Cell IL-2 Production Research Articles

Influence of graphene oxide nanoparticles on functional activity of Jurkat cell line

Graphene oxide offers properties that make it a promising material for numerous biomedical applications, including various cancer treatment methods. Nanomaterials may overcome certain limitations of conventional chemotherapy. In cancer research, cell lines like Jurkat (T cell acute lymphoblastic leukemia cells) serve as models for investigating tumor treatment strategies. Previous studies have explored the effect of pegylated graphene oxide nanoparticles on some parameters of Jurkat cells, such as metabolism and apoptosis. This study aims to investigate how pegylated graphene oxide nanoparticles, varying in size, surface functionalization, and concentration, influence the functional activity of Jurkat cells, including cell viability, IL-2 production, and CD69 expression, both spontaneously, and following external activation. Jurkat cells were cultured with different types of graphene oxide nanoparticles (100-200 nm and 1-5 ìm; functionalized with linear and branched polyethylene glycol (PEG)) at concentrations of 5 ìg/ mL and 25 ìg/ mL for 24 hours. For assessment of cell parameters under stimulation with different types of particles, phytohemagglutinin (PHA, 50 ìg/mL) was used. Subsequently, the cells were stained with Zombie Aqua and CD69-APC antibody, followed by flow cytometry analysis (CytoFlex S) to determine the percentage of viable cells and CD69-expressing cells. The presence of IL-2 in cell culture supernatants was quantified using ELISA tests. It was observed that nanoparticles at low concentrations did not induce cytotoxic effects; cell viability improved after PHA stimulation. Small particles (100-200 nm) coated with linear PEG induced IL-2 production and CD69 expression. However, 1-5 ìm graphene oxide modified with branched PEG at a concentration of 25 ìg/mL led to a decrease in CD69 expression following PHA-stimulation. It was shown for the first time that pegylated graphene oxide nanoparticles affect the functional activity of Jurkat cells. The influence of particles is dependent on the size, concentration, surface functionalization of graphene oxide, and activation by PHA.

Long-term monocyte activation after coronary artery bypass grafting: An exploratory prospective observational study

Major surgery such as coronary artery bypass grafting (CABG) is associated with an increased post-operative risk of atherosclerotic cardiovascular events. Cells of the innate immune system can adopt a long-lasting pro-inflammatory and atherogenic phenotype after brief exposure to exogenous or endogenous inflammatory stimuli, a process called “trained immunity”. We hypothesized that the surgery-induced inflammation leads to sustained alterations in monocyte function, which promote the subsequent occurrence of cardiovascular events. Blood from 13 patients undergoing elective CABG was obtained before, 3–7 days (median 4) after, and 6–8 weeks (median 6) weeks after surgery. At 3–7 days postoperatively, circulating C-reactive protein (CRP) concentration, leukocyte counts and ex vivo Peripheral Blood Mononuclear Cell (PBMC) IL-6, TNFα and IL-1Ra production after stimulation (with various inflammatory stimuli) were significantly increased. Simultaneously, there was a reduction in monocyte HLA-DR expression. 6–8 weeks after CABG there was an ongoing systemic pro-inflammatory state with higher CRP concentrations, increased stimulated ex vivo PBMC IL-6 production, changes in monocytes subsets, and a higher expression of CCR2 on monocytes compared to baseline. In conclusion, CABG induces a persistent systemic inflammatory reaction with a sustained activated monocyte phenotype. This might contribute to the increased atherosclerotic cardiovascular event risk observed in cardiac surgery patients.

Localized ablative immunotherapy enhances antitumor immunity by modulating the transcriptome of tumor-infiltrating Gamma delta T cells

Gamma delta T cells (γδT cells) play crucial roles in the immune response against tumors, yet their functional dynamics under different cancer therapies remain poorly understood. Laser Ablative Immunotherapy (LAIT) is a novel cancer treatment modality combining local photothermal therapy (PTT) and intratumoral injection of an immunostimulant, N-dihydrogalactochitosan (glycated chitosan, GC). LAIT has been shown to induce systemic antitumor immune responses in pre-clinical studies and clinical trials, eradicating both treated local tumors and untreated distant metastases. In this study, we used LAIT to treat breast tumors in a mouse model and investigated the effects of LAIT on tumor-infiltrating γδT cells using single-cell RNA sequencing (scRNAseq). We characterized the γδT cells from tumors in control, PTT, GC, and LAIT (PTT + GC) groups, by identifying six distinct subtypes: activated, cytotoxic, cycling cytotoxic, IFN-enriched, antigen-presenting, and IL17-producing γδT cells. Differential gene expression analysis revealed that LAIT significantly upregulated genes associated with T cell activation, leukocyte adhesion, and interferon signaling in treated tumor tissues while downregulating genes involved in protein folding and stress responses. LAIT also uniquely increased the proportion of IL17-producing γδT cells, which correlated with prolonged survival in breast cancer patients, as analyzed using TCGA data. Furthermore, the transcriptomic profiles of γδT cells in LAIT-treated tumors closely resembled those in immune checkpoint inhibitor (ICI)-treated patients, suggesting potential synergistic effects. Our findings indicate that LAIT modulates the γδT cell transcriptome, enhancing their antitumor capabilities and providing a basis for combining LAIT with ICI therapy to improve cancer treatment outcomes.

