Hypoxic Growth Conditions Research Articles

Expanding the Reactive Sulfur Metabolome: Intracellular and Efflux Measurements of Small Oxoacids of Sulfur (SOS) and H2S in Human Primary Vascular Cell Culture.

Hydrogen sulfide (H2S) is an endogenous signaling molecule which is important for cardiovascular health, but its mechanism of action remains poorly understood. Here, we report measurements of H2S as well as its oxidized metabolites, termed small oxoacids of sulfur (SOS = HSOH and HOSOH), in four human primary vascular cell lines: smooth muscle and endothelial cells derived from both human arterial and coronary tissues. We use a methodology that targets small molecular weight sulfur species; mass spectrometric analysis allows for species quantification to report cellular concentrations based on an H2S calibration curve. The production of H2S and SOS is orders of magnitude higher in smooth muscle (nanomolar) as compared to endothelial cell lines (picomolar). In all the primary lines measured, the distributions of these three species were HOSOH >H2S > HSOH, with much higher SOS than seen previously in non-vascular cell lines. H2S and SOS were effluxed from smooth muscle cells in higher concentrations than endothelial cells. Aortic smooth muscle cells were used to examine changes under hypoxic growth conditions. Hypoxia caused notable increases in HSOH and ROS, which we attribute to enhanced sulfide quinone oxidase activity that results in reverse electron transport.

CRISPR Generated SIX6 and POU4F2 Reporters Allow Identification of Brain and Optic Transcriptional Differences in Human PSC-Derived Organoids.

Human pluripotent stem cells (PSCs) represent a powerful tool to investigate human eye development and disease. When grown in 3D, they can self-assemble into laminar organized retinas; however, variation in the size, shape and composition of individual organoids exists. Neither the microenvironment nor the timing of critical growth factors driving retinogenesis are fully understood. To explore early retinal development, we developed a SIX6-GFP reporter that enabled the systematic optimization of conditions that promote optic vesicle formation. We demonstrated that early hypoxic growth conditions enhanced SIX6 expression and promoted eye formation. SIX6 expression was further enhanced by sequential inhibition of Wnt and activation of sonic hedgehog signaling. SIX6 + optic vesicles showed RNA expression profiles that were consistent with a retinal identity; however, ventral diencephalic markers were also present. To demonstrate that optic vesicles lead to bona fide “retina-like” structures we generated a SIX6-GFP/POU4F2-tdTomato dual reporter line that labeled the entire developing retina and retinal ganglion cells, respectively. Additional brain regions, including the hypothalamus and midbrain-hindbrain (MBHB) territories were identified by harvesting SIX6 + /POU4F2- and SIX6- organoids, respectively. Using RNAseq to study transcriptional profiles we demonstrated that SIX6-GFP and POU4F2-tdTomato reporters provided a reliable readout for developing human retina, hypothalamus, and midbrain/hindbrain organoids.

Reactive oxygen species in cancer: a paradox between pro- and anti-tumour activities.

Cancer constitutes a group of heterogeneous diseases that share common features. They involve the existence of altered cellular pathways which result in uncontrolled cell proliferation. Deregulation of production and/or elimination of reactive oxygen species (ROS) appear to be a relevant issue in most of them. ROS have a dual role in cell metabolism: they are compromised in normal cellular homeostasis, but their overproduction has been reported to promote oxidative stress (OS), a process that may induce the damage of cell structures. ROS accumulation is implicated in the activation of signaling pathways that promote cell proliferation and metabolic adaptations to tumour growth. One characteristic of cancer cells is the sensitivity to OS, which often results from the combination of high anabolic needs and hypoxic growth conditions. However, there is still no clear evidence about the levels of oxidant species that promote cellular transformation or, otherwise, if OS induction could be adequate as an antitumour therapeutic tool. There is a need for novel therapeutic strategies based on the new knowledge of cancer biology. Targeting oncogenic molecular mechanisms with non-classical agents and/or natural compounds would be beneficial as chemoprevention or new adjuvant therapies. In addition, epigenetics and environment, and particularly dietary factors may influence the development and prevention of cancer. This article will present a revision of the current research about molecular aspects proposed to be involved in the anticancer features of oxidant and antioxidant-based therapies targeting cancer cells, and their participation in the balance of oxidative species and cancer cell death.

Hypoxia-Induced Adaptations of miRNomes and Proteomes in Melanoma Cells and Their Secreted Extracellular Vesicles.

