Human Telomeric DNA Sequence Research Articles

Mismatch repair enzymes regulate telomere recombination in Saccharomycescerevisiae

DNA mismatch repair (MMR) is a crucial mechanism that ensures chromosome stability and prevents the development of various human cancers. Apart from its role in correcting mismatches during DNA replication, MMR also plays a significant role in regulating recombination between non-identical sequences, a process known as homeologous recombination. Telomeres, the protective ends of eukaryotic chromosomes, possess sequences that are not perfectly homologous. While telomerase primarily maintains telomere length in the yeast Saccharomyces cerevisiae, recombination between telomeres becomes a major pathway for length maintenance in cells lacking telomerase. This study investigates the participation of MMR in telomere recombination. Our findings reveal that mutations in MMR genes activate type I recombination. Notably, among the MMR proteins, MutSα (Msh2 and Msh6) and MutLα (Mlh1 and Pms1) exerted the most pronounced effects on telomere recombination. We also found that yeast cells containing simple human telomeric TTAGGG DNA sequences preferentially utilize type II recombination to maintain their telomeres, highlighting the influence of the heterogeneous nature of yeast telomeric sequences on type II recombination. Furthermore, our observations indicate that MMR activity is indispensable for its impact on telomere recombination. Collectively, these results contribute to a more comprehensive understanding of the role of MMR in telomere recombination.

Spectroscopy and calorimetry evidence of binding-induced thermal stabilization of human telomeric G-quadruplex DNA by 1,5-disubstituted morpholino-amido anthraquinone: Molecular basis of anticancer action

We report interaction of 1,5-Bis (3-morpholinopropionamido) anthracene-9,10-dione with Human Telomeric G4 DNA sequences, wHTel26 and HTel22 in presence of K+ and Na+ ions, respectively. Surface Plasmon Resonance yields association constant Kb = 1.0–3.8x105 M−1 with HTel22 in K+-rich solution. Significant hypochromism (46–79 %) and fluorescence quenching (83–92 %), no change in absorption and emission maxima, unaltered fluorescence lifetime of ligand, change in conformation of G4 DNA with no overall disruption of G-quartets and absence of induced Circular Dichroism band, suggest external groove binding of ligand. Molecular docking shows short contacts of 9O, 15N, 18O, 11NH, 12CO atoms of ligand with A3, G4, G22, G23 and A1, G3, G14 bases of 3 + 1 hybrid-2 and 2 + 2 anti-parallel conformers, respectively without making any contact with loops, to an energetically more favourable conformation. Ligand-influenced thermal stabilization, up to ΔTm = 37/48 °C, may disrupt access of telomerase enzyme to telomere and promote apoptosis in malignant tissues.

Spectroscopy evidence of interaction of 1,5 disubstituted piperidino-amido anthraquinone derivative with human telomeric G-quadruplex DNA: Basis of anticancer action

The binding of ligands to G-quadruplex (G4) structures at the ends of human telomeric DNA induces thermal stabilization, which interferes with telomere maintenance by disrupting the association of telomeres with the telomerase enzyme—an important marker for cancer. Understanding the binding mode of the ligand-G quadruplex DNA complex is imperative for evaluating the relative efficacy and specificity of their interaction. We focused on the interaction of 1,5-Bis(3-piperidino propionamido) anthracene-9,10-dione with human telomeric DNA sequences using surface plasmon resonance, absorbance, fluorescence (steady-state and lifetime), and circular dichroism spectroscopy techniques. The ligand binding with HTel22 (Kb = 8.4 × 105 M−1) induced cell toxicity with an IC50 value of ∼ 8.64 µM in MCF-7 cancer cell lines. Significant hypochromism (59 %), fluorescence quenching (97 %), no change in fluorescence lifetime and absence of induced Circular Dichroism (CD) band upon addition of G4 DNA to ligand, suggest a groove/external binding mode. CD spectral changes reflect rearrangement in parallel and antiparallel strands to accommodate the ligand. Docking results reveal specific short contacts of the ligand's side chain, including 9CO, 13N, 14NH, and 11CO, with the grooves of the G4 DNA, without making any contact with the loops, favoring an energetically more favorable conformation. Thermal denaturation profiles, obtained by Differential Scanning Calorimetry and CD, show the stabilization of wHTel26 and HTel22 G4 DNA in K+ and Na+ rich solutions by 21.2 and 17.6 °C, respectively, which may restrict the access of telomerase to telomeres. The findings indicate the potential of modifying anthraquinone substituent groups for therapeutic applications.