The iNKT cell ligand α-GalCer prevents murine septic shock by inducing IL10-producing iNKT and B cells.

α-galactosylceramide (α-GalCer), a prototypical agonist of invariant natural killer T (iNKT) cells, stimulates iNKT cells to produce various cytokines such as IFNγ and IL4. Moreover, repeated α-GalCer treatment can cause protective or pathogenic outcomes in various immune-mediated diseases. However, the precise role of α-GalCer-activated iNKT cells in sepsis development remains unclear. To address this issue, we employed a lipopolysaccharide (LPS)/D-galactosamine (D-GalN)-induced murine sepsis model and two alternative models. Sepsis was induced in wild-type (WT) C57BL/6 (B6) mice by three methods (LPS/D-GalN, α-GalCer/D-GalN, and cecal slurry), and these mice were monitored for survival rates. WT B6 mice were intraperitoneally injected with α-GalCer or OCH (an IL4-biased α-GalCer analog) one week prior to the induction of sepsis. To investigate the effects of α-GalCer-mediated iNKT cell activation on sepsis development, immune responses were analyzed by flow cytometry using splenocytes and liver-infiltrating leukocytes. In addition, a STAT6 inhibitor (AS1517499) and an IL10 inhibitor (AS101) were employed to evaluate the involvement of IL4 or IL10 signaling. Furthermore, we performed B cell adoptive transfers to examine the contribution of α-GalCer-induced regulatory B (Breg) cell populations in sepsis protection. In vivo α-GalCer pretreatment polarized iNKT cells towards IL4- and IL10-producing phenotypes, significantly attenuating LPS/D-GalN-induced septic lethality in WT B6 mice. Furthermore, α-GalCer pretreatment reduced the infiltration of immune cells to the liver and attenuated pro-inflammatory cytokine production. Treatment with a STAT6 inhibitor was unable to modulate disease progression, indicating that IL4 signaling did not significantly affect iNKT cell-mediated protection against sepsis. This finding was confirmed by pretreatment with OCH, which did not alter sepsis outcomes. However, interestingly, prophylactic effects of α-GalCer on sepsis were significantly suppressed by treatment with an IL10 antagonist, suggesting induction of IL10-dependent anti-inflammatory responses. In addition to IL10-producing iNKT cells, IL10-producing B cell populations were significantly increased after α-GalCer pretreatment. Overall, our results identify α-GalCer-mediated induction of IL10 by iNKT and B cells as a promising option for controlling the pathogenesis of postoperative sepsis.

Associating structural characteristics to immunomodulating properties of carrot rhamnogalacturonan-I fractions

Carrot rhamnogalacturonan-I (cRG-I) is a polydisperse polysaccharide with molecular weights of 7–250 kDa. Using size exclusion chromatography cRG-I was fractionated and pooled in fractions (PF1–6). All fractions contained the same RG-I monosaccharides and similar glycosidic linkages although in varying relative amounts. The main differences were in rhamnose substitution, arabinan- and galactan side chain length and in levels of acetylation and methyl esterification. Atomic force microscopy showed either spheric or elongated structures for cRG-I and its derived fractions. To gain insight in the structure-function relationship of cRG-I, the immunomodulatory effect of the six fractions and their saponified derivatives was assessed in vitro. All fractions, except PF2, dose-dependently stimulated TNFα, IL-6, IL-1β, IL-8 and IL-10 production in peripheral blood mononuclear cells (PBMCs) of three healthy donors. Cytokine levels were largely influenced by the Mw and degree of esterification of the individual fractions. Notably, the highest Mw fraction (100 kDa) displayed the most potent activity, which was strongly reduced after the removal of ester residues by saponification. In contrast, the 75 kDa Mw population (PF2) proved inactive while its saponified counterpart exhibited substantial immunomodulatory activity. This confirmed the role of ester residues on the immune profile of RG-I subpopulations.

HBHA induces IL-10 from CD4+ T cells in patients with active tuberculosis but IFN-γ and IL-17 from individuals with Mycobacterium tuberculosis infection.

