). Patients who switched to another therapy showed 80% and 89% 5-year OS on IMA and II-TKI group, respectively. Of the 45 deaths observed in this group of 363 patients, 14 were CML related (3 on IMA and 11 on II-TKI) (Tab. 2). In IMA treated patients, 5-year OS according to 6- and 12-months molecular response was worse for patients with BCR::ABL1 >1% compared to those with values between 1 and 0.1% and <0.1% BCR::ABL1 patients (looking at 12 months response, OS was 65% vs 85% vs 90%, Fig. 1A). At 24 months there was a statistical difference in OS between patients with BCR::ABL1 between 1 and 0.1% versus those <0.1% (OS at 3 years was 82% vs 92%) (Fig. 1B). Among II-TKI treated patients, no significant differences in OS were observed, but there was only a generic trend for those with deeper molecular responses between patients with BCR::ABL1 >0.1 versus patients with BCR::ABL1 < 0.1% at all timepoints; to note, the deaths are few and were observed within the first year, independently from the molecular response achieved: at 6 months, 10 deaths on 113 patients of which 7 CML related; at 12 months, 5 deaths on 48 patients of which 4 CML related. Row comparisons of OS were confirmed with multivariable Cox models including main prognostic factors. Conclusions: The real-life data collected by this observational study support the good prognosis of CML patients obtained in our days independently by the TKI used in first line. Indeed, most of the deaths observed are due to CML unrelated causes and the use of II-TKIs does not seem to prevent the CML related deaths, whose number is similar in both cohorts. The fact that the OS is similar in those who remain in IMA therapy versus to those who switch could also simply reflect the presence of unfavorable prognostic factors at diagnosis not controlled by IMA nor by II-TKIs. In this scenario, the observation that the achievement of <1% at 12 months and of MMR at 24 months in patients treated with imatinib is endowed with a statistically significant better OS could simply represent an association rather than a determining factor. Early NGS study would probably provide helpful information at this regard and for identifying patients that, even if treated first line with II-TKIs, could benefit of an early switch, since 11 of the 12 progressions were observed in this group.

The Dermatofibrosarcoma Protuberans In A 13-Year-Old: A Rare Case Of Soft Tissue Sarcoma Of The Skin

Introduction and importance: Dermatofibrosarcoma protuberans (DFSP) is a rare soft tissue sarcoma that primarily affects middle-aged adults but can also occur in children. Despite its low metastatic potential, DFSP displays aggressive local behavior and a high rate of local recurrence. Diagnosis in children can be delayed due to confusion with other skin conditions. This case report aims to discuss the case management of dermatofibrosarcoma protuberans in a 13 year old female. Presentation of case: A 13-year-old female patient presented with a progressively enlarging lump on the left eyelid, initially resembling small brown spots that coalesced over 7 months. Intermittent bleeding and pain were reported. Physical examination revealed a dark brown mass in the left frontotemporal region, with solid, non-fragile characteristics. Clinical diagnosis suggested a suspicious malignant skin tumor, confirmed as basal cell carcinoma. Treatment involved wide excision and flap reconstruction. Post-operative care included infusion, antibiotic injection, and pain management. The patient's prognosis was favorable, though functional impairment was possible. Follow-up revealed histopathological findings of pigmented dermatofibrosarcoma protuberans. Discussion: DFSP is a rare but significant malignancy that poses diagnostic challenges due to its varied clinical presentations and histopathological features. While primarily affecting young to middle-aged individuals, it can also manifest in pediatric populations. Diagnosis typically involves histopathological assessment, confirming characteristic spindle cell proliferation with CD34 expression. Surgical excision remains the cornerstone of treatment, complemented by adjuvant therapies like imatinib mesylate or radiation in select cases. Regular surveillance, comprising frequent evaluations in the initial post-excision period followed by yearly monitoring, is imperative for detecting any recurrence or metastasis promptly. Conclusions: The structured approach in DFSP ensures optimal patient management and outcomes. Surgical management with Wide local excision (WLE) or Mohs micrographic surgery (MMS) is the gold standard in the treatment of DFSP.

