The biology of IgE+ memory B cells (MBCs) remains enigmatic. The body of data from murine models demonstrates that IgE+ MBCs are extremely rare, at best, therefore suggesting that IgE-mediated recall responses are derived from non–IgE-expressing MBCs, particularly IgG1.1Jimenez-Saiz R. Bruton K. Koenig J.F.E. Waserman S. Jordana M. The IgE memory reservoir in food allergy.J Allergy Clin Immunol. 2018; 142: 1441-1443Scopus (6) Google Scholar In stark contrast, several human studies have claimed that a population of IgE+ MBCs can be identified in PBMCs of healthy donors, atopic donors, and donors with food allergy,2Heeringa J.J. Rijvers L. Arends N.J. Driessen G.J. Pasmans S.G. van Dongen J.J.M. et al.IgE-expressing memory B cells and plasmablasts are increased in blood of children with asthma, food allergy, and atopic dermatitis.Allergy. 2018; 73: 1331-1336Crossref PubMed Scopus (36) Google Scholar, 3Berkowska M.A. Heeringa J.J. Hajdarbegovic E. van der Burg M. Thio H.B. van Hagen P.M. et al.Human IgE(+) B cells are derived from T cell-dependent and T cell-independent pathways.J Allergy Clin Immunol. 2014; 134: 688-697.e6Abstract Full Text Full Text PDF PubMed Google Scholar, 4Heeringa J.J. Fieten K.B. Bruins F.M. van Hoffen E. Knol E.F. Pasmans S. et al.Treatment for moderate to severe atopic dermatitis in alpine and moderate maritime climates differentially affects helper T cells and memory B cells in children.Clin Exp Allergy. 2018; 48: 679-690Google Scholar as well as in the sputum of asthmatic patients.5Oliveria J.P. Salter B.M. MacLean J. Kotwal S. Smith A. Harris J.M. et al.Increased IgE(+) B cells in sputum, but not blood, bone marrow, or tonsils, after inhaled allergen challenge in subjects with asthma.Am J Respir Crit Care Med. 2017; 196: 107-109Crossref PubMed Scopus (8) Google Scholar, 6Oliveria J.P. Salter B.M. Phan S. Obminski C.D. Munoz C.E. Smith S.G. et al.Asthmatic subjects with allergy have elevated levels of IgE+ B cells in the airways.J Allergy Clin Immunol. 2017; 140: 590-593.e9Abstract Full Text Full Text PDF PubMed Scopus (10) Google Scholar Moreover, the presence of these cells in the circulation has been proposed as a prognostic marker of allergy.2Heeringa J.J. Rijvers L. Arends N.J. Driessen G.J. Pasmans S.G. van Dongen J.J.M. et al.IgE-expressing memory B cells and plasmablasts are increased in blood of children with asthma, food allergy, and atopic dermatitis.Allergy. 2018; 73: 1331-1336Crossref PubMed Scopus (36) Google Scholar Divergent findings on the existence of IgE-expressing MBCs between mice and human subjects could be partly due to the precision of techniques used in their quantification. While the identification of IgE-expressing MBCs in mice has been comprehensive, identification of these cells in human subjects has relied on flow cytometry.1Jimenez-Saiz R. Bruton K. Koenig J.F.E. Waserman S. Jordana M. The IgE memory reservoir in food allergy.J Allergy Clin Immunol. 2018; 142: 1441-1443Scopus (6) Google Scholar In light of this, we sought to establish a method to validate the flow cytometric identification of IgE+ MBCs through genetic analysis of the BCR isotypes from single-sorted cells (see the Methods section in this article's Online Repository at www.jacionline.org). We modified a single-cell nested PCR amplification method7Tiller T. Busse C.E. Wardemann H. Cloning and expression of murine Ig genes from single B cells.J Immunol Methods. 