To effectively control tuberculosis (TB), it is crucial to distinguish between active TB disease and latent TB infection (LTBI) to provide appropriate treatment. However, no such tests are currently available. Immune responses associated with active TB and LTBI are dynamic and exhibit distinct patterns. Comparing these differences is crucial for developing new diagnostic methods and understanding the etiology of TB. This study aimed to investigate the relationship between pro- and anti-inflammatory CD4+ cytokine production following stimulation with two types of latency-associated Mycobacterium tuberculosis (M.tb) antigens to allow differentiation between active TB and LTBI. Cryopreserved PBMCs from patients with active TB disease or LTBI were stimulated overnight with replication-related antigen [ESAT-6/CFP-10 (E/C)] or two latency-associated antigens [heparin-binding hemagglutinin (HBHA) and alpha-crystallin-like protein (Acr)]. Responses were analyzed using multiparameter flow cytometry: active TB disease (n=15), LTBI (n=15) and ELISA: active TB disease (n=26) or LTBI (n=27). CD4+ central memory T cells (Tcm) specific to E/C and CD4+ effector memory T cells specific to Acr and HBHA were higher in LTBI than in TB patients. IFN-γ+Tcm and IL-17+ Tem cells was higher in the LTBI group (p= 0.012 and p=0.029 respectively), but IL-10+ Tcm was higher in the active TB group (p= 0.029) following HBHA stimulation. Additionally, following stimulation with HBHA, IL-10 production from CD4+ T cells was significantly elevated in patients with active TB compared to those with LTBI (p= 0.0038), while CD4+ T cell production of IL-17 and IFN-γ was significantly elevated in LTBI compared to active TB (p= 0.0076, p< 0.0001, respectively). HBHA also induced more CCR6+IL-17+CD4Tcells and IL-17+FoxP3+CD25+CD4Tcells in LTBI than in TB patients (P=0.026 and P=0.04, respectively). HBHA also induced higher levels of IFN-γ+IL-10+CD4+ T cells in patients with active TB (Pp=0.03) and higher levels of IFN-γ+IL-17+ CD4+ T cells in those with LTBI (p=0.04). HBHA-specific cytokine production measured using ELISA showed higher levels of IFN-γ in participants with LTBI (P=0.004) and higher levels of IL-10 in those with active TB (P=0.04). Stimulation with HBHA and measurement of CD4+ T cell production of IFN-γ, IL-10, and IL-17 could potentially differentiate active TB from LTBI. The characteristics of cytokine-expressing cells induced by HBHA also differed between participants with active TB and LTBI.

Dynamin 2-mediated endocytosis of BLT1 is required for IL-8 production in HMC-1 cells induced by Trichomonas vaginalis-derived secretory products.

We previously reported that leukotriene B4 (LTB4) contained in Trichomonas vaginalis-derived secretory products (TvSP) play an essential role in interleukin-8 (IL-8) production in human mast cell line (HMC-1 cells) via LTB4 receptor (BLT)-mediated Nuclear Factor-kappa B (NF-кB) activation. Dynamin, a GTPase, has been known to be involved in endocytosis of receptors for signaling of production of cytokine or chemokines. In the present study, we investigated the role of dynamin-mediated BLT1 endocytosis in TvSP-induced IL-8 production. When HMC-1 cells were transfected with BLT1 or BLT2 siRNA, TvSP-induced IL-8 production was significantly inhibited compared with that in cells transfected with control siRNA. In addition, pretreatment of HMC-1 cells with a dynamin inhibitor (Dynasore) reduced IL-8 production induced by TvSP or LTB4. TvSP- or LTB4- induced phosphorylation of NF-кB was also attenuated by pretreatment with Dynasore. After exposing HMC-1 cells to TvSP or LTB4, BLT1 was translocated from the intracellular compartments to the plasma membrane within 30 min. At 60 min after stimulation with TvSP or LTB4, BLT1 remigrated from the cell surface to intracellular areas. Pretreatment of HMC-1 cells with dynamin-2 siRNA blocked internalization of BLT1 induced by TvSP or LTB4. Co-immunoprecipitation experiments revealed that dynamin-2 strongly interacted with BLT1 60 min after stimulation with TvSP or LTB4. These results suggest that T. vaginalis-secreted LTB4 induces IL-8 production in HMC-1 cells via dynamin 2-mediated endocytosis of BLT1 and phosphorylation of NF-кB.

CysLT receptor-mediated NOX2 activation is required for IL-8 production in HMC-1 cells induced by Trichomonas vaginalis-derived secretory products.