Post- and Pre-Radiolabeling Assays for anti Thymidine Cyclobutane Dimers as Intrinsic Photoprobes of Various Types of G-Quadruplexes, Reverse Hoogsteen Hairpins, and Other Non-B DNA Structures.

G-quadruplexes are thought to play an important role in gene regulation and telomere maintenance, but developing probes for their presence and location is challenging due to their transitory and highly dynamic nature. The majority of probes for G-quadruplexes have relied on antibody or small-molecule binding agents, many of which can also alter the dynamics and relative populations of G-quadruplexes. Recently, it was discovered that ultraviolet B (UVB) irradiation of human telomeric DNA and various G-quadruplex forming sequences found in human promoters, as well as reverse Hoogsteen hairpins, produces a unique class of non-adjacent anti cyclobutane pyrimidine dimers (CPDs). Therefore, one can envision using a pulse of UVB light to irreversibly trap these non-B DNA structures via anti CPD formation without perturbing their dynamics, after which the anti CPDs can be identified and mapped. As a first step toward this goal, we report radioactive post- and pre-labeling assays for the detection of non-adjacent CPDs and illustrate their use in detecting trans,anti T=(T) CPD formation in a human telomeric DNA sequence. Both assays make use of snake venom phosphodiesterase (SVP) to degrade the trans,anti T=(T) CPD-containing DNA to the tetranucleotide pTT=(pTT) corresponding to CPD formation between the underlined T's of two separate dinucleotides while degrading the adjacent syn TT CPDs to the trinucleotide pGT=T. In the post-labeling assay, calf intestinal phosphodiesterase is used to dephosphorylate the tetranucleotides, which are then rephosphorylated with kinase and [32P]-ATP to produce radiolabeled mono- and diphosphorylated tetranucleotides. The tetranucleotides are confirmed to be non-adjacent CPDs by 254 nm photoreversion to the dinucleotide p*TT. In the pre-labeling assay, radiolabeled phosphates are introduced into non-adjacent CPD-forming sites by ligation prior to irradiation, thereby eliminating the dephosphorylation and rephosphorylation steps. The assays are also demonstrated to detect the stereoisomeric cis,anti T=(T) CPD.

Influence of Different Salts on the G-Quadruplex Structure Formed from the Reversed Human Telomeric DNA Sequence.

G-rich telomeric DNA plays a major role in the stabilization of chromosomes and can fold into a plethora of different G-quadruplex structures in the presence of mono- and divalent cations. The reversed human telomeric DNA sequence (5′-(GGG ATT)4; RevHumTel) was previously shown to have interesting properties that can be exploited for chemical sensing and as a chemical switch in DNA nanotechnology. Here, we analyze the specific G-quadruplex structures formed by RevHumTel in the presence of K+, Na+, Mg2+ and Ca2+ cations using circular dichroism spectroscopy (CDS) and Förster resonance energy transfer (FRET) based on fluorescence lifetimes. CDS is able to reveal strand and loop orientations, whereas FRET gives information about the distances between the 5′-end and the 3′-end, and also, the number of G-quadruplex species formed. Based on this combined information we derived specific G-quadruplex structures formed from RevHumTel, i.e., a chair-type and a hybrid-type G-quadruplex structure formed in presence of K+, whereas Na+ induces the formation of up to three different G-quadruplexes (a basket-type, a propeller-type and a hybrid-type structure). In the presence of Mg2+ and Ca2+ two different parallel G-quadruplexes are formed (one of which is a propeller-type structure). This study will support the fundamental understanding of the G-quadruplex formation in different environments and a rational design of G-quadruplex-based applications in sensing and nanotechnology.