A conserved ZFX/WNT3 axis modulates the growth and imatinib response of chronic myeloid leukemia stem/progenitor cells

BackgroundZinc finger protein X-linked (ZFX) has been shown to promote the growth of tumor cells, including leukemic cells. However, the role of ZFX in the growth and drug response of chronic myeloid leukemia (CML) stem/progenitor cells remains unclear.MethodsReal-time quantitative PCR (RT–qPCR) and immunofluorescence were used to analyze the expression of ZFX and WNT3 in CML CD34+ cells compared with normal control cells. Short hairpin RNAs (shRNAs) and clustered regularly interspaced short palindromic repeats/dead CRISPR-associated protein 9 (CRISPR/dCas9) technologies were used to study the role of ZFX in growth and drug response of CML cells. Microarray data were generated to compare ZFX-silenced CML CD34+ cells with their controls. Chromatin immunoprecipitation (ChIP) and luciferase reporter assays were performed to study the molecular mechanisms of ZFX to regulate WNT3 expression. RT–qPCR and western blotting were used to study the effect of ZFX on β-catenin signaling.ResultsWe showed that ZFX expression was significantly higher in CML CD34+ cells than in control cells. Overexpression and gene silencing experiments indicated that ZFX promoted the in vitro growth of CML cells, conferred imatinib mesylate (IM) resistance to these cells, and enhanced BCR/ABL-induced malignant transformation. Microarray data and subsequent validation revealed that WNT3 transcription was conservatively regulated by ZFX. WNT3 was highly expressed in CML CD34+ cells, and WNT3 regulated the growth and IM response of these cells similarly to ZFX. Moreover, WNT3 overexpression partially rescued ZFX silencing-induced growth inhibition and IM hypersensitivity. ZFX silencing decreased WNT3/β-catenin signaling, including c-MYC and CCND1 expression.ConclusionThe present study identified a novel ZFX/WNT3 axis that modulates the growth and IM response of CML stem/progenitor cells.

Identification of multivariable microRNA and clinical biomarker panels to predict imatinib response in chronic myeloid leukemia at diagnosis.

Imatinib Mesylate (imatinib) was once hailed as the magic bullet for chronic myeloid leukemia (CML) and remains a front-line therapy for CML to this day alongside other tyrosine kinase inhibitors (TKIs). However, TKI treatments are rarely curative and patients are often required to receive life-long treatment or otherwise risk relapse. Thus, there is a growing interest in identifying biomarkers in patients which can predict TKI response upon diagnosis. In this study, we analyze clinical data and differentially expressed miRNAs in CD34+ CML cells from 80 patients at diagnosis who were later classified as imatinib-responders or imatinib-nonresponders. A Cox Proportional Hazard (CoxPH) analysis identified 16 miRNAs that were associated with imatinib nonresponse and differentially expressed in these patients. We also trained a machine learning model with different combinations of the 16 miRNAs with and without clinical parameters and identified a panel with high predictive performance based on area-under-curve values of receiver-operating-characteristic and precision-recall curves. Interestingly, the multivariable panel consisting of both miRNAs and clinical features performed better than either miRNA or clinical panels alone. Thus, our findings may inform future studies on predictive biomarkers and serve as a tool to develop more optimized treatment plans for CML patients in the clinic.

Developing an exclusive sensor based on molecularly imprinted polymer/Multi-walled carbon nanotubes/Fe3O4@Au nanocomposite for the selective determination of an anti-cancer drug imatinib

Determination of pharmaceuticals especially anticancer drugs is one of the important issues in environmental and medical investigation and creating good information about human health. The presence sturdy introducing an electroanalytical sensor based on molecularly imprinted polymer (MIP)/Multi-walled carbon nanotubes (MWCNTs)/Au@Fe3O4 nanoparticles modified carbon paste electrode (PE) to determine imatinib (IMA). The MIP/MWCNTs/Au@Fe3O4/PE showed catalytic activity and also a sensitive strategy to sensing IMA in the concentration range 1–1000 μM with a limit of detection of 0.013 μM. The MIP/MWCNTs/Au@Fe3O4/PE has shown interesting results in the analysis of IMA in real samples, and the interference investigations results show the high selectivity of the MIP/MWCNTs/Au@Fe3O4/PE in the monitoring of IMA in complex fluids such as tablet and blood serum and results approved by F-test and t-test as statistical methods.