Trichomoniasis is caused by a sexually transmitted flagellate protozoan parasite Trichomonas vaginalis. T. vaginalis-derived secretory products (TvSP) contain lipid mediators such as leukotriene B4 (LTB4) and various cysteinyl leukotrienes (CysLTs) which included LTC4, LTD4, and LTE4. However, the signaling mechanisms by which T. vaginalis-induced CysLTs stimulate interleukin (IL)-8 production in human mast cells remain unclear. In this study, we investigated these mechanisms in human mast cells (HMC-1). Stimulation with TvSP resulted in increased intracellular reactive oxygen species (ROS) generation and NADPH oxidase 2 (NOX2) activation compared to unstimulated cells. Pre-treatment with NOX2 inhibitors such as diphenyleneiodonium chloride (DPI) or apocynin significantly reduced ROS production in TvSP-stimulated HMC-1 cells. Additionally, TvSP stimulation increased NOX2 protein expression and the translocation of p47phox from the cytosol to the membrane. Pretreatment of HMC-1 cells with PI3K or PKC inhibitors reduced TvSP-induced p47phox translocation and ROS generation. Furthermore, NOX2 inhibitors or NOX2 siRNA prevented CREB phosphorylation and IL-8 gene expression or protein secretion induced by TvSP. Pretreatment with a CysLTR antagonist significantly inhibited TvSP-induced ROS production, CREB phosphorylation, and IL-8 production. These results indicate that CysLT-mediated activation of NOX2 plays a crucial role in ROS-dependent IL-8 production in human mast cells stimulated by T. vaginalis-secreted CysLTs. These findings enhance our understanding of the inflammatory response in trichomoniasis and may inform the development of targeted therapies to mitigate this response.

Grass pollen allergoids conjugated with mannan for subcutaneous and sublingual immunotherapy: a dose-finding study.

Polymerized allergoids conjugated with mannan represent a novel approach of allergen immunotherapy targeting dendritic cells. In this study, we aimed to determine the optimal dose of mannan-allergoid conjugates derived from grass pollen (Phleum pratense and Dactylis glomerata) administered via either the subcutaneous or sublingual route. A randomized, double-blind, placebo-controlled trial with a double-dummy design was conducted, involving 162 participants across 12 centers in Spain. Subjects were randomly allocated to one of nine different treatment groups, each receiving either placebo or active treatment at doses of 500, 1,000, 3,000, or 5,000 mTU/mL over four months. Each participant received five subcutaneous (SC) doses of 0.5 mL each, every 30 days, and a daily sublingual (SL) dose of 0.2 mL. Participants who received active treatment through SC, received placebo through SL. Participants who received active treatment through SL, received placebo SC. One Group, as control, received bot SC and SL placebo. The primary efficacy outcome was the improvement in titrated nasal provocation tests (NPT) at the end of the study compared to baseline. Secondary outcomes included specific antibody (IgG4, IgE) and cellular (IL-10 producing and regulatory T cell) responses. All adverse events and side reactions were recorded and assessed. Post-treatment, the active groups showed improvements in NPT ranging from 33% to 53%, with the highest doses showing the greatest improvements regardless of the administration route. In comparison, the placebo group showed a 12% improvement. Significant differences over placebo were observed at doses of 3,000 mTU/mL (p=0.049 for SL, p=0.015 for SC) and 5,000 mTU/mL (p=0.011 for SL, p=0.015 for SC). A dose-dependent increase in IgG4 was observed following SC administration, and an increase in IL-10 producing cells for both routes of administration. No serious systemic or local adverse reactions were recorded, and no adrenaline was required. Grass pollen immunotherapy with mannan-allergoid conjugates was found to be safe and efficacious in achieving the primary outcome, whether administered via the subcutaneous or sublingual routes, at doses of 3,000 and 5,000 mTU/mL. https://www.clinicaltrialsregister.eu/ctr-search (EudraCT), identifier 2014-005471-88; https://www.clinicaltrials.gov, identifier NCT02654223.

Antioxidant and Anti-Inflammatory Activities of the Extract and Bioaccessible Fraction of Mango Peel in Muffins.

Mango peel is a production waste and can cause environmental problems, but its nutritional value consists of bioactive compounds that could be beneficial for human health. The aim of this study is to determine the bioactive compounds, antioxidant and anti-inflammatory activities of mango peels and their use in muffins. The content of polyphenols, carotenoids and total phenols as well as the antioxidant activity of mango peel extract were evaluated. The anti-inflammatory activity of the extract was investigated using Caco-2 cell assay. The mango peel powder was then incorporated into muffin formulations. The sensory properties of these fortified muffins were evaluated. The total phenolic content, antioxidant activity and anti-inflammatory properties of the muffin extracts and their bioaccessible fractions were also analysed. The mango peel contained quercetin, phenolic compounds, α-carotene, β-carotene and lutein, which have antioxidant potential. In Caco-2 cells exposed to induced inflammation, the mango peel powder extract (γ=10, 50 and 100 µg/mL) attenuated the production of reactive oxygen species (ROS), tumour necrosis factor-alpha (TNF-α) and interleukin-8 (IL-8), while maintaining cell viability. Muffins supplemented with 5 % mango peel powder showed good sensory properties, but not as good as those of plain muffins without mango peel powder. The total phenolic content and antioxidant activities in both the extract and the bioaccessible fraction of the supplemented muffins were higher than those observed in the standard muffins. Moreover, the extract and bioaccessible fraction of the supplemented muffins resulted in a higher reduction of ROS, IL-8 and TNF-α production in Caco-2 cells than those obtained from the standard muffins. This study is the first to investigate the protective effects of mango peel and muffins supplemented with mango peel powder against IL-1β-induced oxidative damage in Caco-2 cells. The results confirm that both mango peel and the supplemented muffins inhibited the production of inflammatory markers, including ROS and cytokines. These findings suggest that mango peel could be a valuable component of functional food formulations including dietary supplements.

