Hyphenated Dyad Symmetry Research Articles

Lactate Utilization Is Regulated by the FadR-Type Regulator LldR in Pseudomonas aeruginosa

NAD-independent L-lactate dehydrogenase (l-iLDH) and NAD-independent D-lactate dehydrogenase (D-iLDH) activities are induced coordinately by either enantiomer of lactate in Pseudomonas strains. Inspection of the genomic sequences of different Pseudomonas strains revealed that the lldPDE operon comprises 3 genes, lldP (encoding a lactate permease), lldD (encoding an L-iLDH), and lldE (encoding a D-iLDH). Cotranscription of lldP, lldD, and lldE in Pseudomonas aeruginosa strain XMG starts with the base, C, that is located 138 bp upstream of the lldP ATG start codon. The lldPDE operon is located adjacent to lldR (encoding an FadR-type regulator, LldR). The gel mobility shift assays revealed that the purified His-tagged LldR binds to the upstream region of lldP. An XMG mutant strain that constitutively expresses D-iLDH and L-iLDH was found to contain a mutation in lldR that leads to an Ile23-to-serine substitution in the LldR protein. The mutated protein, LldR(M), lost its DNA-binding activity. A motif with a hyphenated dyad symmetry (TGGTCTTACCA) was identified as essential for the binding of LldR to the upstream region of lldP by using site-directed mutagenesis. L-Lactate and D-lactate interfered with the DNA-binding activity of LldR. Thus, L-iLDH and D-iLDH were expressed when the operon was induced in the presence of L-lactate or D-lactate.

Regulation of L-lactate utilization by the FadR-type regulator LldR of Corynebacterium glutamicum.

Corynebacterium glutamicum can grow on L-lactate as a sole carbon and energy source. The NCgl2816-lldD operon encoding a putative transporter (NCgl2816) and a quinone-dependent L-lactate dehydrogenase (LldD) is required for L-lactate utilization. DNA affinity chromatography revealed that the FadR-type regulator LldR (encoded by NCgl2814) binds to the upstream region of NCgl2816-lldD. Overexpression of lldR resulted in strongly reduced NCgl2816-lldD mRNA levels and strongly reduced LldD activity, and as a consequence, a severe growth defect was observed in cells grown on L-lactate as the sole carbon and energy source, but not in cells grown on glucose, ribose, or acetate. Deletion of lldR had no effect on growth on these carbon sources but resulted in high NCgl2816-lldD mRNA levels and high LldD activity in the presence and absence of L-lactate. Purified His-tagged LldR bound to a 54-bp fragment of the NCgl2816-lldD promoter, which overlaps with the transcriptional start site determined by random amplification of cDNA ends-PCR and contains a putative operator motif typical of FadR-type regulators, which is -1TNGTNNNACNA10. Mutational analysis revealed that this motif with hyphenated dyad symmetry is essential for binding of LldD to the NCgl2816-lldD promoter. L-Lactate, but not D-lactate, interfered with binding of LldRHis to the NCgl2816-lldD promoter. Thus, during growth on media lacking L-lactate, LldR represses expression of NCgl2816-lldD. In the presence of L-lactate in the growth medium or under conditions leading to intracellular L-lactate accumulation, the L-lactate utilization operon is induced.

Systematic mutagenesis of the thymidine tract of the pyrBI attenuator and its effects on intrinsic transcription termination in Escherichia coli

The pyrBI attenuator of Escherichia coli is an intrinsic transcription terminator composed of DNA with a hyphenated dyad symmetry and an adjacent 8 bp T:A tract (T-tract). These elements specify a G+C-rich terminator hairpin followed by a run of eight uridine residues (U-tract) in the RNA transcript. In this study, we examined the effects on in vivo transcription termination of systematic base substitutions in the T/U-tract of the pyrBI attenuator. We found that these substitutions diminished transcription termination efficiency to varying extents, depending on the nature and position of the substitution. In general, substitutions closer to the dyad symmetry/terminator hairpin exhibited the most significant effects. Additionally, we examined the effects on in vivo transcription termination of mutations that insert from 1 to 4 bases between the terminator hairpin and U-tract specified by the pyrBI attenuator. Our results show an inverse relationship between termination efficiency and the number of bases inserted. The effects of the substitution and insertion mutations on termination efficiency at the pyrBI attenuator were also measured in vitro, which corroborated the in vivo results. Our results are discussed in terms of the current models for intrinsic transcription termination and estimating termination efficiencies at intrinsic terminators of other bacteria.