Anthraquinone derivatives inhibit telomerase activity by interaction with G quadruplex DNA and acts as a promising anticancerous agent

G‐quadruplex defines as an evolutionarily conserved sequence, non‐canonical secondary structures found at the telomeric region and in promoter regions of various oncogenes like cMYC, CKIT, and BCL2, etc. Telomerase enzyme activity is inhibited by a small molecule that selectively interacts with G‐quadruplex. Understanding the binding mechanism of the ligand‐G quadruplex complex is crucial for assessing anti‐tumor therapeutic efficacy. We have synthesized different anthraquinone derivative‐based G4 ligands which stabilize quadruplex sequence and influence various cellular processes. We have explored the interaction of synthesized anthraquinone derivatives with G4 DNA sequences comprising human telomeric DNA sequence by using absorption, fluorescence, circular dichroism (CD) spectroscopy, surface plasmon resonance (SPR) and thermal melting. Each ligand binds to the G4 DNA in monomeric form. The absorption intensity decreases with a shift of 6‐8 nm. Fluorescence quenching studies and sensorgram indicated a significant binding affinity (Kb) in the order of 102 to 108 M−1. A shift of ~6‐10 nm indicates partial stacking of aromatic chromophores with nucleic acid bases. Similar studies with CD spectroscopy yielded Kb in the range of 103 to 107 M−1. Thermal melting profiling of DNA saturated at Drug/DNA = 5 indicated a stabilization (ΔTm) of 21 to 34 °C in presence of different ions indicating more thermal stabilization in the presence of Na+ ions as compared to K+. Molecular docking analysis concluded that external binding of the ligands to G4 DNAs. The formation of a complex G4 structure was further established by polymerase stop assay. The compounds showed in vitro cytotoxicity in cancer cells (MCF) based on a cell viability assessment which undergoes oxidative lesions at a greater extent. Apoptosis is the mechanical pathway behind the cytotoxicity of cancer cells from the live‐dead staining trials. Modifications of cellular morphs, nuclear condensation, and fragmentation were observed in fluorescence microscopy upon treatment of these compounds. qRT‐PCR highlights gene transcriptional regulation genes containing G4 sequence after treatment of ligands. Apart from damaging G4 DNA, thermal stabilization caused by selective interactions is thought to block telomerase enzyme associated with telomere end and contribute to drug‐induced death in cancerous cell types. The insights expedite therapeutic development due to the extensive possibilities of changing ensuing groups on anthraquinones to improve efficacy, reduce cell toxicity, and increase specificity for G‐quadruplex DNA.

G4 DNA present at human telomeric DNA contributes toward reduced sensitivity to γ-radiation induced oxidative damage, but not bulky adduct formation

Purpose DNA, the hereditary material of a human cell generally exists as Watson-Crick base paired double-stranded B-DNA. Studies suggest that DNA can also exist in non-B forms, such as four stranded G-quadruplexes (G4 DNA). Recently, our studies revealed that the regions of DNA that can fold into G-quadruplex structures are less sensitive to ionizing radiation (IR) compared to B-DNA. Importantly, we reported that the planar G-quartet of a G4 structure is shielded from radiation induced DNA breaks, while the single- and double-stranded DNA regions remained susceptible. Thus, in the present study, we investigate whether telomeric repeat DNA present at the end of telomere, known to fold into G4 DNA can protect from radiation induced damages including strand breaks, oxidation of purines and bulky adduct formation on DNA. Materials and methods For plasmid irradiation assay, plasmids containing human telomeric repeat DNA sequence TTAGGG (0.8 kb or 1.8 kb) were irradiated with increasing doses of IR along with appropriate control plasmids and products were resolved on 1% agarose gel. Radioprotection was evaluated based on extent of conversion of supercoiled to nicked or linear forms of the DNA following irradiation. Formation of G-quadruplex structure on supercoiled DNA was evaluated based on circular dichroism (CD) spectroscopy studies. Cleavage of radiation induced oxidative damage and extent of formation of nicks was further evaluated using base and nucleotide excision repair proteins. Results Results from CD studies showed that the plasmid DNA harboring human telomeric repeats (TTAGGG) can fold into G-quadruplex DNA structures. Further, results showed that human telomeric repeat sequence when present on a plasmid can protect the plasmid DNA against IR induced DNA strand breaks, unlike control plasmids bearing random DNA sequence. Conclusions Human telomeric repeat sequence when present on plasmids can fold into G-quadruplex DNA structures, and can protect the DNA against IR induced DNA strand breaks and oxidative damage. These results in conjunction with our previous studies suggest that telomeric repeat sequence imparts less sensitivity to IR and thus telomeres of chromosomes are protected from radiation.