2009; 350: 183-193Crossref PubMed Scopus (164) Google Scholar to amplify the variable region of IgE transcripts with primers shown specific to the 5′ end of IgE heavy chain constant region (see Fig E1, A, in this article's Online Repository at www.jacionline.org).3Berkowska M.A. Heeringa J.J. Hajdarbegovic E. van der Burg M. Thio H.B. van Hagen P.M. et al.Human IgE(+) B cells are derived from T cell-dependent and T cell-independent pathways.J Allergy Clin Immunol. 2014; 134: 688-697.e6Abstract Full Text Full Text PDF PubMed Google Scholar Then amplicons underwent Sanger sequencing, and resulting sequences were aligned to human heavy chain constant region alleles of all antibody isotypes to assess homology. To evaluate that the PCR technique amplifies IgE transcripts with high specificity and sensitivity, we single-sorted a human IgE-expressing cell line and performed IgE RT-PCR according to the same methodology (see Fig E1, B). Our protocol demonstrated high sensitivity, amplifying, on average, more than 90% of the cells tested, sequences of which all aligned to IgE constant region (IGHE) alleles (see Fig E1, C). Additionally, we generated a DNA vector containing a human IgE backbone (IGEv) for use as a positive control. To determine that our technique specifically amplifies IgE transcripts, we single-sorted peripheral blood B cells (CD20+) that did not stain for IgE (see Fig E1, D). Using the same RT-PCR strategy as in Fig E1, A, none of the IgE− B cells were amplified (see Fig E1, E), indicating that the technique is both sensitive and specific. Together, these data demonstrate that this system accurately amplifies rearranged IgE heavy chain variable sequences, specifically in single-sorted IgE-expressing cells. Reported frequencies of IgE-expressing MBCs in peripheral blood vary depending on the flow cytometric identification strategies.2Heeringa J.J. Rijvers L. Arends N.J. Driessen G.J. Pasmans S.G. van Dongen J.J.M. et al.IgE-expressing memory B cells and plasmablasts are increased in blood of children with asthma, food allergy, and atopic dermatitis.Allergy. 2018; 73: 1331-1336Crossref PubMed Scopus (36) Google Scholar, 3Berkowska M.A. Heeringa J.J. Hajdarbegovic E. van der Burg M. Thio H.B. van Hagen P.M. et al.Human IgE(+) B cells are derived from T cell-dependent and T cell-independent pathways.J Allergy Clin Immunol. 2014; 134: 688-697.e6Abstract Full Text Full Text PDF PubMed Google Scholar, 6Oliveria J.P. Salter B.M. Phan S. Obminski C.D. Munoz C.E. Smith S.G. et al.Asthmatic subjects with allergy have elevated levels of IgE+ B cells in the airways.J Allergy Clin Immunol. 2017; 140: 590-593.e9Abstract Full Text Full Text PDF PubMed Scopus (10) Google Scholar, 8Blanco E. Perez-Andres M. Arriba-Mendez S. Contreras-Sanfeliciano T. Criado I. Pelak O. et al.Age-associated distribution of normal B-cell and plasma cell subsets in peripheral blood.J Allergy Clin Immunol. 2018; 141: 2208-2219.e16Abstract Full Text Full Text PDF PubMed Scopus (84) Google Scholar A basic approach to identify these cells involves intracellular staining of IgE without preventing staining of cytotropic IgE.5Oliveria J.P. Salter B.M. MacLean J. Kotwal S. Smith A. Harris J.M. et al.Increased IgE(+) B cells in sputum, but not blood, bone marrow, or tonsils, after inhaled allergen challenge in subjects with asthma.Am J Respir Crit Care Med. 2017; 196: 107-109Crossref PubMed Scopus (8) Google Scholar, 6Oliveria J.P. Salter B.M. Phan S. Obminski C.D. Munoz C.E. Smith S.G. et al.Asthmatic subjects with allergy have elevated levels of IgE+ B cells in the airways.J Allergy Clin Immunol. 