Identification of upstream sequences essential for activation of a bacteriophage P2 late promoter.

We have carried out a mutational scan of the upstream region of the bacteriophage P2 FETUD late operon promoter, P(F), which spans an element of hyphenated dyad symmetry that is conserved among all six of the P2 and P4 late promoters. All mutants were assayed for activation by P4 delta in vivo, by using a lacZ reporter plasmid, and a subset of mutants was assayed in vitro for delta binding. The results confirm the critical role of the three complementary nucleotides in each half site of the upstream element for transcription factor binding and for activation of transcription. A trinucleotide DNA recognition site is consistent with a model in which these transcription factors bind via a zinc finger motif. The mutational scan also led to identification of the -35 region of the promoter. Introduction of a sigma(70) -35 consensus sequence resulted in increased constitutive expression, which could be further stimulated by delta. These results indicate that activator binding to the upstream region of P2 late promoters compensates in part for poor sigma(70) contacts and helps to recruit RNA polymerase holoenzyme.

An upstream sequence element required for NucC-dependent expression of the Serratia marcescens extracellular nuclease.

The Serratia marcescens extracellular nuclease gene, nucA, is positively regulated by the product of the nucC gene. In this study, the upstream region required for NucC-dependent nuclease expression was defined by using fusions to the gene encoding chloramphenicol acetyltransferase (cat). This sequence includes an element of hyphenated dyad symmetry identified previously as the binding site for the P2 Ogr family of activators. Footprint analysis confirmed that members of this family of activator proteins bind to this site, protecting a region between -76 and -59 relative to the start of transcription. The activator binding site in the nucA promoter lies one turn of the helix upstream from the corresponding sites in the P2 and P4 late promoters. The effects of deletions between the downstream end of the activator binding site and the putative -35 region are consistent with a strict helical phasing requirement for activation.

Identification and characterization of the frog virus 3 DNA methyltransferase gene

Cytosine DNA methyltransferases (MTases) first recognize specific nucleotide sequences and then transfer a methyl group from S-adenosylmethionine to cytosine. This division of function is reflected in five highly conserved motifs shared by cytosine MTases. The region containing the first four motifs is responsible for the catalytic function whereas the region containing the fifth motif V provides specificity of binding to DNA. In at least one case, two separate proteins, one containing the first four motifs and the second containing the last motif combine to provide full functional activity. In the frog virus 3 (FV3) genome we have identified an open reading frame (ORF) whose deduced amino acid (aa) sequence contains motifs characteristic of prokaryotic as well as eukaryotic MTases. The ORF consists of 642 bp which codes for a protein of 214 aa with a predicted molecular mass of 24.8 kDa. This ORF contains the first four highly conserved motifs of cytosine MTases but the fifth motif, responsible for DNA binding specificity, is missing. Presumably, FV3 MTase is composed of two subunits. Northern blot analysis showed that the putative MTase ORF is transcribed into two transcripts belonging to the delayed-early class of FV3 messages. These two transcripts appear to be initiated at two different start sites but terminate in the same 3' region of the gene. The transcription start sites are not preceded by any known promoter sequences, but two regions of hyphenated dyad symmetry are present at the 3' end of the message. A protein with a molecular mass of approximately 28 kDa was synthesized by a rabbit reticulocyte lysate programmed with capped runoff transcripts from the cloned gene, suggesting that the ORF can be transcribed into a message coding for a viral protein. Overall, our results suggest that we have identified a gene for a subunit of MTase in the FV3 genome.

Purification, characterization and mode of action of PdhR, the transcriptional repressor of the pdhR–aceEF–Ipd operon of Escherichia coli

The repressor of the pdhR-aceEF-lpd operon of Escherichia coli, PdhR, was amplified to 23% of total cell protein and purified to homogeneity by heparin-agarose and cation-exchange chromatography. The purified protein is a monomer (M(r) 29,300) which binds specifically to DNA fragments containing the pdh promoter (Ppdh) in the absence of pyruvate. The pdh operator was identified by DNase I footprinting as a region of hyphenated dyad symmetry, +11AATTGGTaagACCAATT+27, situated just downstream of the transcript start site. In vitro transcription from Ppdh was repressed > 1000-fold by PdhR and this repression was antagonized in a concentration-dependent manner by its co-effector, pyruvate. Studies on RNA polymerase binding at Ppdh showed that RNA polymerase protects the -44 to +21 region in the absence of PdhR, but no RNA polymerase binding or protection upstream of +9 could be detected in the presence of PdhR. It is concluded that PdhR represses transcription by binding to an operator site centred at +19 such that effective binding of RNA polymerase is prevented.