Trizbenzim, Cu-Trizbenzim and Zn-Trizbenzim as G-Quadruplex Inducing and Stabilizing Compounds on Human Telomeric Sequence and their Anticancer Properties.

The benzimidazole and their derivatives have rich biological relevance with respect to available natural amino acids and their role in protein folding and quaternary conformations. Thus the ligand trizbenzim and their Cu(II) and Zn(II) metal complexes were prepared to induce G-quadruplex conformation even under no-salt conditions with remarkable anticancer activities. The ligand N,N',N''-Tris-(1H-benzoimidazol-2-ylmethyl)-[1,3,5]triazine-2,4,6-triamine ( trizbenzim) and its Cu and Zn complexes (Cu-trizbenzim, Zn-trizbenzim) were synthesized and characterized by IR, NMR, and MALDI-TOF techniques. The pure ligand and its complexes interacted with human telomere DNA sequence d(TTAGGG), HTelo8and HTelo20and the interactions were followed by circular dichroism spectroscopy, FID assay, and molecular docking techniques. The compounds were tested for anticancer activity towards selected cell lines. All the three compounds stabilized the HTelo8 and HTelo20 in parallel and antiparallel G-quadruplex conformations with salt conditions. Under no-salt conditions, the compounds induce and stabilize the G-quadruplex conformation in antiparallel topology selectively. The pure ligand, Cu-trizbenzim, and Zn-trizbenzim were involved in partial or classical intercalation and some backbone interactions on the strand. The FID assay using thiazole orange intercalator supports the proposed intercalation mode of binding for the three compounds, especially for the pure ligand and the Cu-complex. The MOE docking experiments using X-ray and NMR derived G-quadruplex models with the title compounds extensively support the G-quadruplex induction and stabilization of the telomere sequence by these compounds. The guanines bases involved in the G-tetrad formation interact well with the triazine and the benzimidazole part of the ligand through strong π-π interactions. The primary mode of binding is described as end stacking and intercalation of the compounds to the G-quadruplex structures. The Cu-trizbenzim exhibited more anticancer property in comparison to the pure ligand and the Zntrizbenzim complex. The IC50 values were in the nanomolar range from 50 to 150nM in concentration. This novel self-induction of G-quadruplex is novel without the presence of alkali metal ions.

Platform- and label-free detection of lead ions in environmental and laboratory samples using G-quadraplex probes by circular dichroism spectroscopy

Guanine-rich quadruplex (G-QD) are formed by conversion of nucleotides with specific sequences by stabilization of positively charged K+ or Na+. These G-QD structures differentially absorb two-directional (right- and left-handed) circularly polarized light, which can discriminate the parallel or anti-parallel structures of G-QDs. In this study, G-QDs stabilized by Pb2+ were analyzed by a circular dichroism (CD) spectroscopy to determine Pb2+ concentration in water samples. Thrombin aptamer (TBA), PS2.M, human telomeric DNA (HTG), AGRO 100, and telomeric related sequence (T2) were studied to verify their applicability as probes for platform- and label-free detection of Pb2+ in environmental as well as laboratory samples. Among these nucleotides, TBA and PS2.M exhibited higher binding constants for Pb2+, 1.20–2.04 × 106/M at and 4.58 × 104–1.09 × 105/M at 100 micromolar and 100 mM K+ concentration, respectively. They also exhibited excellent selectivity for Pb2+ than for Al3+, Cu2+, Ni2+, Fe3+, Co2+, and Cr2+. When Pb2+ was spiked into an effluent sample from a wastewater treatment plant (WWTP), its existence was detected by CD spectroscopy following a simple addition of TBA or PS2.M. By the addition of TBA and PS2.M, the Pb2+ signals were observed in effluent samples over 0.5 micromolar (100 ppb) concentration. Furthermore, PS2.M caused a Pb2+-specific absorption band in the effluent sample without spiking of Pb2+, and could be induced to G-QD structure by the background Pb2+ concentration in the effluent, 0.159 micromolar concentration (3.30 ppb). Taken together, we propose that TBA and PS2.M are applicable as platform- and label-free detection probes for monitoring Pb2+ in environmental samples such as discharged effluent from local WWTPs, using CD spectroscopy.