Distinct Effects of Respiratory Viral Infection Models on miR-149-5p, IL-6 and p63 Expression in BEAS-2B and A549 Epithelial Cells.

Respiratory viruses cause airway inflammation, resulting in epithelial injury and repair. miRNAs, including miR-149-5p, regulate different pathological conditions. We aimed to determine how miR-149-5p functions in regulating pro-inflammatory IL-6 and p63, key regulators of airway epithelial wound repair, in response to viral proteins in bronchial (BEAS-2B) and alveolar (A549) epithelial cells. BEAS-2B or A549 cells were incubated with poly (I:C, 0.5 µg/mL) for 48 h or SARS-CoV-2 spike protein-1 or 2 subunit (S1 or S2, 1 μg/mL) for 24 h. miR-149-5p was suppressed in BEAS-2B challenged with poly (I:C), correlating with IL-6 and p63 upregulation. miR-149-5p was down-regulated in A549 stimulated with poly (I:C); IL-6 expression increased, but p63 protein levels were undetectable. miR-149-5p remained unchanged in cells exposed to S1 or S2, while S1 transfection increased IL-6 expression in BEAS-2B cells. Ectopic over-expression of miR-149-5p in BEAS-2B cells suppressed IL-6 and p63 mRNA levels and inhibited poly (I:C)-induced IL-6 and p63 mRNA expressions. miR-149-5p directly suppressed IL-6 mRNA in BEAS-2B cells. Hence, BEAS-2B cells respond differently to poly (I:C), S1 or S2 compared to A549 cells. Thus, miR-149-5p dysregulation may be involved in poly (I:C)-stimulated but not S1- or S2-stimulated increased IL-6 production and p63 expression in BEAS-2B cells.

#1843 Deletion of IL17-producing follicular helper T cells restrains the germinal center reaction in systemic lupus erythematosus

Abstract Background and Aims Systemic lupus erythematosus (SLE) is an autoimmune disorder in which autoantibody formation can lead to severe kidney pathology. Interleukin (IL)17-producing T cells have been suggested to play an important role in the pathogenesis of SLE, and IL-17 inhibition was shown to ameliorate SLE pathology in lupus-prone mice. Moreover, the frequency of circulating follicular helper T (Tfh) cells, a T cell subset that orchestrates the maturation of high-affinity antibodies in the germinal center of secondary lymphoid organs, is associated with disease activity in SLE. Increased frequencies of IL17-producing Tfh have been reported in SLE patients compared to controls, but their role in SLE pathogenesis is still unknown. Method By leveraging the B6.Sle1NZM2410/AegYaa strain, we generated lupus-prone mice in which IL17-producing Tfh cells could be either fate-mapped (SLE Tfh17-FM, Il17aCRERosaLoxSTOPLox-YFPSle1+/+Yaa+) or fate-mapped and selectively depleted by intraperitoneal diphtheria toxin (DT) administration (SLE Tfh17-DTR, Il17aCRERosaLoxSTOPLox-YFPCxcr5LoxSTOPLox-DTRSle1+/+Yaa+). Tfh17-FM and Tfh17-DTR mice (both Sle1−/−Yaa−) were used as controls. Results Tfh17 comprised approximately 0.4% of total splenic Tfh in SLE mice at 6 weeks of life, and DT administration caused potent and selective depletion of these cells in the SLE Tfh17-DTR strain (Fig. 1A). Early Tfh17 deletion from week 4 to week 9 did not modify the increased Tfh frequency observed at 20 weeks in SLE mice, but resulted in long-term reduction of splenic germinal center (GC) B cells and plasmacells (Fig. 1B-C). IL17 receptor A was overexpressed in non-GC B cells and plasmacells of SLE mice compared to controls, suggesting a possible increased susceptibility of these subsets to IL17 (Fig. 1D). SLE Tfh17-DTR mice treated with DT displayed a trend towards decreased anti-DNA levels compared to SLE Tfh17-FM (Fig. 1E), but both glomerular immunocomplex deposition and renal pathology were not significantly impacted (Fig. 1F-G). Conclusion The germinal center reaction is affected by selective depletion of IL17-producing Tfh cells in SLE mice, with reduced differentiation of GC B cells and plasmacells. The modest effect of Tfh17 depletion on autoantibody levels and lupus nephritis pathology suggests that other Tfh subsets may play a role in GC-derived autoantibody generation. In addition, extrafollicular sources may also contribute to autoantibody production in SLE.

Galectin-3-ITGB1 Signaling Mediates Interleukin 10 Production of Hepatic Conventional Natural Killer Cells in Hepatitis B Virus Transgenic Mice and Correlates with Hepatocellular Carcinoma Progression in Patients.