2017; 140: 590-593.e9Abstract Full Text Full Text PDF PubMed Scopus (10) Google Scholar A more stringent detection method involves the stepwise exclusion of each BCR isotype through extracellular staining.3Berkowska M.A. Heeringa J.J. Hajdarbegovic E. van der Burg M. Thio H.B. van Hagen P.M. et al.Human IgE(+) B cells are derived from T cell-dependent and T cell-independent pathways.J Allergy Clin Immunol. 2014; 134: 688-697.e6Abstract Full Text Full Text PDF PubMed Google Scholar With our single-cell IgE amplification protocol, we sought to validate the frequency of peripheral blood IgE-expressing MBCs in donors with peanut allergy using these previously reported flow cytometric approaches. MBCs were identified as live singlet CD20+CD38lo-medCD27+ and IgD−IgM− cells, and IgE+ MBCs were further identified through basic IgE staining or the stepwise exclusion approach (see Fig E2, B). Twelve putative IgE-expressing MBCs were single-sorted from each staining technique for subsequent single-cell nested PCR. Basic IgE staining revealed a 3.4% frequency of IgE+ MBCs from B cells. However, no cells were amplified with IgE-specific RT-PCR (see Fig E2, C). The stepwise exclusion approach reported a frequency of putative IgE-expressing MBCs 20 times lower (0.17%), but likewise, none of the cells were amplified with IgE-specific RT-PCR (see Fig E2, D). To delineate the BCR identity of the spurious cells that fell into the IgE gate, we generated a cocktail of primers specific to IgG, IgA, and IgM heavy chain regions (GAM). By using our single-cell nested PCR strategy, more than 90% of the sorted cells were amplified with GAM primers, and the rest did not amplify (<10%). Amplicons were confirmed to align predominantly with IGHG and to a minor extent with IGHA or IGHM through Sanger sequencing. These data demonstrate that previously reported IgE+ MBC flow cytometry detection protocols result in a high rate of false-positive events. The demonstration that previously reported flow cytometric methods for IgE+ MBC identification are faulty prompted us to ascertain the true frequency of these cells. Because the stepwise exclusion method generated a substantially lower number of spurious events than the basic IgE staining method, we sought to modify the former to remove contamination from non–IgE-expressing cells, which largely originated from IgG+ MBCs carrying cytotropic IgE (data not shown). This enhanced protocol consisted of purifying B cells from PBMCs and a stepwise exclusion of IgD+, IgM+, IgA+, and IgG+ cells (Fig 1, A). Furthermore, use of a polyclonal anti-IgG antibody markedly contributed to resolving the double-negative population of MBCs (IgD−IgM−IgG−IgA−IgE−) compared with the previous stepwise exclusion method (3.8% vs 58.6%). Because B cells canonically express at least 1 BCR isotype, we reasoned that the population arose from B cells with a low BCR surface density, in which use of a polyclonal (rather than monoclonal) antibody to stain for surface IgG was superior. Notably, the improved staining resulted in a significantly lower frequency of cells in the IgE gate, at 0.006% of total B cells, which was considered background as it was comparable to the frequency observed in the fluorescence minus one control (0.01% of total B cells; Fig 1, A). To validate that our enhanced staining technique was capable of detecting IgE+ MBCs, we stimulated PBMCs in culture with IL-4 plus anti-CD40. As expected, culturing under these conditions resulted in the robust emergence of