Structural basis for stabilization of human telomeric G-quadruplex [d-(TTAGGGT)]4 by anticancer drug epirubicin

Anthracycline anticancer drugs show multiple strategies of action on gene functioning by regulation of telomerase enzyme by apoptotic factors, e.g. ceramide level, p53 activity, bcl-2 protein levels, besides inhibiting DNA/RNA synthesis and topoisomerase-II action. We report binding of epirubicin with G-quadruplex (G4) DNA, [d-(TTAGGGT)]4, comprising human telomeric DNA sequence TTAGGG, using 1H and 31P NMR spectroscopy. Diffusion ordered spectroscopy, sequence selective changes in chemical shift (~0.33 ppm) and line broadening in DNA signals suggest formation of a well-defined complex. Presence of sequential nuclear Overhauser enhancements at all base quartet steps and absence of large downfield shifts in 31P resonances preclude intercalative mode of interaction. Restrained molecular dynamics simulations using AMBER force field incorporating intermolecular drug to DNA interproton distances, involving ring D protons of epirubicin depict external binding close to T1-T2-A3 and G6pT7 sites. Binding induced thermal stabilization of G4 DNA (~36 °C), obtained from imino protons and differential scanning calorimetry, is likely to come in the way of telomerase association with telomeres. The findings pave the way for drug-designing with modifications at ring D and daunosamine sugar.

Recent advances in the development of ligands specifically targeting telomeric multimeric G-quadruplexes

Long human telomeric DNA sequence could form higher-order G-quadruplex structures, namely telomeric multimeric G-quadruplexes. The formation of telomeric multimeric G-quadruplexes has been demonstrated. Several efforts have been devoted to the development of ligands targeting telomeric multimeric G-quadruplexes in recent years. The reported ligands specifically targeting telomeric multimeric G-quadruplexes exhibited either high anticancer activity with effective stabilization ability or distinct fluorescence responses to telomeric multimeric G-quadruplexes. In this review, the ligands including three types of small molecules are discussed which focus on their structural features and binding modes. Furthermore, we put forward the promising prospects and current challenges. This presented review might provide new strategies to exploit more sophisticated ligands targeting telomeric multimeric G-quadruplexes.

Binding of anticancer drug adriamycin to parallel G-quadruplex DNA [d-(TTAGGGT)]4 comprising human telomeric DNA leads to thermal stabilization: A multiple spectroscopy study.

Adriamycin is known to exert its anti cancer action by inhibiting DNA duplication, RNA transcription and topoisomerase-II enzyme action. Recent findings of its binding to G-quadruplex DNA resulting in telomere dysfunction indicated multiple strategies of its action. The interaction of anticancer drug adriamycin with parallel stranded inter molecular G-quadruplex DNA [d-(TTAGGGT)]4 comprising human telomeric DNA sequence TTAGGG was investigated by absorption, fluorescence, circular dichroism and nuclear magnetic resonance spectroscopy to understand mode of their interaction. The adriamycin binds as monomer to G-quadruplex DNA with affinity (Kb1 = 9.8x105 M-1 and Kb2 = 6.7x105 M-1 ) higher than that reported for daunomycin, at two independent sites, mainly in terminal stacking and groove binding modes. The bound complex formed as a result of specific interactions induces thermal stabilization of DNA by 12.5-28.1°C, which is likely to hinder telomere association with telomerase enzyme and contribute significantly to adriamycin-induced apoptosis in cancer cell lines. The findings have therapeutic potential towards drug designing by way of altering substituent groups on anthracyclines to enhance efficacy using additional mechanism of targeting pathway of telomere maintenance by disrupting telomerase association with telomeres.