The outcomes of HBV infections are related to complex immune imbalances; however, the precise mechanisms by which HBV induces immune dysfunction are not well understood. HBV transgenic (HBs-Tg) mice were used to investigate intrahepatic NK cells in two distinct subsets: conventional NK (cNK) and liver-resident NK (LrNK) cells during a chronic HBV infection. The cNK cells, but not the LrNK cells, were primarily responsible for the increase in the number of bulk NK cells in the livers of ageing HBs-Tg mice. The hepatic cNK cells showed a stronger ability to produce IL-10, coupled with a higher expression of CD69, TIGIT and PD-L1, and lower NKG2D expression in ageing HBs-Tg mice. A lower mitochondrial mass and membrane potential, and less polarized localization were observed in the hepatic cNK cells compared with the splenic cNK cells in the HBs-Tg mice. The enhanced galectin-3 (Gal-3) secreted from HBsAg+ hepatocytes accounted for the IL-10 production of hepatic cNK cells via ITGB1 signaling. For humans, LGALS3 and ITGB1 expression is positively correlated with IL-10 expression, and negatively correlated with the poor clinical progression of HCC. Gal-3-ITGB1 signaling shapes hepatic cNK cells but not LrNK cells during a chronic HBV infection, which may correlate with HCC progression.

MPoMA protects against lung epithelial cell injury via p65 degradation

Numerous cases of lung injury caused by viral infection were reported during the coronavirus disease-19 pandemic. While there have been significant efforts to develop drugs that block viral infection and spread, the development of drugs to reduce or reverse lung injury has been a lower priority. This study aimed to identify compounds from a library of compounds that prevent viral infection that could reduce and prevent lung epithelial cell damage. We investigated the cytotoxicity of the compounds, their activity in inhibiting viral spike protein binding to cells, and their activity in reducing IL-8 production in lung epithelial cells damaged by amodiaquine (AQ). We identified N-(4-(4-methoxyphenoxy)-3-methylphenyl)-N-methylacetamide (MPoMA) as a non-cytotoxic inhibitor against viral infection and AQ-induced cell damage. MPoMA inhibited the expression of IL-8, IL-6, IL-1β, and fibronectin induced by AQ and protected against AQ-induced morphological changes. However, MPoMA did not affect basal IL-8 expression in lung epithelial cells in the absence of AQ. Further mechanistic analysis confirmed that MPoMA selectively promoted the proteasomal degradation of inflammatory mediator p65, thereby reducing intracellular p65 expression and p65-mediated inflammatory responses. MPoMA exerted potent anti-inflammatory and protective functions in epithelial cells against LPS-induced acute lung injury in vivo. These findings suggest that MPoMA may have beneficial effects in suppressing viral infection and preventing lung epithelial cell damage through the degradation of p65 and inhibition of the production of inflammatory cytokines.

Intestinal ILC3 Activation by Commensal Bacteroides thetaiotaomicron: Implication for Liver Protection in Alcohol-Induced Liver Disease

Abstract In recent years, there has been a growing recognition of the intricate interplay between the commensal bacteria Bacteroides thetaiotaomicron (Bt) and immune system. Among the various immune cell subsets, innate lymphoid cells (ILCs), group 3 ILCs (ILC3s) have particularly piqued the interest of researchers, as they appear to wield a significant influence in maintaining gut homeostasis. In order to understand if Bt mediates the crosstalk between intestinal epithelial cells (IECs) and ILC3 that prevents gut dysbiosis and liver injury in alcoholic liver disease (ALD), a disorder that causes lipid accumulation, liver damage, gut bacterial overgrowth and gastrointestinal mucosa dysfunctions, this study narrowed to the exploration of intricate relationship between Bt and ILC3s activation in the modulation of ALD. Bt supplementation leads to lower liver triglyceride content, prevent liver from steatosis, inflammatory lesions, relieves liver fat lesions and enhance intestinal. Bt enhances the Ahr activity and IL23 expression in IEC. The beneficial effect of Bt was abrogated in mice supplemented with Bt lacking capsular polysaccharides (CPS) and diminish AhR dependent IECs IL23 production and activation of type 3 innate lymphoid cells (ILC3). IL22-producing ILC3 cells improved gut homeostasis and this cascade ultimately results in enhance Mucin secretion, reduced systemic inflammation, hepatocyte apoptosis, and subsequently acute liver injury through the gut-liver axis.

Allergenicity Modulation of Casein with the Modifications of Linearization, Cross-Linking, and Glycation via the Regulation of Th1/Th2 Homeostasis.