IgE-secreting cells and IgE, as detected by using total IgE ELISpot and ELISA, respectively (Fig 1, B). A population of putative IgE+ MBCs was observed through the enhanced stepwise exclusion method (Fig 1, C), and their IgE identity was confirmed through single-cell nested RT-PCR and Sanger sequencing (Fig 1, D and E). Further validation was carried out in PBMCs from 4 patients with atopic dermatitis and serum IgE levels of between 2370 and 6350 kIU/L. Bona fide IgE+ MBCs, confirmed with Sanger sequencing, were identified in 2 of these 4 patients at a frequency of 0.0015% from total B cells (Fig 1, F and G). With our enhanced detection method, we conducted analyses on PBMCs of 20 donors, which included patients with peanut allergy (n = 9; mean serum total IgE level, 196 kIU/L [11-890 kIU/L]) and nonallergic subjects (n = 10, see Table E1 in this article's Online Repository at www.jacionline.org). We detected similar frequencies of putative IgE+ MBCs (percentage from total B cells: 0.0019 for patients with peanut allergy and 0.0046 for nonallergic subjects). However, in all instances there was no IgE amplification (Table I).Table IQuantification of IgE+ MBCs in healthy and allergic donorsTissueDonor IDAllergic statusMononuclear cellsPurified B cellsEvents in CD20+CD38lo-med gateEvents in IgE gateSorted cellsIGHE amplificationBloodP001P003P007P009P014P021P025P026P030P031P008P011P013P016P017P020P024P028P029−−−−−−−−−−PeanutPeanutPeanutPeanutPeanutPeanutPeanutPeanutPeanut250,000,000123,000,000125,000,00098,600,000109,000,000173,000,00086,600,00094,200,00078,800,00085,400,000125,000,000250,000,000210,000,000125,000,000125,000,000124,000,00071,800,00094,800,00054,000,0009,540,0008,640,0002,685,0004,140,0002,820,00026,000,0001,401,0001,494,0001,128,000945,0008,160,0007,150,0005,450,0001,068,0001,467,0003,900,0001,026,0001,440,0001,467,000600,304169,267645,055325,734605,535440,963246,090250,018132,157172,260335,641520,021690,015143,759213,345537,856166,313157,340277,359212951282201444206135114312612312812010442031251011120000000000000000000TonsilsTP-9TP-10TP-11−−−10,000,00010,000,00010,000,000−−−204,12568,46156,127101567126000 Open table in a new tab To ensure that IgE+ MBCs were not being missed through our exclusion of CD27− cells, we sorted CD27− IgE+ MBCs because it has been speculated that MBCs arising extrafollicularly3Berkowska M.A. Heeringa J.J. Hajdarbegovic E. van der Burg M. Thio H.B. van Hagen P.M. et al.Human IgE(+) B cells are derived from T cell-dependent and T cell-independent pathways.J Allergy Clin Immunol. 2014; 134: 688-697.e6Abstract Full Text Full Text PDF PubMed Google Scholar might not gain CD27, the canonical MBC marker. Similarly, no PCR amplification occurred with IgE primers (data not shown). Furthermore, we investigated the possibility that the polyclonal anti-IgG antibody could bind nonspecifically to IgE+ MBCs because of serum IgG or IgA bound to MBCs, thus masking IgE+ MBCs cells in the IgG+ or IgA+ populations. Here we stained for IgA and IgG on the same fluorophore and flow-sorted class-switched MBCs that were positive for IgE (see Fig E3, A and B, in this article's Online Repository at www.jacionline.org). The frequency of this population was 0.074%, and genetic analysis demonstrated that these MBCs were of a non-IgE identity that presumably bound secreted IgE. Additionally, we single-sorted class-switched MBCs from the IgG, IgA, and (residual) double-negative gate. There was no PCR amplification with IgE primers but with GAM (see Fig E3, C