Dual mode of binding of anti cancer drug epirubicin to G-quadruplex [d-(TTAGGGT)]4 containing human telomeric DNA sequence induces thermal stabilization

Epirubicin exerts its anti cancer action by blocking DNA/RNA synthesis and inhibition of topoisomerase-II enzyme. Recent reports on its influence on telomere maintenance, suggest interaction with G-quadruplex DNA leading to multiple strategies of action. The binding of epirubicin with parallel stranded inter molecular G-quadruplex DNA [d-(TTAGGGT)]4 comprising human telomeric DNA sequence TTAGGG was investigated by absorption, fluorescence, circular dichroism and nuclear magnetic resonance spectroscopy. The epirubicin binds as monomer to G-quadruplex DNA with affinity, Kb1 = 3.8 × 106 M−1 and Kb2 = 2.7 × 106 M−1, at two independent sites externally. The specific interactions induce thermal stabilization of DNA by 13.2–26.3 °C, which is likely to come in the way of telomere association with telomerase enzyme and contribute to epirubicin-induced apoptosis in cancer cell lines. The findings pave the way for drug designing in view of the possibility of altering substituent groups on anthracyclines to enhance efficacy using alternate mechanism of its interaction with G4 DNA, causing interference in telomere maintenance pathway by inducing telomere dysfunction.

Molecular recognition of 3 + 1 hybrid human telomeric G-quadruplex DNA d-[AGGG(TTAGGG)3] by anticancer drugs epirubicin and adriamycin leads to thermal stabilization

Recent reports suggest influence of anti-cancer anthracyclines on telomere dysfunction and their possible interaction with G-quadruplex (G4) DNA as an alternate pathway to apoptosis. We have investigated interaction of epirubicin and adriamycin with G4 DNA [d-AGGG(TTAGGG)3] comprising human telomeric DNA sequence by surface plasmon resonance, absorption, fluorescence, circular dichroism and thermal denaturation. Epirubicin and adriamycin bind with affinity, Kb, = 2.5×105 and 5.2×105M−1, respectively in monomeric form leading to decrease in absorbance, fluorescence quenching and ellipticity changes without any significant shift in absorption emission maxima with corresponding induced thermal stabilization by 13.0 and 11.6°C in K+ rich solution. Na+ ions did not induce any thermal stabilization. Molecular docking confirmed external binding at grooves and loops of G4 DNA involving 4OCH3 of ring D, 9COCH2OH of ring A, 4′OH/H and 3′NH3+ of daunosamine sugar. Thermal stabilization induced by specific interactions is likely to hamper telomere association with telomerase enzyme and contribute to drug-induced apoptosis in cancer cell lines besides causing damage to duplex DNA. The findings pave the way for drug designing in view of immense possibilities of altering substituent groups on anthracyclines for enhancement of efficacy, reduced cell toxicity as well as specificity towards G-quadruplex DNA.

Telomere DNA Binding, Cleavage and Anticancer Activity of [Cu(phendione)(Hpyramol)Cl

Background:The ligand Hpyramol is a redox active, which on coordination with Cu(II) cleaves DNA without any added reductant. Another ligand phendione is known for its wide application towards anticancer activities. We combined the ligands with CuCl2 to have an intercalation moiety and a redox active ligand in participation towards telomere DNA cleavage and anticancer activity.Objective:In this study, our aim is to interact it with Human telomere DNA and to see their effects on cancer cells.Methods:The complex [Cu(L)(L’)Cl] has interacted with the human telomere DNA sequence (TTAGGG), HTelo20. The HTelo20 was stabilized under both parallel and antiparallel G-quadruplex conformations and the complex [Cu(L)(L’)Cl] has interacted followed by circular dichroism spectroscopy and gel electrophoresis.Results:The parallel G-quadruplex and randomly coiled conformations of HTelo20 were easily cleaved than the anti-parallel G-quadruplex conformation. The nature of DNA cleavage was found to be oxidative rather hydrolytic. The formation of phenoxyl radical species under electrochemical and controlled potential electrolysis conditions by the complex [Cu(L)(L’)Cl] proves the possibility of oxidative nature of DNA cleavage. The comet assay also proves the DNA cleavage induced by the complex [Cu(L)(L’)Cl] inside the nucleus of HeLa cancer cells.Conclusion:The complex [Cu(L)(L’)Cl] was tested for anticancer activity, induced by ROS and DNA cleavage. The IC50 values resulted in nanomolar concentrations with selected cancer cell lines. Relatively the Cu complex shows less toxicity with the normal cell line L132.