A human histone H2B.1 variant gene, located on chromosome 1, utilizes alternative 3' end processing.

A variant human H2B histone gene (GL105), previously shown to encode a 2300 nt replication independent mRNA, has been cloned. We demonstrate this gene expresses alternative mRNAs regulated differentially during the HeLa S3 cell cycle. The H2B-Gl105 gene encodes both a 500 nt cell cycle dependent mRNA and a 2300 nt constitutively expressed mRNA. The 3' end of the cell cycle regulated mRNA terminates immediately following the region of hyphenated dyad symmetry typical of most histone mRNAs, whereas the constitutively expressed mRNA has a 1798 nt non-translated trailer that contains the same region of hyphenated dyad symmetry but is polyadenylated. The cap site for the H2B-GL105 mRNAs is located 42 nt upstream of the protein coding region. The H2B-GL105 histone gene was localized to chromosome region 1q21-1q23 by chromosomal in situ hybridization and by analysis of rodent-human somatic cell hybrids using an H2B-GL105 specific probe. The H2B-GL105 gene is paired with a functional H2A histone gene and this H2A/H2B gene pair is separated by a bidirectionally transcribed intergenic promoter region containing consensus TATA and CCAAT boxes and an OTF-1 element. These results demonstrate that cell cycle regulated and constitutively expressed histone mRNAs can be encoded by the same gene, and indicate that alternative 3' end processing may be an important mechanism for regulation of histone mRNA. Such control further increases the versatility by which cells can modulate the synthesis of replication-dependent as well as variant histone proteins during the cell cycle and at the onset of differentiation.

A frog virus 3 gene codes for a protein containing the motif characteristic of the INT family of integrases

The integrase (INT) family of bacteriophage coded integrase-recombinase proteins are responsible for catalyzing strand exchange between DNA molecules and play an important role in the DNA replication of many bacteriophages. Within the frog virus 3 (FV3) genome we have identified an open reading frame (ORF) of which the deduced amino acid sequence contains a motif characteristic of the INT family of integrases-recombinases. The ORF consists of 825 by which codes for a protein of 275 amino acids with a predicted M r of 29,945. RNA transcribed from this ORF during virus infection was detected by Northern blot analysis and it is a delayed early message of approximately 1100 bases. The 5′ and 3′ ends of the putative FV3 integrase-recombinase transcript were mapped. The transcriptional start site is preceded by a presumptive TATA box, and a region of hyphenated dyad symmetry is present at the 3′ end of the message. A protein with an M r of approximately 30,500 was synthesized by a rabbit reticulocyte lysate programmed with capped runoff transcripts from the cloned gene, indicating that the ORF can be transcribed into a message coding for a viral protein. In the FV3 life cycle, DNA replication occurs in a large complex formed through the recombination of small viral DNA molecules. Thus, at this stage, DNA replication and recombination are interlinked. Resolution of concatameric DNA is required for the packaging of genomes into virus particles. The putative FV3 INT gene may be involved in one or more of these functions.

Dual transcriptional initiation sites from the pyrC promoter control expression of the gene in Salmonella typhimurium

Expression of the Salmonella typhimurium pyrC gene encoding dihydroorotase is negatively regulated by CTP and stimulated by GTP. This regulation does not occur at the level of transcription initiation but appears to involve translation attenuation of the transcripts. Alterations of specific bases in a region of hyphenated dyad symmetry located in the leader established that base pairing in the 5' terminal region of the pyrC leader transcript is required for normal regulation of dihydroorotase synthesis. Primer extension experiments on RNA from mutant strains that permit manipulation of the CTP and GTP pools showed that pyrC transcription may start at either a cytosine or a guanine residue, 2 bp apart. The ratio between G-starts and C-starts appeared to be determined by the intracellular [GTP]/[CTP] pool ratio. The larger transcript, starting with a C, is able to form a stable hairpin in the 5' end, sequestering part of the ribosome binding site in the stem. The leader of the shorter transcript, however, cannot form this secondary structure. Thus, translational initiation will occur unhindered only from the shorter transcript.