and D), thus supporting that the methodology used did not underestimate the frequency of IgE+ MBCs. The value of scientific knowledge relies to a large extent on the fidelity of the tools used to generate such knowledge. In this context, we provide a validated method to identify bona fide IgE+ MBCs. Our data demonstrate the extreme rarity of these cells in the circulation of allergic patients, at least orders of magnitude lower than previously reported,2Heeringa J.J. Rijvers L. Arends N.J. Driessen G.J. Pasmans S.G. van Dongen J.J.M. et al.IgE-expressing memory B cells and plasmablasts are increased in blood of children with asthma, food allergy, and atopic dermatitis.Allergy. 2018; 73: 1331-1336Crossref PubMed Scopus (36) Google Scholar, 3Berkowska M.A. Heeringa J.J. Hajdarbegovic E. van der Burg M. Thio H.B. van Hagen P.M. et al.Human IgE(+) B cells are derived from T cell-dependent and T cell-independent pathways.J Allergy Clin Immunol. 2014; 134: 688-697.e6Abstract Full Text Full Text PDF PubMed Google Scholar and are in agreement with human genetic studies that reported few IgE transcripts in the circulation but without unambiguously defining the B-cell phenotype (eg, MBCs and plasmablasts).9Croote D. Darmanis S. Nadeau K.C. Quake S.R. High-affinity allergen-specific human antibodies cloned from single IgE B cell transcriptomes.Science. 2018; 362: 1306-1309Crossref PubMed Scopus (67) Google Scholar This finding strengthens the concept that the reservoir of IgE-secreting cells resides in MBCs of a non-IgE isotype and, as such, informs future research directions. Of note, it is possible that tissues from allergic subjects could harbor IgE+ MBCs; this remains both a challenge and a prime venue for future efforts. Nevertheless, it is evident that the proposal that circulating IgE+ MBCs could be a clinical marker for allergic disease is unproved. Antibodies were obtained from BioLegend (San Diego, Calif), Columbia Biosciences (Frederick, Md), BD Biosciences (San Jose, Calif), Miltenyi Biotec (Bergisch Gladbach, Cologne, Germany), eBioscience (Carlsbad, Calif), or Thermo Fisher Scientific (Waltham, Mass): CD38–phycoerythrin (PE)-Cy7 (clone HIT2); IgE-allophycocyanin (Columbia Biosciences SKU: D3-110-E); IgG-PE (clones G18-145 and HP6017 and Thermo Fisher Scientific Catalog #12-4998-82); IgA-PE (clone IS11-8E10); IgA-allophycocyanin (clone IS11-8E10); IgM–Brilliant Violet 510 (clone MHM-88); IgD–Brilliant Violet 421 (clone IA6-2); IgG-biotin (Thermo Fisher Scientific Catalog #A18815); CD20–Alexa Fluor 700 (clone 2H7); and CD27–fluorescein isothiocyanate (clone O323). In all assays 1 × 106 cells were first incubated with Human TruStain FcX (Fc Receptor Blocking Solution, BioLegend) or anti-human CD32 (FcγRII Blocker; STEMCELL Technologies, Vancouver, British Columbia, Canada) for 15 minutes on ice to block nonspecific staining and then incubated with fluorochrome-conjugated antibodies for 30 minutes on ice and protected from light. When IgG-biotin was used to label IgG+ cells, cells were incubated for an additional 30 minutes with streptavidin-PE (BioLegend) on ice and protected from light. Dead cells were excluded by using the fixable viability dye eFluor780 (eBioscience) and by gating on singlets. Fluorescence minus one was used for gating. Data were acquired on a Fortessa (BD Biosciences) and analyzed with FlowJo software (TreeStar, Ashland, Ore), and single cells were sorted on a MoFlo XDP Cell Sorter (Beckman Coulter, Fullerton, Calif). Single cells were sorted into 