Reduced levels of intratumoural oxygen are associated with hypoxia-induced pro-oncogenic events such as invasion, metabolic reprogramming, epithelial–mesenchymal transition, metastasis and resistance to therapy, all favouring cancer progression. Small extracellular vesicles (EV) shuttle various cargos (proteins, miRNAs, DNA and others). Tumour-derived EVs can be taken up by neighbouring or distant cells in the tumour microenvironment, thus facilitating intercellular communication. The quantity of extracellular vesicle secretion and their composition can vary with changing microenvironmental conditions and disease states. Here, we investigated in melanoma cells the influence of hypoxia on the content and number of secreted EVs. Whole miRNome and proteome profiling revealed distinct expression patterns in normoxic or hypoxic growth conditions. Apart from the well-known miR-210, we identified miR-1290 as a novel hypoxia-associated microRNA, which was highly abundant in hypoxic EVs. On the other hand, miR-23a-5p and -23b-5p were consistently downregulated in hypoxic conditions, while the protein levels of the miR-23a/b-5p-predicted target IPO11 were concomitantly upregulated. Furthermore, hypoxic melanoma EVs exhibit a signature consisting of six proteins (AKR7A2, DDX39B, EIF3C, FARSA, PRMT5, VARS), which were significantly associated with a poor prognosis for melanoma patients, indicating that proteins and/or miRNAs secreted by cancer cells may be exploited as biomarkers.

Mesenchymal stem cell-derived exosomes ameliorate cardiomyocyte apoptosis in hypoxic conditions through microRNA144 by targeting the PTEN/AKT pathway

BackgroundA growing body of evidence suggests that stem cell-derived exosomal microRNAs (miRNAs) could be a promising cardioprotective therapy in the context of hypoxic conditions. The present study aims to explore how miRNA-144 (miR-144), a miRNA contained in bone marrow mesenchymal stem cell (MSC)-derived exosomes, exerts a cardioprotective effect on cardiomyocyte apoptosis in the context of hypoxic conditions and identify the underlying mechanisms.MethodsMSCs were cultured using the whole bone marrow adherent method. MSC-derived exosomes were isolated using the total exosome isolation reagent and confirmed by nanoparticle trafficking analysis as well as western blotting using TSG101 and CD63 as markers. The hypoxic growth conditions for the H9C2 cells were established using the AnaeroPack method. Treatment conditions tested included H9C2 cells pre-incubated with exosomes, transfected with miR-144 mimics or inhibitor, or treated with the PTEN inhibitor SF1670, all under hypoxic growth conditions. Cell apoptosis was determined by flow cytometry using 7-ADD and Annexin V together. The expression levels of the miRNAs were detected by real-time PCR, and the expression levels of AKT/p-AKT, Bcl-2, caspase-3, HIF-1α, PTEN, and Rac-1 were measured by both real-time PCR and western blotting.ResultsExosomes were readily internalized by H9C2 cells after co-incubation for 12 h. Exosome-mediated protection of H9C2 cells from apoptosis was accompanied by increasing levels of p-AKT. MiR-144 was found to be highly enriched in MSC-derived exosomes. Transfection of cells with a miR-144 inhibitor weakened exosome-mediated protection from apoptosis. Furthermore, treatment of cells grown in hypoxic conditions with miR-144 mimics resulted in decreased PTEN expression, increased p-AKT expression, and prevented H9C2 cell apoptosis, whereas treatment with a miR-144 inhibitor resulted in increased PTEN expression, decreased p-AKT expression, and enhanced H9C2 cell apoptosis in hypoxic conditions. We also validated that PTEN was a target of miR-144 by using luciferase reporter assay. Additionally, cells treated with SF1670, a PTEN-specific inhibitor, resulted in increased p-AKT expression and decreased H9C2 cell apoptosis.ConclusionsThese findings demonstrate that MSC-derived exosomes inhibit cell apoptotic injury in hypoxic conditions by delivering miR-144 to cells, where it targets the PTEN/AKT pathway. MSC-derived exosomes could be a promising therapeutic vehicle to facilitate delivery of miRNA therapies to ameliorate ischemic conditions.

Ifu5, a WW domain-containing protein interacts with Efg1 to achieve coordination of normoxic and hypoxic functions to influence pathogenicity traits in Candida albicans.

Hypoxic adaptation pathways, essential for Candida albicans pathogenesis, are tied to its transition from a commensal to a pathogen. Herein, we identify a WW domain-containing protein, Ifu5, as a determinant of hypoxic adaptation that also impacts normoxic responses in this fungus. Ifu5 activity supports glycosylation homeostasis via the Cek1 mitogen-activated protein kinase-dependent up-regulation of PMT1, under normoxia. Transcriptome analysis of ifu5Δ/Δ under normoxia shows a significant up-regulation of the hypoxic regulator EFG1 and EFG1-dependent genes. We demonstrate physical interaction between Ifu5 by virtue of its WW domain and Efg1 that represses EFG1 expression under normoxia. This interaction is lost under hypoxic growth conditions, relieving EFG1 repression. Hypoxic adaptation processes such as filamentation and biofilm formation are affected in ifu5Δ/Δ cells revealing the role of Ifu5 in hypoxic signalling and modulating pathogenicity traits of C. albicans under varied oxygen conditions. Additionally, the WW domain of Ifu5 facilitates its role in hypoxic adaptation, revealing the importance of this domain in providing a platform to integrate various cellular processes. These data forge a relationship between Efg1 and Ifu5 that fosters the role of Ifu5 in hypoxic adaptation thus illuminating novel strategies to undermine the growth of C. albicans.