Isolation and characterization of a cDNA from a human histone H2B gene which is reciprocally expressed in relation to replication-dependent H2B histone genes during HL60 cell differentiation

A variant human histone H2B cDNA (HHC289) has been cloned and characterized and shown to have a complex pattern of regulation with respect to the HeLa S3 cell cycle and HL60 cell differentiation. The H2B protein coding region of HHC289 is flanked at the 3' end by a 1798-nt nontranslated trailer that contains a region of hyphenated dyad symmetry and a poly(A) addition sequence, followed by a poly(A) tail. Nuclear run-on transcription analysis revealed a 2-fold increase in transcription of the HHC289 gene during S phase, in comparison to replication-dependent human histone genes which exhibit a 2-3-fold increase in transcription during S phase. Northern blot analysis indicated that the levels of the 2300-nt HHC289 mRNA species did not vary significantly during the HeLa S3 cell cycle, in comparison to replication-dependent H2B mRNAs which are elevated 15-fold during S phase. Northern blot analysis also revealed a reciprocal relationship during the onset of HL60 differentiation between the expression of the HHC289 H2B gene and the replication-dependent H2B genes. The levels of the 2300-nt HHC289 H2B species increased approximately 10-fold during HL60 cell differentiation whereas the levels of cell cycle dependent H2B mRNAs decreased to less than 1% of those in proliferating cells. These results suggest that complex transcriptional and posttranscriptional regulatory mechanisms control cellular levels of mRNAs from various human H2B histone genes during progression through the cell cycle and at the onset of differentiation.

Primary sequence of the Escherichia coli fadL gene encoding an outer membrane protein required for long-chain fatty acid transport

The fadL gene of Escherichia coli encodes an outer membrane protein (FadL) that plays a central role in the uptake of exogenous long-chain fatty acids. The nucleotide sequence of the fadL gene revealed a single open reading frame of 1,344 bp encoding a protein with 448 amino acid residues and a molecular weight of 48,831. The transcriptional start, analyzed by primer extension, was shown to be 95 bp upstream from the translational start. Apparent -10 and -35 regions were found at -12 and -37 bp upstream from the transcriptional start. Three regions with hyphenated dyad symmetry (two between the transcriptional start and the translational start and one upstream from the -10 and -35 regions) were identified that may play a role in the expression of fadL. The protein product of the fadL gene contained a signal sequence and signal peptidase I cleavage site similar to that defined for other E. coli outer membrane proteins. The N-terminal sequence of mature FadL protein was determined by automated amino acid sequencing of protein purified from the outer membrane of a strain harboring fadL under the control of a T7 RNA polymerase-responsive promoter. This amino acid sequence, Ala-Gly-Phe-Gln-Leu-Asn-Glu-Phe-Ser-Ser, verified the signal peptidase I cleavage site on pre-FadL and confirmed the N-terminal amino acid sequence of FadL predicted from the DNA sequence. Mature FadL contained 421 amino acid residues, giving a molecular weight of 45,969. The amino acid composition of FadL deduced from the DNA sequence suggested that this protein contained an abundance of hydrophobic amino acid residues and lacked cysteinyl residues. The hydrophobic amino acids within FadL were predicted to contribute to at least five regions of the protein with an overall hydrophobic character. The amino acid sequence of FadL was used to search GenBank for other proteins with amino acid sequence homology. These data demonstrated that FadL and the heat-modifiable outer membrane protein P1 of Haemophilus influenzae type b were 60.5% conserved and 42.0% identical over 438 amino acid residues.

Mutational analysis of a bacteriophage P4 late promoter

Transcription from the late Psid promoter of satellite bacteriophage P4 is dependent on the bacterial RNA polymerase carrying the sigma 70 subunit and is positively regulated by the product of the P4 delta gene or the ogr gene of helper bacteriophage P2. Through deletion and mutational analyses of the Psid promoter, we identified mutations in the -10 region and in a region of hyphenated dyad symmetry centered around position -55 that inactivate Psid. Most of these mutations alter base pairs that are highly conserved in the five other delta-activated P4 and P2 late promoters. We propose that the P4 delta and P2 ogr gene products bind the -55 region of the P4 and P2 late promoters.