96-well PCR plates (Thermo Fisher) containing 20 U of RNasin Ribonuclease Inhibitors (Promega, Madison, Wis), 2 μL of First Strand buffer (Thermo Fisher), and nuclease-free water to a volume of 10 μL per well. The cells were centrifuged at 4°C and 550g for 1 minute and immediately placed in a −80°C freezer. Next, heat lysis was performed by adding 3 μL of Nonidet P-40 Substitute (G-Biosciences, St Louis, Mo) and 150 ng of random hexamers (Thermo Fisher). The reaction was performed at 65°C for 10 minutes and then 25°C for 3 minutes. All thermocycler reactions were done with the Mastercycler Pro S (Eppendorf). cDNA was synthesized, as follows: 2 μL of 5× First Strand buffer (Thermo Fisher), 2 μL of 0.1 mol/L dithiothreitol (Qiagen, Hilden, Germany), 1 μL of 10 mmol/L of each dNTP, and 0.5 μL of SuperScript III (Thermo Fisher) were added to the plate containing the heat lysis contents (final volume, 19.5 μL). Reverse transcription was performed at 37°C for 1 hour and then 70°C for 10 minutes. IgH amplification was accomplished by using a 2-step nested PCR, as previously described. Briefly, a mix of 6 forward primersE1Tiller T. Meffre E. Yurasov S. Tsuiji M. Nussenzweig M.C. Wardemann H. Efficient generation of monoclonal antibodies from single human B cells by single cell RT-PCR and expression vector cloning.J Immunol Methods. 2008; 329: 112-124Crossref PubMed Scopus (598) Google Scholar and either a reverse primer specific to IGHEE2Berkowska M.A. Heeringa J.J. Hajdarbegovic E. van der Burg M. Thio H.B. van Hagen P.M. et al.Human IgE(+) B cells are derived from T cell-dependent and T cell-independent pathways.J Allergy Clin Immunol. 2014; 134: 688-697.e6Abstract Full Text Full Text PDF PubMed Scopus (52) Google Scholar (first 5′-CATCACCGGCTCCGGGAAGTAG-3′ and second 5′-GTTTTTGCAGCAGCGGGTCAAG-3′) or a pool of reverse primers specific to IGHM, IGHA, and IGHG were used (IGHM: first 5′-CAGGAGACGAGGGGGAAAAG-3′ and second 5′-GAAAAGGGTTGGGGCGGATGC-3′; IGHA: first 5′-GCTCAGCGGGAAGACCTT-3′ and second 5′- GACCTTGGGGCTGGTCGGGGA-3′; and IGHG: first 5′-GCCAGGGGGAAGACSGATG-3′ and second 5′-GACSGATGGGCCCTTGGTGGA-3′).E3Wang X. Stollar B.D. Human immunoglobulin variable region gene analysis by single cell RT-PCR.J Immunol Methods. 2000; 244: 217-225Crossref PubMed Scopus (70) Google Scholar The first PCR reaction contained 8 μL of cDNA mixture, 1 U of HotStar Plus Taq (Qiagen), 200 nmol/L of each primer, 400 μmol/L dNTP (Thermo Fisher), 5 μL of 10× PCR buffer (Qiagen), and nuclease-free water to a final volume of 50 μL. The reaction was performed starting with 3 cycles of preamplification of 95°C for 45 seconds, 45°C for 45 seconds, and 72°C for 45 seconds, followed by 30 cycles of 94°C for 45 seconds, 50°C for 45 seconds, and 72°C for 1 minute and 45 seconds and a final extension of 72°C for 10 minutes. The second PCR reaction contained 4 μL of PCR 1 product, 5 μL of 10× Pfu buffer (Agilent, Santa Clara, Calif), 1.25 μL of 10 mmol/L dNTP (Thermo Fisher), 400 nmol/L of each primer, 1.25 U of Pfu polymerase (Agilent), and nuclease-free water to a final concentration of 50 μL. The reaction was performed for 30 cycles at 94°C for 45 seconds, 50°C for 45 seconds, and 72°C for 1 minute and 45 seconds, followed by a final extension of 72°C for 10 minutes. The second PCR product was visualized on a 1.5% agarose gel, and the expected band size was approximately 400 bp. Amplified IgH sequences were enzymatically purified by using ExoSAP-IT PCR Product Cleanup Reagent (Thermo Fisher) and subsequently