Casein (CN) is the primary allergenic protein in cow's milk, contributing to the worldwide escalating prevalence of food allergies. However, there remains limited knowledge regarding the effect of structural modifications on CN allergenicity. Herein, we prepared three modified CNs (mCN), including sodium dodecyl sulfate and dithiothreitol-induced linear CN (LCN), transglutaminase-cross-linked CN (TCN), and glucose-glycated CN (GCN). The electrophoresis results indicated widespread protein aggregation among mCN, causing variations in their molecular weights. The unique internal and external structural characteristics of mCN were substantiated by disparities in surface microstructure, alterations in the secondary structure, variations in free amino acid contents, and modifications in functional molecular groups. Despite the lower digestibility of TCN and GCN compared to LCN, they significantly suppressed IL-8 production in Caco-2 cells without significantly promoting their proliferation. Moreover, GCN showed the weakest capacity to induce LAD2 cell degranulation. Despite the therapeutic effect of TCN, GCN-treated mice displayed the most prominent attenuation of allergic reactions and a remarkably restored Th1/Th2 imbalance, while LCN administration resulted in severe allergic phenotypes and endotypes in both cellular and murine models. This study highlighted the detrimental effect of linear modifications and underscored the significance of glycation in relation to CN allergenicity.

STAT3 promotes cytoplasmic-nuclear translocation of RNA-binding protein HuR to inhibit IL-1β-induced IL-8 production

Signal transducer and activator of transcription 3 (STAT3) functions to regulate inflammation and immune response, but its mechanism is not fully understood. We report here that STAT3 inhibitors Stattic and Niclosamide up-regulated IL-1β-induced IL-8 production in C33A, CaSki, and Siha cervical cancer cells. As expected, IL-1β-induced IL-8 production was also up-regulated through the molecular inhibition of STAT3 by use of CRISPR/Cas9 technology. Unexpectedly, IL-1β induced IL-8 production via activating ERK and P38 signal pathways, but neither STAT3 inhibitors nor STAT3 knockout affected IL-1β-induced signal transduction, suggesting that STAT3 decreases IL-8 production not via inhibition of signal transduction. To our surprise, STAT3 inhibition increased the stabilization, and decreased the degradation of IL-8 mRNA, suggesting a post-transcriptional regulation of IL-1β-induced IL-8. Moreover, Dihydrotanshinone I, an inhibitor of RNA-binding protein HuR, down-regulated IL-1β-induced IL-8 dose-dependently. HuR inhibition by CRISPR/Cas9 also decreased IL-8 production induced by IL-1β. Mechanistically, co-immunoprecipitation results showed that STAT3 did not react with HuR directly, but STAT3 inhibition increased the protein levels of HuR in cytoplasm. And IL-6 activation of STAT3 induced HuR cytoplasmic-nuclear transport. Taken together, these results suggest that STAT3 contributes to HuR nuclear localization and inhibits Il-1β-induced IL-8 production through this non-transcriptional mechanism.

444 Deciphering the role of IL-4 in post-colitis repair

OBJECTIVES/GOALS: Incomplete mucosal healingand dysbiosis prevent long-term remission after colitis. IL4 may restore colon homeostasis through its action on immune cells and the microbiome. We will demonstrate this mechanism using genetically modified mice and molecular tools. This may result in target therapies that prolong remission in patients with IBD. METHODS/STUDY POPULATION: Mice were treated with 3% dextran sulfate sodium (DSS) in drinking water for 5 days to induce colitis. Mice were monitored daily for changes in body weight, and to monitor colitis severity. At each endpoint, mice were sacrificed and colon length was measured. For disease severity assessment, mouse colons were prepared in paraffin sections by the 'swiss-rolling' method. For flow cytometry, lamina propria mononuclear cell isolation was performed and cellular populations were stained with fluorophore-conjugated antibodies. IL4-eGFP-expressing (4get) mice were used to analyze the cellular expression of IL4 after colitis. Cell-specific IL4 deletion mice were generated using the cre-lox system. RESULTS/ANTICIPATED RESULTS: IL4-deficient mice had worse colitis compared with wild-type controls. Flow cytometry of lamina propria cells from 4get mice showed that most IL4-producing cells after colitis are eosinophils (CD11b+SiglecF+). Flow cytometry of C57bl6 mice showed an influx of IL4Ra+ monocytes (CD11b+Ly6C+) and macrophages (CD11b+F480+). IL4-stimulated bone marrow-derived macrophages demonstrated an increase in HB-EGF mRNA transcription. Myeloid-specific IL4R deleted mice had no difference in colitis severity compared with controls. Neutrophil-specific IL4R-deleted mice had increased colitis severity and mortality. Co-housing of littermate mice rescued recovery after DSS in IL4 deficient mice. DISCUSSION/SIGNIFICANCE: IL4 appears to play a role in restoring homeostasis after colitis. The mechanism depends on eosinophil-derived IL4, and action through neutrophils. However, the reparative function of IL4 can be shared with deficient mice through the microbiome. I will study the cellular and microbial mechanism by which IL4 restores homeostasis after colitis.