The ‘missing’ gastric microbe; the impact of gastric cancer-associated microbiota on Helicobacter pylori growth in vitro and its implications in gastric carcinogenesis

In recent years, multiple studies have examined the bacterial communities present in the gastric microbiota during the progression to gastric cancer (GC). Although Helicobacter pylori is the biggest risk factor for GC, the microbiota of GC comprises a decreased load of H. pylori and an enrichment of bacteria, such as Prevotella spp., Veillonella spp., Actinomyces spp. However, interactions between H. pylori and these cancer-associated bacteria is hugely understudied. Here, we have used hypoxic growth conditions (5 % O2) to investigate polymicrobial interactions between cancer-associated bacteria and H. pylori in vitro. We found that whilst the co-culture of H. pylori with Prevotella spp. and Veillonella spp. had no effect on growth of either bacteria, Actinomyces oris completely inhibited the growth of H. pylori. Moreover, A. oris did not inhibit the growth of other Gram-negative pathogens such as Salmonella Typhimurium and E. coli, whilst there was a slight growth inhibition of Campylobacter jejuni. Furthermore, ultrafiltration of A. oris culture supernatants revealed that inhibition is mediated by a secreted factor larger than 5 kDa, which can be heat inactivated. Interestingly, Actinomyces viscosus can also specifically kill H. pylori suggesting that this inhibition could be conserved across the Actinomyces genus. We are currently identifying the inhibitory factor responsible for inhibiting H. pylori growth. Furthermore, we are investigating whether A. oris can clear gastric H. pylori infection in a mouse model of infection and the implications of this on gastric carcinogenesis. In conclusion, whilst data-rich microbiota studies continue to thrive, it is imperative that we understand the mechanisms underpinning changes to the gastric microbiota and whether these bacteria are drivers or ‘passengers’ of gastric carcinogenesis.

Hypoxia Promotes Resistance to EGFR Inhibition in NSCLC Cells via the Histone Demethylases, LSD1 and PLU-1.

The development of small-molecule tyrosine kinase inhibitors (TKI) specific for epidermal growth factor receptors (EGFR) with activating mutations has led to a new paradigm in the treatment of non-small cell lung cancer (NSCLC) patients. However, most patients eventually develop resistance. Hypoxia is a key microenvironmental stress in solid tumors that is associated with poor prognosis due, in part, to acquired resistance to conventional therapy. This study documents that long-term, moderate hypoxia promotes resistance to the EGFR TKI, gefitinib, in the NSCLC cell line HCC827, which harbors an activating EGFR mutation. Following hypoxic growth conditions, HCC827 cells treated with gefitinib upregulated N-cadherin, fibronectin, and vimentin expression and downregulated E-cadherin, characteristic of an epithelial-mesenchymal transition (EMT), which prior studies have linked to EGFR TKI resistance. Mechanistically, knockdown of the histone demethylases, LSD1 and PLU-1, prevented and reversed hypoxia-induced gefitinib resistance, with inhibition of the associated EMT, suggesting that LSD1 and PLU-1 play key roles in hypoxia-induced gefitinib resistance and EMT. Moreover, hypoxia-treated HCC827 cells demonstrated more aggressive tumor growth in vivo compared with cells grown in normoxia, but inhibition of LSD1 function by shRNA-mediated knockdown or by the small-molecular inhibitor SP2509 suppressed tumor growth and enhanced gefitinib response in vivo These results suggest that hypoxia is a driving force for acquired resistance to EGFR TKIs through epigenetic change and coordination of EMT in NSCLC. This study suggests that combination of therapy with EGFR TKIs and LSD1 inhibitors may offer an attractive therapeutic strategy for NSCLCs. Mol Cancer Res; 16(10); 1458-69. ©2018 AACR.

Oxygen-sensitive interactions between glycolytic enzymes and a cancer-testis antigen established signalling scaffold are regulated by lysine acetylation

Reactivation of the male gametogenic expression program is tightly associated with the most malignant and metastasis-prone tumors and the emergence of aggressive sub-clones of tumor cells, which are highly resistant to stress-induced apoptosis. While the cancer-testis antigens (CTAs) CABYR and AKAP3/4 roles during gametogenesis and their importance for flagellar movement have gradually emerged, their function in cancer cells has remained obscure. In this study, we combine immunoprecipitation (IP), mass spectrometry (MS), and Western blot (WB) analysis to unravel their functional roles in therapy-resistant lung and ovary adenocarcinoma cells by identifying their interaction partners. CABYR variants were shown to oligomerize and interact with AKAP proteins to generate an HMW signal scaffold structure, which was found to bind several glycolytic enzymes and signal transducers. Forward and reverse IP experiments followed by WB confirmed interactions between CABYR and LDH, ALDO, PFK, TPI-1, GAPDH, ENO-1, and GSK3b. The transition from normoxic to hypoxic growth conditions disrupted the associations between glycolytic enzymes and the CABYR-AKAP signaling scaffold in the cancer cells, leading to a 3.2-fold increase in their production and secretion of lactic acid. Hypoxic growth conditions resulted in increased acetylation of lysine residues in both CTAs and triggered deacetylation of lysines in LDH and aldolase.