Sanger sequenced by using the forward and reverse primers (GENEWIZ). The sequences were analyzed by using IMGT/HighV-QUEST (http://imgt.org/HighV-QUEST) for V, D, and J sequences with the highest identity, as well as nucleotide and amino acid mutations from their germline sequences. To generate a human IgE, we started with a heavy chain IgG1 vector (gifted by Michel C. Nussenzweig) previously modified to include an Ara h 2 variable chain.E4Patil S.U. Ogunniyi A.O. Calatroni A. Tadigotla V.R. Ruiter B. Ma A. et al.Peanut oral immunotherapy transiently expands circulating Ara h 2-specific B cells with a homologous repertoire in unrelated subjects.J Allergy Clin Immunol. 2015; 136: 125-134.e12Abstract Full Text Full Text PDF PubMed Scopus (60) Google Scholar The human ε constant region was amplified from an anti-OVA human IgE vectorE5 with primers (5′ TTTT GTCGAC GGCGCACCA 3′ and 5′ TTTT AAGCTT CTCAATGGTGGTGATGTTTA 3′) to add flanking SalI and HindIII restriction enzyme sites. The human ε constant region then replaced the γ1 constant region under the CMV provider by using the SalI and HindIII restriction enzyme sites. Sanger sequencing confirmed successful insertion of the ε constant region. A cohort of 10 blood donors with peanut allergy and 10 nonallergic blood donors were recruited from McMaster University (Hamilton, Ontario, Canada). Allergy to peanut was ascertained by using a peanut-specific IgE ImmunoCAP performed at LRC Hamilton (McMaster Children's Hospital) and by using skin prick testing. Patients with peanut allergy were considered for inclusion with peanut-specific serum IgE levels of greater than 0.35 kU/L and skin prick test responses of 3 mm or more larger than those elicited by the saline control. Total serum IgE levels were quantified by using the IMMAGE 800 (Beckman Coulter) performed at LRC Hamilton for a general measure of atopy. We recruited an additional 4 participants with total serum IgE levels of greater than 2300 kIU/L and received 3 tonsil discards from subjects undergoing routine tonsillectomies. Exclusion criteria for all recruited donors included the following: allergen immunotherapy, previous or current omalizumab (Xolair) treatment, other systemic immunomodulatory treatments (ie, rituximab), or autoimmune/immunodeficiency diseases. Patients' demographics and allergic indicators are summarized in Table E1. All donors were recruited with written consent and ethical approval from Hamilton Integrated Research Ethics Board. Up to 80 mL of peripheral blood was collected into heparinized tubes (BD), and tonsils were crushed into a single-cell suspension. PBMCs were isolated through Ficoll-Paque (GE Healthcare, Chicago, Ill) density gradient centrifugation. Immediately afterward, B cells were isolated from PBMCs by using a negative selection magnetic separation kit (19054; STEMCELL Technologies) with at least 70% purity. PBMCs were cultured in RPMI 1640 (Gibco, Grand Island, NY) supplemented with 10% human AB serum (Corning, Corning, NY), 10 mmol/L HEPES, 0.1 mmol/L nonessential amino acids, 1 mmol/L sodium pyruvate, 55 μmol/L 2-mercaptoethanol, 1% l-glutamine, and 1% penicillin-streptomycin. Cells were plated at a density of 1.5 × 106 cells/mL in 24-well plates. Stimulated cells were treated with 68.7 ng/mL (8000 IU) IL-4 (Sigma-Aldrich, St Louis, Mo) and 5 μg/mL anti-CD40 (Bio X Cell, West Lebanon, NH) on day 1. Cells were incubated at 37°C and 5% CO2 for the duration of culture. On days 4 and 8 of culture, 1 mL of cell-free supernatant