Transcriptional regulation of the cytochrome b562-o complex in Escherichia coli. Gene expression and molecular characterization of the promoter.

Transcriptional regulation of the cyo operon coding for a terminal oxidase, the cytochrome b562-o complex, of the aerobic respiratory chain of Escherichia coli was studied using a chromosomal operon fusion technique with the lacZ gene. Expression of the cyo gene was found to be subject to catabolite repression and also to control by the oxygen concentration. Information on the mechanisms of these regulations was obtained by nucleotide sequencing of the regulatory region, which corresponds to the 5'-flanking region of the cyoA gene. A typical promoter sequence and two noteworthy composite structural features, that is, two potential catabolite gene activator protein-binding sites and a region of hyphenated dyad symmetry were found. The transcription start point was identified by primer extension analysis, confirming the promoter site in the nucleotide sequence. The homology search of the nucleotide sequence in the region of hyphenated dyad symmetry showed a conserved nucleotide sequence in six oxygen-regulated genes examined, which suggests that this is the consensus sequence for the regulation by oxygen.

Vitamin D-mediated modifications in protein-DNA interactions at two promoter elements of the osteocalcin gene.

By the combined use of DNase I footprinting, electrophoretic mobility-shift assay, and methylation interference analysis, we have identified a series of sequence-specific protein-DNA interactions in the 5' flanking region of the rat osteocalcin gene. Stimulation of osteocalcin gene expression by 1,25-dihydroxyvitamin D3, a physiologic mediator of this bone-specific gene in vitro and in vivo, is associated with modifications in the binding of ROS 17/2.8 cell nuclear factors to two promoter segments that up-regulate transcription. One segment located between -462 and -437 exhibits a vitamin D-dependent increase in sequence-specific binding of nuclear factors. This element (CTGGGTGAATGAGGACATTACTGACC), identified at single nucleotide resolution, contains a region of hyphenated dyad symmetry and shares sequence homology with consensus steroid-responsive elements and with the sequence that has been identified as the vitamin D receptor binding site in the human osteocalcin gene. We have also observed that vitamin D stimulation of osteocalcin gene expression results in a 5-fold increase in protein binding to the region of the osteocalcin box, a 24-nucleotide segment in the proximal promoter with a CCAAT motif as the central core. Our results demonstrate protein-DNA interactions in a vitamin D-responsive element and in a second sequence, the osteocalcin box, both of which are involved in the physiologic regulation of the osteocalcin gene in response to 1,25-dihydroxyvitamin D3.

Plasmid deletion formation in recE4 and addB72 mutants of Bacillus subtilis

Plasmid deletion formation was compared in wild-type, recE4, and addB72 strains of Bacillus subtilis. Deletion frequencies in plasmid pGP1, as monitored with a penP- lacZ fusion, were low in recE4 and high in addB72, in comparison to the wild-type strain. In the wild-type and recE4 strains, deletions between directly repeated sequences were rare. In contrast, about half of the deletions in the addB72 mutant resulted from recombination at direct repeats of 5 bp or more. The sequences at or near the left deletion endpoints showed striking similarities in the three strains. (1) 5′-T-T-T-3′, or the complement 5′-A-A-A-3′, was frequently located at these sites. (2) 5′-T-G-T-A-3′ was found close to most of these termini. (3) Nearly all left termini occurred in a region rich in hyphenated dyad symmetry, which includes the penP transcription/translation regulatory sequences. It is assumed that DNA secondary structures, together with a sequence preference, specify the majority of the left deletion termini, which we speculate to be target sites for topoisomerase I. The right termini of deletions in the wild-type and addB72 mutant were frequently located close to a loose octanucleotide consensus sequence: 5′-G/C-G/C-G/C-G-A/T-A/T-A/T-A/G-3′. In contrast, in the recE4 mutant, the sequence 5′-C-A-G/C-G/C-G/C-G/C-T/ G-3′ was more frequently found at this position.