Peripheral T-cell responses of EphB2- and EphB3-deficient mice in a model of collagen-induced arthritis

Both EphB2- and EphB3-deficient mice exhibit profound histological alterations in the thymic epithelial network but few changes in T-cell differentiation, suggesting that this organization would be sufficient to produce functional T lymphocytes. Also, other antigen-presenting cells involved in immunological education could substitute the thymic epithelium. Accordingly, we found an increased frequency of plasmacytoid dendritic cells but not of conventional dendritic cells, medullary fibroblasts or intrathymic B lymphocytes. In addition, there are no lymphoid infiltrates in the organs of mutant mice nor do they contain circulating autoantibodies. Furthermore, attempts to induce arthritic lesions after chicken type II collagen administration fail totally in EphB2-deficient mice whereas all WT and half of the immunized EphB3−/− mice develop a typical collagen-induced arthritis. Our results point out that Th17 cells, IL4-producing Th2 cells and regulatory T cells are key for the induction of disease, but mutant mice appear to have deficits in T cell activation or cell migration properties. EphB2−/− T cells show reduced in vitro proliferative responses to anti-CD3/anti-CD28 antibodies, produce low levels of anti-type II collagen antibodies, and exhibit low proportions of T follicular helper cells. On the contrary, EphB3−/− lymph node cells respond accurately to the different immune stimuli although in lower levels than WT cells but show a significantly reduced migration in in vitro transwell assays, suggesting that no sufficient type II collagen-dependent activated lymphoid cells reached the joints, resulting in reduced arthritic lesions.

Abstract 7478: Unveiling the role of two-pore channel 2 (TPC2) in cancer immunity from monocyte differentiation to cytokine production

Abstract Background: The study of TPC2 is of great interest in the field of cancer and immune diseases, as it plays a crucial role in various cellular processes, and there is substantial evidence that TPC2 sustains several cancer hallmarks (angiogenesis, autophagy, and metastasis). The expression and role of TPC2 and its relevance to cancer in the innate immune system remain unknown. Methods: U937 TPCN2 knockdown (KD) cells were developed by nucleofection-based transfection of CRISPR-Cas9 gene editing tools. sgRNA (single guide RNA): CGUGCUGGUGAGUGAGGAUG was designed to target the fourth exon of the TPCN2 gene (Transcript ID: ENST00000294309). The model was used in tandem with pharmacological modulators of TPC2 channel activity to underpin its function in monocyte differentiation, macrophage development, and IL-8 production. Molecular biology techniques, including Sanger sequencing, qPCR, ELISA, and WB, were utilized. Proteins of murine TPC2 WT and TPC2 KO cells were extracted and sent to the Discovery Proteomics Facility of the Target Discovery Institute for label-free quantification and proteomics analysis using mass spectrometry. Results: We developed TPC2-deficient human monocytes (U937 cells) with a 75% reduction in TPCN2 expression levels, and we demonstrated that TPCN2 genetically modified U937 monocytes were resistant to monocyte differentiation after treatment with increasing concentrations of PMA ranging from 100 ng/mL to 400 ng/mL. TPC2-deficient U937 monocytes were not differentiated into Mϕ. TPC2 acts as a major regulator of monocyte differentiation by modulating PKC-alpha via calpain. In addition, the levels of IL-8 were significantly reduced after treating U937 cells with Ned 19 (an NAADP antagonist) or TPC2 KD. Keratinocyte-derived chemokine (KC) and Macrophage inflammatory protein-2 (MIP-2) are the murine IL-8 homologues. Notably, the levels of MIP-2, but not KC, were significantly reduced in the TPC2 KO murine cells compared to the WT controls. Thus, TPC2 appears to be involved in IL-8 secretion in both humans and mice. In contrast to KC at the protein level, the KC expression level was significantly reduced in TPC2-deficient murine cells. TPC2 in EE/RE is involved in lipopolysaccharide (LPS)-mediated IL-8 production in U937 cells. TPC2 modulates immune targets involving CD38, PKC-alpha, and AKT.We found that 28 different proteins that play roles in cancer immunity showed significant changes in expression in TPC2-deficient murine cells (three overexpressed proteins and 25 down-expressed proteins), compared to WT. Conclusion: Our data provide the first preclinical proof of concept for TPC2 as a potential target for blocking macrophage development and modulating CD38/IL8 levels as therapeutic strategies for cancer patients, raising questions regarding the clinical utility of TPC2 as a biomarker or immunotherapy target to modulate immune responses. Citation Format: Abeer Alharbi, John Parrington. Unveiling the role of two-pore channel 2 (TPC2) in cancer immunity from monocyte differentiation to cytokine production [abstract]. In: Proceedings of the American Association for Cancer Research Annual Meeting 2024; Part 1 (Regular Abstracts); 2024 Apr 5-10; San Diego, CA. Philadelphia (PA): AACR; Cancer Res 2024;84(6_Suppl):Abstract nr 7478.