Abstract 433: Glycogen accumulation in aggressive breast cancers during hypoxic exposure

Abstract Isolation of specific metabolic alterations in aggressive triple negative and inflammatory breast cancers represents a compelling avenue for the development of treatments for these diseases. The ability of cancer to utilize diverse metabolic pathways to modulate increased survival and proliferation is well established. Indeed, we have previously described a series of metabolic adaptations in the triple negative inflammatory breast cancer cell line SUM149 and demonstrated a role for the small GTPase RhoC in the metabolic phenotype of the cell line. In this work we seek to describe a survival mechanism for cancer cells that are subjected to hypoxic environments. Hypoxic survival or growth is often necessitated at the center of a growing tumor mass or if the tumor is growing in the lymphatic system, as is often the case for inflammatory breast cancers. Here we investigate the regulation of glycogen levels in breast cancer and normal-like cell lines in atmospheric and 1% oxygen environments. Reserves of glucose are typically stored in liver and muscle cells as the polysaccharide glycogen. Elevated levels of glycogen have previously been observed in various cancers, and recent studies have implicated the importance of glycogen metabolism in promoting cancer cell survival. We hypothesize that aggressive breast cancers utilize modifications of the glycogen synthesis and degradation pathways to provide nutritional flexibility as they proliferate and invade into diverse environments. MCF10A, SUM149, and SUM190 cell lines demonstrate a greater than 10-fold increase in glycogen accumulation when subjected to hypoxic growth conditions. MDA-MB-231 cells also increase glycogen storage, though at levels on the order of 2-3 times higher in hypoxia when compared to normoxic growth. Conditioned media for all cell lines in normoxic and hypoxic conditions were analyzed for glucose and lactate levels to determine changes in metabolite consumption. The data presented indicate an unexpected accumulation of glycogen in response to hypoxic conditions. Studies to determine the mechanisms through which these changes occur and why they are important for continued survival and growth of the cancer cells are ongoing and will be presented. Citation Format: Megan Altemus, Joel Yates, ZhiFen Wu, LiWei Bao, Sofia Merajver. Glycogen accumulation in aggressive breast cancers during hypoxic exposure [abstract]. In: Proceedings of the American Association for Cancer Research Annual Meeting 2017; 2017 Apr 1-5; Washington, DC. Philadelphia (PA): AACR; Cancer Res 2017;77(13 Suppl):Abstract nr 433. doi:10.1158/1538-7445.AM2017-433

Pseudomonas aeruginosa Aggregate Formation in an Alginate Bead Model System Exhibits In Vivo -Like Characteristics

ABSTRACTAlginate beads represent a simple and highly reproducible in vitro model system for diffusion-limited bacterial growth. In this study, alginate beads were inoculated with Pseudomonas aeruginosa and followed for up to 72 h. Confocal microscopy revealed that P. aeruginosa formed dense clusters similar in size to in vivo aggregates observed ex vivo in cystic fibrosis lungs and chronic wounds. Bacterial aggregates primarily grew in the bead periphery and decreased in size and abundance toward the center of the bead. Microsensor measurements showed that the O2 concentration decreased rapidly and reached anoxia ∼100 μm below the alginate bead surface. This gradient was relieved in beads supplemented with NO3− as an alternative electron acceptor allowing for deeper growth into the beads. A comparison of gene expression profiles between planktonic and alginate-encapsulated P. aeruginosa confirmed that the bacteria experienced hypoxic and anoxic growth conditions. Furthermore, alginate-encapsulated P. aeruginosa exhibited a lower respiration rate than the planktonic counterpart and showed a high tolerance toward antibiotics. The inoculation and growth of P. aeruginosa in alginate beads represent a simple and flexible in vivo-like biofilm model system, wherein bacterial growth exhibits central features of in vivo biofilms. This was observed by the formation of small cell aggregates in a secondary matrix with O2-limited growth, which was alleviated by the addition of NO3− as an alternative electron acceptor, and by reduced respiration rates, as well as an enhanced tolerance to antibiotic treatment.IMPORTANCE Pseudomonas aeruginosa has been studied intensively for decades due to its involvement in chronic infections, such as cystic fibrosis and chronic wounds, where it forms biofilms. Much research has been dedicated to biofilm formation on surfaces; however, in chronic infections, most biofilms form small aggregates of cells not attached to a surface, but embedded in host material. In this study, bacteria were encapsulated in small alginate beads and formed aggregates similar to what is observed in chronic bacterial infections. Our findings show that aggregates are exposed to steep oxygen gradients, with zones of oxygen depletion, and that nitrate may serve as an alternative to oxygen, enabling growth in oxygen-depleted zones. This is important, as slow growth under low-oxygen conditions may render the bacteria tolerant toward antibiotics. This model provides an alternative to surface biofilm models and adds to the comprehension that biofilms do not depend on a surface for formation.