Atypical presentation of chronic myeloid leukemia with e13a2 BCR-ABL1 fusion transcript in a young male

Chronic myeloid leukemia (CML) is usually a disease of the elderly population characterized by a clonal hematopoietic progenitor cell disorder propelled by the product of the breakpoint cluster region-Abelson murine leukemia (BCR-ABL) chimeric gene, known as the Philadelphia chromosome. It occurs due to a balanced reciprocal translocation between the long arms of chromosomes 9 and 22, which codes for tyrosine kinase. The incidence of CML increases with age, and the median age of diagnosis in Western countries is 64 years. The most common finding at presentation is abdominal pain due to splenomegaly which is present in about half of the patients. We present a rare case of CML in the chronic phase where a young 23-year-old male presented with complaints of severe bilateral lower limb bone pain restricting mobility at the hip joint for 1 year. The upper end of the femur showed heterogeneous areas of bone infarct on the technetium 99 m-methylene diphosphonate bone scan. He was treated with imatinib mesylate, and he entered remission within 5 months of starting therapy. This case highlights the atypical presentation of the chronic phase of CML with the e13a2 BCR-ABL fusion transcript in a young patient and the complete recovery achieved with standard therapy.

Uveitis – A side effect of imatinib mesylate

Imatinib mesylate, a BCR-ABL tyrosine kinase inhibitor, is widely used in the management of chronic myeloid leukemia (CML). Although there are a few studies documenting ocular side effects of imatinib, there have been no reports of uveitis caused by imatinib in the literature. We present a case of imatinib-induced uveitis, in which a young male with CML developed bilateral pan-uveitis and cystoid macular edema as a side effect of imatinib. The ocular adverse effects were completely resolved upon withdrawal of drug. To the best of our knowledge, this might be one of the first cases of such kind.

High BCR::ABL1 Expression Defines CD34+ Cells with Significant Alterations in Signal Transduction, Short-Proliferative Potential and Self-Renewal Ability.

Chronic Myeloid Leukemia (CML) is a clonal disorder of the hematopoietic stem cell caused by expression of the BCR::ABL1 oncoprotein. High BCR::ABL1 levels have been associated to proliferative advantage of leukemic cells, blast crisis progression and tyrosine kinase inhibitors (TKIs) inefficacy. We have previously shown that high BCR::ABL1/GUSIS transcripts measured at diagnosis are associated with inferior responses to standard dose Imatinib (IM). However, the mechanisms underlying the higher rates of disease progression and development of TKIs resistance dependent on elevated BCR::ABL1 levels remain unclear. Leukemic cells were collected from CML patients showing, at diagnosis, high or low BCR::ABL1/GUSIS. BCR::ABL1 expression levels were measured using real-time PCR. Short-term culture and long-term culture-initiating cells assays were employed to investigate the role of BCR::ABL1 gene-expression levels on proliferation, clonogenicity, signal transduction, TKIs responsiveness and self-renewal ability. Cell division was performed by carboxyfluorescein-succinimidyl ester (CFSE) assay. We found that BCR::ABL1 oncogene expression levels correlate in both PMNs and CD34+ cells. Furthermore, high oncogene levels increased both proliferation and anti-apoptotic signaling via ERK and AKT phosphorylation. Moreover, high BCR::ABL1 expression reduced the clonogenicity of leukemic CD34+ cells and increased their sensitivity to high doses IM but not to those of dasatinib. Furthermore, we observed that high BCR::ABL1 levels are associated with a reduced self-renewal of primitive leukemic cells and, also, that these cells showed comparable TKIs responsiveness with cells expressing lower BCR::ABL1 levels. Interestingly, we found a direct correlation between high BCR::ABL1 levels and reduced number of quiescent leukemic cells caused by increasing their cycling. Higher BCR::ABL1 levels improving the proliferation, anti-apoptotic signaling and reducing self-renewal properties cause an increased expansion of leukemic clone.