was withdrawn and replaced with fresh media. Supernatants were also withdrawn on day 11 of culture and stored at −80°C for later analysis of total IgE by means of ELISA. After 11 days in culture, cells were harvested, and IgE-secreting cells were quantified by using ELISpot. For total IgE ELISA, MaxiSorb plates (Thermo Fisher Scientific) were coated with 0.5 μg/mL anti-human IgE (555894; BD PharMingen, San Jose, Calif) in carbonate-bicarbonate buffer overnight at 4°C. Coated wells were blocked with 5% skim milk in PBS for 2 hours at room temperature, followed by 3 washes (1× PBS and 0.05% Tween 20). Cell-free supernatant samples and a serial dilution of purified human IgE (401152; Calbiochem, San Diego, Calif) were incubated overnight at 4°C. Wells were washed 3 times and incubated with 1 μg/mL biotinylated anti-human IgE (A18803; Invitrogen, Carlsbad, Calif) in 1% skim milk for 2 hours at room temperature. Subsequently, wells were washed 3 times and incubated with alkaline phosphatase streptavidin for 1 hour at room temperature. Plates were developed with p-nitrophenyl phosphate, and the reaction was stopped with 2N NaOH. ODs were measured at 405 nm (Multiskan FC; Thermo Scientific). A commercially available ELISpot kit (3810-2H; Mabtech, Stockholm, Sweden) was used for detection of IgE-secreting cells. On day 11 of culture, samples were plated in duplicates at 4 × 106 cells/mL. Plates were imaged with the ImmunoSpot S6 Analyzer, and spots were counted independently by 2 blinded investigators.Fig E2BCR analysis of single-sorted, putative IgE+ MBCs stained with commonly used methods demonstrates a non-IgE identity. A, Schematic of the experimental design. B, Gating strategy used with a basic IgE staining (upper) or stepwise exclusion (lower) method. C, BCR amplification with primers specific for IGHE or a mix (IgHGAM). Data are representative of 5 independent experiments (1-2 donors per experiment and 12-24 single-sorted cells per donor).View Large Image Figure ViewerDownload Hi-res image Download (PPT)Fig E3Assessment of cytotropic (IgG and/or IgA) and negative staining of IgE+ MBCs. A and C, Cytometric detection and sorting of class-switched MBCs from different gates. FMO, Fluorescence minus one control. B and D, BCR amplification with primers specific for IgE (IGHE) or a mix specific of IgG, IgA, and IgM (IgHGAM) of single-sorted cells. Data are representative of 2 independent experiments (2 donors per experiment and 12-18 single-sorted cells per donor).View Large Image Figure ViewerDownload Hi-res image Download (PPT)Table E1Patients' profilesDonor IDSexAgeSerum IgE (kIU/L)Atopic dermatitisClinical reactivity to peanutPeanut IgE (kU/L)Skin prick test (S/H/P)Nonallergic subjectsP001P003P007P009P014P021P025P026P030P031TP09TP10TP11MMMFMMFMMMMMM202323242221341924232305<596<5<5230454037912NANANANoNoNoNoNoNoNoNoNoNoNoNoNoNoNoNoNoNoNoNoNoNoNoNoNoNo<0.1<0.1<0.1<0.10.34<0.1<0.10.11<0.1<0.1NANANA2/5/21/3/11/4/11/4/12/5/21/4/21/5/11/6/11/4/11/5/1NANANAPatients with atopic dermatitisP006P034P035P036FFMF233953205430376023706350YesYesYesYesYesNoNoNo13.4810.29NANA1/4/5NANANAPatients with peanut allergyP008P011P013P016P017P020P024P028P029MMMMMMMMF32192021222660252313021089091120256372711NoNoNoNoNoNoNoNoNoYesYesYesYesYesYesYesYesYes15.870.6628.091.6643.287.565.541.113.791/4/71/5/71/5/41/4/81/4/101/4/121/4/101/4/71/4/6F, Female; M, male; NA, not available; S/H/P, saline/histamine/peanut. Open table in a new tab F, Female; M, male; NA, not available; S/H/P, saline/histamine/peanut.