Abstract 611: A complex 3D model of glioblastoma for patient-specific drug response profiling

Abstract Approximately 70,000 new cases of brain tumors will be diagnosed this year with glioblastoma (GBM) accounting for about 17% of those cases. Unfortunately the median survival for patients with GBM is only 14.6 months due to the complexity of the tumor, the pattern of diffuse spread within the brain, and the lack of effective therapeutic options. Complex in vitro tumor models developed in 3D better mimic in vivo biology, and, when utilizing patient-derived cells, may offer robust platforms for new drug development and patient-specific drug response profiling. We have previously shown this to be true with both breast and ovarian cancer and we have adopted this approach to modelling GBM ex vivo. We hypothesize that primary derived GBM tissues and stem cells cultured in complex 3D microenvironments can recapitulate the intra-tumor heterogeneity and drug resistance similar to that found in the clinical. To this end, we have developed 3D models of GBM that incorporate tumor cells, endothelial cells, and macrophages within a complex extracellular matrix and cultured them for up to 2 weeks under perfusion flow. We have created these models using both cell lines and primary patient cells and these 3D tissues have been analyzed for changes in viability (PrestoBlue and PicoGreen), marker expression (flow cytometry, Luminex, and protein arrays), macrophage differentiation and invasion (flow cytometry, multiphoton microscopy, and IHC), and methylation patterns (ChIP on chip arrays and methylation specific PCR). Initial optimization work using cell lines has revealed that culturing with endothelial cells and/or macrophages has an effect upon proliferation dependent upon the differentiation state of the macrophages. Additionally, co-culture conditions affect protein secretion and phosphorylation along with patterns of gene methylation. We have also examined how changes in the tumor microenvironment affect these different metrics by examining the role of hypoxic growth conditions. Work using patient cells isolated from primary glioblastoma has focused upon drug response dependent upon the tumor microenvironment and the presence of cancer stem cells utilizing a neurosphere generation assay. We have demonstrated temozolamide resistance in tumors with early relapse after initial chemo-radiation, and sensitivity to EGFR inhibitor afatanib in tumors with EGFR amplication, suggesting clinical and molecular correlation or our ex vivo 3D drug response profiling using patient derived GBM models. Taken together, our data support the further development and use of complex, 3D co-cultures to better mimic GBM in a patient-specific manner. These models are currently being considered for preclinical assessment of novel therapies, including chimeric antigen receptor T cells, and may be a useful adjunct in precision medicine applications to improve patient outcomes. Citation Format: Tessa DesRochers, Lillia Holmes, Lauren O’Donnell, Qi Guo, David Schammel, Jeff Edenfield, Charles C. Kanos, Hal E. Crosswell. A complex 3D model of glioblastoma for patient-specific drug response profiling. [abstract]. In: Proceedings of the 107th Annual Meeting of the American Association for Cancer Research; 2016 Apr 16-20; New Orleans, LA. Philadelphia (PA): AACR; Cancer Res 2016;76(14 Suppl):Abstract nr 611.

Effects of 2-methoxyestradiol on apoptosis and HIF-1α and HIF-2α expression in lung cancer cells under normoxia and hypoxia.

Hypoxic tumor cells are known to be more resistant to conventional chemotherapy and radiation than normoxic cells. However, the effects of 2-methoxyestradiol (2-ME), an anti-angiogenic, antiproliferative and pro-apoptotic drug, on hypoxic lung cancer cells are unknown. The aim of the present study was to compare the effects of 2-ME on cell growth, apoptosis, hypoxia-inducible factor 1α (HIF-1α) and HIF-2α gene and protein expression in A549 cells under normoxic and hypoxic conditions. To establish the optimal 2-ME concentration with which to carry out the apoptosis assay and to examine mRNA and protein expression of HIFs, cell growth analysis was carried out through N-hexa-methylpararosaniline staining assays in A549 cell cultures treated with one of five different 2-ME concentrations at different times under normoxic or hypoxic growth conditions. The 2-ME concentration of 10 mM at 72 h was selected to perform all further experiments. Apoptotic cells were analyzed by flow cytometry. Western blotting was used to determine HIF-1α and HIF-2α protein expression in total cell extracts. Cellular localization of HIF-1α and HIF-2α was assessed by immunocytochemistry. HIF-1α and HIF-2α gene expression was determined by real-time PCR. A significant increase in the percentage of apoptosis was observed when cells were treated with 2-ME under a normoxic but not under hypoxic conditions (p=0.006). HIF-1α and HIF-2α protein expression levels were significantly decreased in cells cultured under hypoxic conditions and treated with 2-ME (p<0.001). Furthermore, 2-ME decreased the HIF-1α and HIF-2α nuclear staining in cells cultured under hypoxia. The HIF-1α and HIF-2α mRNA levels were significantly lower when cells were exposed to 2-ME under normoxia and hypoxia. Our results suggest that 2-ME could have beneficial results when used with conventional chemotherapy in an attempt to lower the invasive and metastatic processes during cancer development due to its effects on the gene expression and protein synthesis of HIFs.