ASXL1 MUTATION ANALYSIS IN CHRONIC MYELOID LEUKAEMIA PATIENTS

BackgroundIn recent years, additional sex comb-like 1 (ASXL1) gene mutations have recently been linked to several myeloid cancers.
 Objectives To characterize ASXL1 mutation prevalence, determine if these abnormalities might constitute a significant event in CML prognosis, and establish the correlations if these mutations are associated with CML transformation and/or imatinib (IM) resistance, Here we designed a study to investigate ASXL1 gene that is frequently mutated in myeloid malignancies and evaluated their occurrence in a well-defined group of CML patients.
 Patients and MethodsThe study population consists of 80 patients diagnosed with CML under treatment with TKI (Imatinib 400,600,800 mg/day and Nilotinib). Ten healthy subjects were checked as controls. Depending on their molecular and/or cytogenetic response, CML patients will either be classified into imatinib-resistant or imatinib-good responders. Then the DNA was extracted depending on the Salting-Out protocol. Then genome amplification was performed on exon 12 and in the HOT spot region for the detection of somatic mutations, using conventional PCR.
 ResultsNine out of 80 CML samples (11.25%) were determined to have mutations with the ASXL1 gene. We identified a novel Mutation (c.1808_1820delCCTCCTGCCGGGG S603Ffs*96) in one of the patients that has not been reported before. We also identified three other mutations (c.1933_1934del G p.G645Wfs*12, c.2047A>G p.T683A, c.1900_1922 delAGAGAGGCGGCCACCACTGCCAT E635Rfs*15).
 ConclusionOur discovery of an ASXL1 mutation, a potential tumour suppressor gene, is a significant genetic aberration in CML. Our findings suggest that ASXL1 mutations are common in patients with late stages of the disease and imatinib therapy resistance.

Vitiligo-like lesions following imatinib mesylate therapy: a case series and review of literature

Imatinib mesylate (IM), a tyrosine kinase inhibitor, has become a standard of care for the management of chronic myeloid leukemia. The safety profile of IM is favorable; however, few adverse effects such as gastrointestinal disturbances, fluid retention, skin rashes, and myelosuppression have been reported. Hypopigmentation of the skin is a rare adverse effect of IM. In this report, we describe two cases of chronic myeloid leukemia who developed skin hypopigmentation while on IM.

Some 2-[4-(1H-benzimidazol-1-yl) phenyl]-1H-benzimidazole derivatives overcome imatinib resistance by induction of apoptosis and reduction of P-glycoprotein activity.

Imatinib (IMA) is a tyrosine kinase inhibitor (TKI) introduced for the chronic myeloid leukemia (CML) therapy. Emergence of IMA resistance leads to the relapse and failure in CML therapy. Benzimidazole is a heterocyclic organic compound which is widely investigated for the development of anticancer drugs. In this study, we aimed to explore the anticancer effects of some 2-[4-(1H-benzimidazol-1-yl) phenyl]-1H-benzimidazole derivatives on K562S (IMA-sensitive) and K562R (IMA-resistant) cells. To analyze the cytotoxic and apoptotic effects of the compounds, K562S, K562R, and L929 cells were exposed to increasing concentrations of the derivatives. Cytotoxic effects of compounds on cell viability were analyzed with MTT assay. Apoptosis induction, caspase3/7 activity were investigated with flow cytometry and BAX, BIM, and BAD genes expression levels were analyzed with qRT-PCR. Rhodamine123 (Rho-123) staining assays were carried out to evaluate the effect of compounds on P-glycoprotein (P-gp) activity. The hit compounds were screened using molecular docking, and the binding preference of each compounds to BCR-ABL protein was evaluated. Our results indicated that compounds triggered cytotoxicity, caspase3/7 activation in K562S and K562R cells. Rho-123 staining showed that compounds inhibited P-gp activity in K562R cells. Overall, our results reveal some benzimidazole derivatives as potential anticancer agents to overcome IMA resistance in CML.

Analysis of the Inhibitory Effect of hsa-miR-145-5p and hsa-miR-203a-5p on Imatinib-Resistant K562 Cells by GC/MS Metabolomics Method.