Photocrosslinking of G-Quadruplex-Forming Sequences found in Human Promoters.

While is it well known that human telomeric DNA sequences can adopt G-quadruplex structures, some promoters sequences have also been found to form G-quadruplexes, and over 40% of promoters contain putative G-quadruplex-forming sequences. Because UV light has been shown to crosslink human telomeric G-quadruplexes by cyclobutane pyrimidine dimer (CPD) formation between T's on adjacent loops, UV light might also be able to photocrosslink G-quadruplexes in promoters. To investigate this possibility, 15 potentially UV-crosslinkable G-quadruplex-forming sequences found in a search of human DNA promoters were UVB irradiated invitro, and three were confirmed to have formed nonadjacent CPDs by mass spectrometry. In addition to nonadjacent T=T CPDs found in human telomeric DNA, a nonadjacent T=U CPD was discovered that presumably arose from deamination of a nonadjacent T=C CPD. Analysis of the three sequences by circular dichroism, melting temperature analysis and chemical footprinting confirmed the presence of G-quadruplexes that could explain the formation of the nonadjacent CPDs. The formation of nonadjacent CPDs from the sequences invitro suggests that they might be useful probes for the presence of non-B DNA structures, such as G-quadruplexes, invivo, and if they were to form invivo, might also have significant biological consequences.

Targeting human telomeric DNA quadruplex with novel berberrubine derivatives: insights from spectroscopic and docking studies

Study on bioactive molecules, capable of stabilizing G-Quadruplex structures is considered to be a potential strategy for anticancer drug development. Berberrubine (BER) and two of its analogs bearing alkyl phenyl and biphenyl substitutions at 13-position were studied for targeting human telomeric G-quadruplex DNA sequence. The structures of berberrubine and analogs were optimized by density functional theory (DFT) calculations. Time-dependent DFT (B3LYP) calculations were used to establish and understand the nature of the electronic transitions observed in UV–vis spectra of the alkaloid. The interaction of berberrubine and its analogs with human telomeric G-quadruplex DNA sequence 5′-(GGGTTAGGGTTAGGGTTAGGG)-3′ was investigated by biophysical techniques and molecular docking study. Both the analogs were found to exhibit higher binding affinity than natural precursor berberrrubine. 13-phenylpropyl analog (BER1) showed highest affinity [(1.45 ± 0.03) × 105 M−1], while the affinity of the 13-diphenyl analog (BER2) was lower at (1.03 ± 0.05) × 105 M−1, and that of BER was (0.98 ± 0.03) × 105 M−1. Comparative fluorescence quenching studies gave evidence for a stronger stacking interaction of the analog compared to berberrubine. The thiazole orange displacement assay has clearly established that the analogs were more effective in displacing the end stacked dye in comparison to berberrubine. Molecular docking study showed that each alkaloid ligand binds primarily at the G rich regions of hTelo G4 DNA which makes them G specific binder towards hTelo G4 DNA. Isothermal titration calorimetry studies of quadruplex–berberrubine analog interaction revealed an exothermic binding that was favored by both enthalpy and entropy changes in BER in contrast to the analogs where the binding was majorly enthalpy dominated. A 1:1 binding stoichiometry was revealed in all the systems. This study establishes the potentiality of berberrubine analogs as a promising natural product based compounds as G-quadruplex-specific ligands.