Abstract 4417: Vatalanib targets ABCG2-overexpressing multidrug resistant colon cancer cells under hypoxia

Abstract Cancer microenvironment is characterized by significantly lower oxygen concentration. This hypoxic condition is known to reduce drug responsiveness to cancer chemotherapy via multiple mechanisms, among which the upregulation of an efflux transporter ABCG2 confers resistance to a wide variety of structurally unrelated anticancer drugs. Vatalanib (PTK787) is a multitargeted tyrosine kinase inhibitor for VEGFR2, Flt and c-Kit, which exhibit potent anticancer activity in vitro and in vivo. We investigated the potentiation effect of vatalanib on the anticancer activity of conventional cytotoxic drugs in colon cancer cell lines under both normoxic and hypoxic growth conditions. More significant synergistic anticancer activity was observed under hypoxic condition. Mechanistically, vatalanib was found to inhibit ABCG2 and P-gp efflux activity, probably by acting as an uncompetitive inhibitor and interfering with their ATPase activity. Under hypoxic growth condition, ABCG2-overexpressing cells sorted out by FACS technique as side population cells (SP) were found to be significantly more responsive to irinotecan (an ABCG2 substrate anticancer drug) in the presence of vatalanib. The colony formation capactiy of these SP cells was remarkably reduced upon treatment with a combination of irinotecan and vatalanib, compared to irinotecan alone. However, vatalanib, at concentrations that produced the circumvention of ABCG2-mediated resistance, did not appreciably alter ABCG2 mRNA or protein expression levels or the phosphorylation of Akt and extracellular signal-regulated kinase 1/2 (ERK1/2). Vatalanib was also evaluated for potential interference with the cytochrome P450 metabolic enzymes by a rapid N-in-one in vitro interaction screening assay. The result indicates that vatalanib is only a mild inhibitor of both CYP34A and CYP2D, two major drug-metabolizing P450 enzymes, which presumably may avoid the undesirable drug-drug interactions in combination therapy. Our study thus advocates the further investigation of vatalanib for use in combination chemotherapy to circumvent hypoxia-mediated drug resistance. Citation Format: Kenneth K. To, Daniel C. Poon, Yuming Wei, Fang Wang, Ge Lin, Li-wu Fu. Vatalanib targets ABCG2-overexpressing multidrug resistant colon cancer cells under hypoxia. [abstract]. In: Proceedings of the 106th Annual Meeting of the American Association for Cancer Research; 2015 Apr 18-22; Philadelphia, PA. Philadelphia (PA): AACR; Cancer Res 2015;75(15 Suppl):Abstract nr 4417. doi:10.1158/1538-7445.AM2015-4417

Abstract 4327: Nek6 and Hif-1α cooperate with the cytoskeletal gateway of drug resistance to drive outcome in serous ovarian cancer

Abstract Hypoxia selects the most aggressive and drug-resistant clones in solid malignancies. One of the pivotal transcription factors induced by hypoxia is Hif-1α. However, in serous ovarian cancer (SEOC), Hif-1α expression is not a prognostic biomarker. This study aims to assess the hypothesis that the serine-threonine kinase Nek6 functions as a downstream effector cooperating with Hif-1α in driving ovarian cancer aggressiveness. Nek6 was overexpressed and Hif-1α was silenced in A2780 cells. Nek6 was also stably silenced in Hey cells. The dependence of Nek6 expression on Hif-1α was assayed as a function of hypoxic growth conditions. Nek6 interaction with the cytoskeletal gateway of drug resistance was investigated with far western blot. The co-expression of NEK6, HIF1A, TUBB3 and GBP1 transcripts was quantified with qPCR in two cohorts of SEOC patients (346 locally treated patients and 344 from the TCGA dataset). Nek6 expression is induced by hypoxia in a Hif-1α dependent fashion. Nek6 directly interacts with GBP-1, thus being a component of the cytoskeletal gateway of drug resistance. Nek6 overexpression increases and silencing decreases the anchorage-independent growth of cultured cells. In SEOC patients, NEK6 expression is significantly correlated with HIF1A. Co-expression of NEK6, HIF1A, TUBB3 and GBP1 transcripts identifies a subset of SEOC patients characterized by poor outcome and drug resistance. This study demonstrates the functional relevance of Nek6 in the context of the adaptive response to hypoxia in SEOC. This finding may help identify a sub-population of patients at high risk of relapse to standard first-line chemotherapy. Citation Format: Marta De Donato, Mara Fanelli, Marisa Mariani, Giuseppina Raspaglio, Deep Pandya, Shiquan He, Paul Fiedler, Marco Petrillo, Giovanni Scambia, Cristiano Ferlini. Nek6 and Hif-1α cooperate with the cytoskeletal gateway of drug resistance to drive outcome in serous ovarian cancer. [abstract]. In: Proceedings of the 106th Annual Meeting of the American Association for Cancer Research; 2015 Apr 18-22; Philadelphia, PA. Philadelphia (PA): AACR; Cancer Res 2015;75(15 Suppl):Abstract nr 4327. doi:10.1158/1538-7445.AM2015-4327