Imatinib (IM) resistance is considered to be a significant challenge in the management of chronic myeloid leukemia (CML). Previous studies have reported that hsa-miR-145-5p and hsa-miR-203a-5p can overcome IM resistance and hsa-miR-203a-5p can alter glutathione metabolism in IM-resistant cells. The purpose of this study was to examine whether hsa-miR-145-5p or hsa-miR-203a-5p counters IM resistance by targeting the overall metabolic profile of IM-resistant K562 cells. The metablic profiling of cell lysates obtained from IM-sensitive, IM-resistant, and miR-transfected IM-resistant K562 cells was carried out using the GC-MS technique. Overall, 75 major metabolites were detected, of which 32 were present in all samples. The pathway analysis of MetaboAnalyst 5.0 revealed that the majorly enriched pathways included glucose metabolism, fatty acid biosynthesis, lipogenesis, and nucleotide metabolism. Eleven of identified metabolites, l-glutamine, l-glutamic acid, l-lactic acid, phosphoric acid, 9,12-octadecadienoic acid, 9-octadecenoic acid, myristic acid, palmitic acid, cholesterol, and β-alanine, appeared in enriched pathways. IM-resistant cells had comparatively higher concentrations of all of these metabolites. Notably, the introduction of hsa-miR-145-5p or hsa-miR-203a-5p into resistant cells resulted in a decrease in levels of these metabolites. The efficacy of miR-203a-5p was particularly remarkable in comparison with miR-145-5p, as evidenced by partial least-squares-discriminant analysis (PLS-DA), which showed a high level of similarity in metabolic profile between IM-sensitive K562 cells and IM-resistant cells transfected with hsa-miR-203a-5p. The results indicate that GC-MS-based metabolic profiling has the potential to distinguish between drug-resistant and -sensitive cells. This approach can also be used to routinely monitor therapeutic response in drug-resistant patients, thus, enabling personalized therapy.

Injectable Gamboge-Based In Situ Gel for Sustained Delivery of Imatinib Mesylate.

The aim of this study was to prepare and characterize the imatinib mesylate (IM)-loaded gamboge-based ISG system for local administration of an anticancer agent against colorectal carcinoma. The ISG formulations were prepared in dimethyl sulfoxide (DMSO) and N-methyl-2-pyrrolidone (NMP). The physicochemical properties, drug release profile, and cytotoxicity of the developed formulations were assessed. The developed ISG demonstrated Newtonian flow behavior with acceptable rheological and mechanical properties. The viscosity of the developed ISG, measured at less than 80 cP, and the applied forces of less than 50 N·mm, indicated easy administration using clinical injection techniques. Upon contact with an aqueous phase, the ISG immediately formed a porous cross-sectional structure, enabling sustained release of IM over 14 days. The release profile of IM was fitted to the quasi-Fickian diffusion mechanism, and the release rate could be controlled by the types of solvent and the amount of IM content. The developed IM-loaded gamboge ISG effectively inhibited colorectal cancer cells, including HCT116 and HT29 cell lines, with less than 20% cell viability observed at a concentration of 1% w/w IM after 2 days of incubation. This suggests that the developed ISG may potentially serve as an injectable system for localized anticancer delivery against colorectal cells, potentially reducing the side effects of systemic chemotherapy and improving patient adherence.

Cost Evaluation Analysis of Genetic Testing and Tailored Adjuvant Imatinib in Patients With Resected High-Risk GI Stromal Tumors: The Brazilian Perspective.

Mutations of the KIT gene are the molecular hallmark of most GI stromal tumors (GISTs). Imatinib has revolutionized GIST treatment. Adjuvant imatinib for 3 years is the standard of care for high-risk resected GIST. However, the GIST molecular biologic profile has found different responses to this approach. Despite this, genetic testing at diagnosis is not a routine and empirical adjuvant imatinib remains the rule. Barriers to genetic profiling include concerns about the cost and utility of testing. This analysis aims to determine whether targeted genetic testing reduces costs as an ancillary tool for a limited-resource scenario instead of adjuvant empirical imatinib in patients with resected high-risk GIST. The cost evaluation analysis of molecular testing for GIST was based on the Cost of Preventing an Event (COPE), considering the Number Needed to Treat and the costs of each test compared with the cost of 3-year empirical adjuvant imatinib and real treatment costs (median number of cycles) from the public and private Brazilian Healthcare System's perspective. The analysis compared the costs of the molecular tests (broad next-generation sequencing [NGS], GS Infinity DNA/RNA assay, and targeted NGS: GS Focus GIST and the Fleury GIST Tumor DNA sequencing panel), costs of drug acquisition, considering discounts (imatinib mesylate and Glivec), and the costs of supportive care. In both scenarios, public and private, regardless of the use of imatinib or Glivec, tailoring adjuvant treatment reduced costs, irrespective of the number of cycles. The only exception was the combination of the broad NGS test and imatinib in the Public Healthcare System. The molecularly tailored adjuvant imatinib reduced costs considering the COPE of available NGS tests for both the public and private Brazilian health care systems.