Histone genes inPhysarum polycephalum: Transcription and analysis of the flanking regions of the two H4 genes

The histone H4 multigene family of Physarum polycephalum consists of two genes, H41 and H42. Both genes have an unusual structure in that they are interrupted by a small intron. The structure of the P. polycephalum H4 genes is discussed and compared to the structure of histone genes of other organisms. S1 nuclease analysis was used to map the 5' and 3' ends of the histone H4 messengers. We show that the histone H4 genes have a hybrid structure; they are interrupted by an intervening sequence, as in replacement variant histone genes of higher eukaryotes, but their 5' and 3' noncoding regions have the properties of replication-dependent histone genes: the 5' and 3' leader and trailer sequences are short, possess a 3'-hyphenated dyad symmetry element, and a CAGA sequence is found 3' to the hyphenated hairpin structure. This report also provides evidence that both genes are expressed in late G2 phase as well as in S phase and that their expression is temporally coordinated and quantitatively similar during the cell cycle.

Human methylated DNA-binding protein. Determinants of a pBR322 recognition site.

Methylated DNA-binding protein (MDBP) from human placenta has a high affinity for a site in pBR322 (pB site 1) when that site is methylated at its CpG dinucleotides. Dimethyl sulfate interference analysis and experiments with ligands prepared by oligonucleotide-directed mutagenesis indicate that 15 contiguous base pairs, 14 of which exhibit hyphenated dyad symmetry, influence MDBP binding to pB site 1. These 14 base pairs, 5'-RTMGYCAMGG(M/T)GAY-3' (M, 5-methylcytosine), suffice for recognition by MDBP as demonstrated with a double-stranded, MpG-containing oligonucleotide used as a free ligand or cloned into M13mp19 and subsequently methylated. Seven single-site mutations at different positions of this 14-base pair region largely eliminated binding, and several others increased binding up to 2-fold when compared to the nonmutant, triply methylated sequence. However, MDBP recognizes a site in hemimethylated M13mp19 replicative form DNA, which was homology to pB site 1 at only 10 of 14 base pairs, and all four of these different base pairs are equivalent to transversions. Based upon the above data, a mixed oligonucleotide probe was constructed that contains variants of pB site 1 which should be recognized by MDBP. This 14-base probe hybridizes under stringent conditions to a number of discrete fragments in restriction digests of human DNA. this suggests that there are multiple pB site 1-related sequences in human DNA that might, when methylated, bind MDBP in vivo.

Structures of the promoter and operator of the glpD gene encoding aerobic sn-glycerol-3-phosphate dehydrogenase of Escherichia coli K-12.

The nucleotide sequence of a 690-base-pair DNA segment containing the control region for the glpD gene encoding aerobic sn-glycerol-3-phosphate dehydrogenase was determined. An ATG translation initiation codon with an adjacent ribosome-binding site was found which preceded an open reading frame continuing 61 codons to the end of the DNA that was sequenced. The start site for transcription, identified by using primer extension analysis, was located 42 base pairs upstream from the proposed Met start codon. The transcription start site was preceded by a region containing typical -10 and -35 sequences found in bacterial promoters. A binding site for the cyclic AMP-cyclic AMP receptor protein complex (identified by comparison with the consensus-binding sequence and verified by using DNase I footprinting) was located just upstream from the -35 sequence, centered at position -63. The interaction site for the glp repressor was identified by using DNase I footprinting. It consisted of a 49-base-pair region which started at the -10 sequence and continued to position +38. This region contained two directly repeated sequences, each possessing hyphenated dyad symmetry, which suggests that the operator is tandemly repeated. The presence of two adjacent operators may explain why expression of the glpD gene is the most sensitive to repressor when compared with expression of the other operons that are members of the glp regulon.

Plasmid deletion formation in Bacillus subtilis.

Plasmid pGP1 carrying a penP-lacZ fusion was used to study structural plasmid instability in Bacillus subtilis. In only one of 28 sequenced deletion junction points in the penP-lacZ region short direct repeats (10 bp) and flanking imperfect inverted repeats (12 bp) were associated with endpoints. In 27 deletions no repeated sequences of more than 3 bp were present at the endpoints. In 15 of these the sequence 5'-T-G-T-A-3' was found within 10 bp from the left endpoint. At the left cleavage sites the sequence 5'-T-T-T-3', or the 5'-A-A-A-3' complement thereof, was frequently observed. Most of the left deletion endpoints were located in potential stem-loop structures in the penP transcription/translation regulatory region, which is very rich in hyphenated dyad symmetry. Near the right deletion endpoints a sequence consisting of four G/C residues, followed by three or four A/T residues, was found in 15 cases. It is speculated that DNA topoisomerase I is involved in the formation of the deletions studied.