Stimulus-dependent differences in signalling regulate epithelial-mesenchymal plasticity and change the effects of drugs in breast cancer cell lines.

IntroductionThe normal process of epithelial mesenchymal transition (EMT) is subverted by carcinoma cells to facilitate metastatic spread. Cancer cells rarely undergo a full conversion to the mesenchymal phenotype, and instead adopt positions along the epithelial-mesenchymal axis, a propensity we refer to as epithelial mesenchymal plasticity (EMP). EMP is associated with increased risk of metastasis in breast cancer and consequent poor prognosis. Drivers towards the mesenchymal state in malignant cells include growth factor stimulation or exposure to hypoxic conditions.MethodsWe have examined EMP in two cell line models of breast cancer: the PMC42 system (PMC42-ET and PMC42-LA sublines) and MDA-MB-468 cells. Transition to a mesenchymal phenotype was induced across all three cell lines using epidermal growth factor (EGF) stimulation, and in MDA-MB-468 cells by hypoxia. We used RNA sequencing to identify gene expression changes that occur as cells transition to a more-mesenchymal phenotype, and identified the cell signalling pathways regulated across these experimental systems. We then used inhibitors to modulate signalling through these pathways, verifying the conclusions of our transcriptomic analysis.ResultsWe found that EGF and hypoxia both drive MDA-MB-468 cells to phenotypically similar mesenchymal states. Comparing the transcriptional response to EGF and hypoxia, we have identified differences in the cellular signalling pathways that mediate, and are influenced by, EMT. Significant differences were observed for a number of important cellular signalling components previously implicated in EMT, such as HBEGF and VEGFA.We have shown that EGF- and hypoxia-induced transitions respond differently to treatment with chemical inhibitors (presented individually and in combinations) in these breast cancer cells. Unexpectedly, MDA-MB-468 cells grown under hypoxic growth conditions became even more mesenchymal following exposure to certain kinase inhibitors that prevent growth-factor induced EMT, including the mTOR inhibitor everolimus and the AKT1/2/3 inhibitor AZD5363.ConclusionsWhile resulting in a common phenotype, EGF and hypoxia induced subtly different signalling systems in breast cancer cells. Our findings have important implications for the use of kinase inhibitor-based therapeutic interventions in breast cancers, where these heterogeneous signalling landscapes will influence the therapeutic response.Electronic supplementary materialThe online version of this article (doi:10.1186/s12964-015-0106-x) contains supplementary material, which is available to authorized users.

저산소와 NO 조건에서 Mycobacterium smegmatis의 adenylyl cyclase 유전자 발현

In Mycobacterium tuberculosis H37Rv 16 adenylyl cyclase (AC) genes have been identified, while 10 AC genes have been found in non-pathogenic Mycobacterium smegmatis. Expression of 6 AC genes (MSMEG_0218, MSMEG_3243, MSMEG_3780, MSMEG_4279, MSMEG_4477, and MSMEG_6154) among 10 AC genes in M. smegmatis was increased when M. smegmatis was subjected to hypoxic growth conditions. On the other hand, only MSMEG_3780 and MSMEG_4279 were slightly induced in the presence of NO. The cAMP levels in cells and culture media were 450and 9.8-fold increased, respectively, when M. smegmatis was grown under hypoxic conditions relative to those grown aerobically. Intracellular levels of cAMP were increased 5.8-fold on the exposure to NO. The DevSR two-component system is known to be involved in the induction of many genes whose expression is induced under hypoxic conditions and in the presence of NO. Expression of 6 hypoxically induced AC genes was observed to be induced in a devR deletion mutant grown under hypoxic conditions, indicating that the induction of the 6 AC genes under hypoxic conditions is independent of the DevSR two-component system. In order to identify a trans-acting regulatory element that is pertinent in the hypoxic induction of MSMEG_3780, ligand-fishing analysis was performed using the upstream DNA of MSMEG_3780 and MSMEG_5136 protein was identified.