Evidence for Reverse Hoogsteen Hairpin Intermediates in the Photocrosslinking of Human Telomeric DNA Sequences.

UVB irradiation of human telomeric d(GGGTTA)3 GGG sequences in potassium ion solution crosslinks the first and third TTA segments through anti cyclobutane pyrimidine dimer (CPD) formation. The photocrosslinking reaction was first proposed to occur through a form 3 two-tetrad G-quadruplex in which the lateral four-nucleotide GTTA loop can interact with an adjacent TTA loop. Curiously, the reaction does not occur with sodium ion, which was explained by the formation of a basket structure which only has three-nucleotide TTA loops that cannot interact. Sequences known or expected to favor the two-tetrad basket did not show enhanced photocrosslinking, suggesting that some other structure was the reactive intermediate. Herein, we report that anti CPDs form in human telomeric DNA sequences with lithium ion that is known to disfavor G-quadruplex formation, as well as with potassium ion when the bases are modified to interfere with G-quartet formation. We also show that anti CPDs form in sequences containing A's in place of G's that cannot form Hoogsteen hairpins, but can form reverse Hoogsteen hairpins. These results suggest that reverse Hoogsteen hairpins may play a hitherto unrecognized role in the biology and photoreactivity of DNA in telomeres, and possibly in other purine-rich sequences found in regulatory regions.

I-Motif of cytosine-rich human telomere DNA fragments containing natural base lesions.

i-Motif (iM) is a four stranded DNA structure formed by cytosine-rich sequences, which are often present in functionally important parts of the genome such as promoters of genes and telomeres. Using electronic circular dichroism and UV absorption spectroscopies and electrophoretic methods, we examined the effect of four naturally occurring DNA base lesions on the folding and stability of the iM formed by the human telomere DNA sequence (C3TAA)3C3T. The results demonstrate that the TAA loop lesions, the apurinic site and 8-oxoadenine substituting for adenine, and the 5-hydroxymethyluracil substituting for thymine only marginally disturb the formation of iM. The presence of uracil, which is formed by enzymatic or spontaneous deamination of cytosine, shifts iM formation towards substantially more acidic pH values and simultaneously distinctly reduces iM stability. This effect depends on the position of the damage sites in the sequence. The results have enabled us to formulate additional rules for iM formation.

Stability of the Na+ Form of the Human Telomeric G-Quadruplex: Role of Adenines in Stabilizing G-Quadruplex Structure.

G-quadruplexes are higher order DNA structures that play significant roles in gene transcription and telomeric maintenance. The formation and stability of the G-quadruplex structures are under thermodynamic control and may be of biological significance for regulatory function of cellular processes. Here, we report the structural influence and energetic contributions of the adenine bases in the loop sequences that flank G-repeats in human telomeric DNA sequence. Spectroscopic and calorimetric techniques are used to measure the thermal stability and thermodynamic contributions to the stability of human telomeric G-quadruplexes that have been designed with systematic changes of A to T throughout the telomeric sequence. These studies demonstrate that the thermal stability of the G-quadruplex structure is directly related to the number and position of the adenines that are present in the telomeric sequence. The melting temperature (Tm) was reduced from 59 °C for the wild-type sequence to 47 °C for the sequence where all four adenines were replaced with thymines (0123TTT). Furthermore, the enthalpy required for transitioning from the folded to unfolded G-quadruplex structure was reduced by 15 kcal/mol when the adenines were replaced with thymines (37 kcal/mol for the wild-type telomeric sequence reduced to 22 kcal/mol for the sequence where all four adenines were replaced with thymines (0123TTT)). The circular dichroism melting studies for G-quadruplex sequences having a single A to T change showed significantly sloping pretransition baselines and their differential scanning calorimetry (DSC) thermograms revealed biphasic melting profiles. In contrast, the deoxyoligonucleotides having sequences with two or more A to T changes did not exhibit sloping baselines or biphasic DSC thermograms. We attribute the biphasic unfolding profile and reduction in the enthalpy of unfolding to the energetic contributions of adenine hydrogen bonding within the loops as well as the adenine stacking to the G-tetrads of the G-quadruplex structure.