Immunosuppressive capabilities of mesenchymal stromal cells are maintained under hypoxic growth conditions and after gamma irradiation

Background aimsThe discovery of regenerative and immunosuppressive capacities of mesenchymal stromal cells (MSCs) raises hope for patients with tissue-damaging or severe, treatment-refractory autoimmune disorders. We previously presented a method to expand human MSCs in a bioreactor under standardized Good Manufacturing Practice conditions. Now we characterized the impact of critical treatment conditions on MSCs with respect to immunosuppressive capabilities and proliferation. MethodsMSC proliferation and survival after γ irradiation were determined by 5-carboxyfluorescein diacetate N-succinimidyl ester and annexinV/4′,6-diamidino-2-phenylindole (DAPI) staining, respectively. T-cell proliferation assays were used to assess the effect of γ irradiation, passaging, cryopreservation, post-thaw equilibration time and hypoxia on T-cell suppressive capacities of MSCs. Quantitative polymerase chain reaction and β-galactosidase staining served as tools to investigate differences between immunosuppressive and non-immunosuppressive MSCs. Resultsγ irradiation of MSCs abrogated their proliferation while vitality and T-cell inhibitory capacity were preserved. Passaging and long cryopreservation time decreased the T-cell suppressive function of MSCs, and postthaw equilibration time of 5 days restored this capability. Hypoxic culture markedly increased MSC proliferation without affecting their T-cell-suppressive capacity and phenotype. Furthermore, T-cell suppressive MSCs showed higher CXCL12 expression and less β-galactosidase staining than non-suppressive MSCs. DiscussionWe demonstrate that γ irradiation is an effective strategy to abrogate MSC proliferation without impairing the cells' immunosuppressive function. Hypoxia significantly enhanced MSC expansion, allowing for transplantation of MSCs with low passage number. In summary, our optimized MSC expansion protocol successfully addressed the issues of safety and preservation of immunosuppressive MSC function after ex vivo expansion for therapeutic purposes.

Hypoxia-activated cytochrome bd expression in Mycobacterium smegmatis is cyclic AMP receptor protein dependent.

Mycobacteria are obligate aerobes and respire using two terminal respiratory oxidases, an aa3-type cytochrome c oxidase and a cytochrome bd-type menaquinol oxidase. Cytochrome bd is encoded by cydAB from the cydABDC gene cluster that is conserved throughout the mycobacterial genus. Here we report that cydAB and cydDC in Mycobacterium smegmatis constitute two separate operons under hypoxic growth conditions. The transcriptional start sites of both operons were mapped, and a series of cydA-lacZ and cydD-lacZ transcriptional reporter fusions were made to identify regulatory promoter elements. A 51-bp region was identified in the cydAB promoter that was required for maximal cydA-lacZ expression in response to hypoxia. A cyclic AMP receptor protein (CRP)-binding site (viz. GTGAN6CCACC) was identified in this region, and mutation of this site to CCCAN6CTTTC abolished cydA-lacZ expression in response to hypoxia. Binding of purified CRP (MSMEG_0539) to the cydAB promoter DNA was analyzed using electrophoretic mobility shift assays. CRP binding was dependent on GTGAN6CCACC and showed cyclic AMP (cAMP) dependency. No CRP site was present in the cydDC promoter, and a 10-bp inverted repeat (CGGTGGTACCGGTACCACCG) was required for maximal cydD-lacZ expression. Taken together, the data indicate that CRP is a direct regulator of cydAB expression in response to hypoxia and that the regulation of cydDC expression is CRP independent and under the control of an unknown regulator.

Modeling the Transcriptional Regulatory Network That Controls the Early Hypoxic Response in Candida albicans

We determined the changes in transcriptional profiles that occur in the first hour following the transfer of Candida albicans to hypoxic growth conditions. The impressive speed of this response is not compatible with current models of fungal adaptation to hypoxia that depend on the depletion of sterol and heme. Functional analysis using Gene Set Enrichment Analysis (GSEA) identified the Sit4 phosphatase, Ccr4 mRNA deacetylase, and Sko1 transcription factor (TF) as potential regulators of the early hypoxic response. Cells mutated in these and other regulators exhibit a delay in their transcriptional responses to hypoxia. Promoter occupancy data for 29 TFs were combined with the transcriptional profiles of 3,111 in vivo target genes in a Network Component Analysis (NCA) to produce a model of the dynamic and highly interconnected TF network that controls this process. With data from the TF network obtained from a variety of sources, we generated an edge and node model that was capable of separating many of the hypoxia-upregulated and -downregulated genes. Upregulated genes are centered on Tye7, Upc2, and Mrr1, which are associated with many of the gene promoters that exhibit the strongest activations. The connectivity of the model illustrates the high redundancy of this response system and the challenges that lie in determining the individual contributions of specific TFs. Finally, treating cells with an inhibitor of the oxidative phosphorylation chain mimics most of the early hypoxic profile, which suggests that this response may be initiated by a drop in ATP production.