Human Chorionic Gonadotropin Stimulation Test Research Articles

Diagnostic utility of testosterone priming prior to dynamic tests to differentiate constitutional delay in puberty from isolated hypogonadotropic hypogonadism in boys

BackgroundDifferentiation between isolated hypogonadotropic hypogonadism (IHH) and constitutional delay in puberty (CDP) throughout adolescence can be challenging for doctors. This study examines the withdrawal effects of short-term, low-dose testosterone treatment (testosterone priming) on the ability of dynamic testing to distinguish between CDP and IHH based on activation of the hypothalamo-pituitary–testicular axis.MethodsA case–control study included 20 boys with delayed puberty (group A) and 20 patients with IHH (group B). Both groups underwent Triptorelin and human chorionic gonadotropin (hCG) stimulation tests before and 2 months after testosterone injections (100 mg) intramuscularly every 4 weekly for 3 months.ResultsThe triptorelin-stimulated 4-h LH with a cutoff of 2.4 IU/L and the hCG-stimulated testosterone with a cutoff of 1.160 ng/mL had sensitivities of 65% each, and specificities of 90% and 95%, respectively, to diagnose CDP. After testosterone withdrawal, the cut-off values for 4-h LH were 8.850 IU/L and 3.190 ng/mL for hCG-stimulated testosterone. Basal inhibin B > 88.25 pg/ml was found to be a differentiating factor in diagnosing CDP after testosterone withdrawal.Conclusionsfollowing the withdrawal of testosterone therapy, Inhibin B levels or 4-h stimulated LH are the most effective discriminant assays to distinguish CDP from IHH.

Value of the human chorionic gonadotropin stimulation test in the diagnosis of disorder of sexual development in children

To investigate the value of the human chorionic gonadotropin (hCG) stimulation test in the diagnosis of disorder of sexual development (DSD) in children. A retrospective analysis was conducted on 132 children with DSD. According to the karyotype, they were divided into three groups: 46,XX group (n=10), 46,XY group (n=87), and sex chromosome abnormality group (n=35). The above groups were compared in terms of sex hormone levels before and after hCG stimulation test, and the morphological manifestation of the impact of testicular tissue on the results of the hCG stimulation test was analyzed. There was no significant difference in the multiple increase of testosterone after stimulation among the three groups (P>0.05). In the 46,XY group, the children with 5α-reductase type 2 deficiency had a testosterone-to-dihydrotestosterone ratio higher than that of the 46,XY DSD children with other causes. Morphological analysis showed that DSD children with testicular tissue demonstrated a significantly higher multiple increase in testosterone after stimulation compared to children without testicular tissue (P<0.05). The hCG stimulation test has an important value in assessing the presence and function of testicular interstitial cells in children with different types of DSD, and it is recommended to perform the hCG stimulation test for DSD children with unclear gonadal type.

Role of Inhibin B, AMH, GnRHa Test and HCG Stimulation Test to Distinguish Isolated Hypogonadotropic Hypogonadism (IHH) from Constitutional Delay in Growth and Puberty (CDGP).

This study aimed to distinguish isolated hypogonadotropic hypogonadism (IHH) from constitutional delay in growth and puberty (CDGP) by various hormonal tests in both sexes. Boys with testicular volume (TV) <4 ml (14-18 years) and girls with breast B1 stage (13-18 years) were enrolled in this study. A detailed history, clinical examination and hormonal analysis including basal luteinising hormone (LH), follicle-stimulating hormone (FSH), inhibin B, anti-Mullerian hormone (AMH), testosterone (boys), oestradiol (girls), triptorelin stimulation test and 3-day human chorionic gonadotropin (HCG) stimulation test (boys) were performed. All patients were followed for 1.5 years or till 18 years of age. Receiver operating characteristic (ROC) curve analysis was performed to determine the optimal cut-offs with sensitivity, specificity, positive predictive value (PPV) and negative predictive value (NPV) for various hormones to distinguish IHH from CDGP. Of 34 children (male: 22 and female: 12), CDGP and IHH were diagnosed in 21 and 13 children, respectively. 4 hours post-triptorelin LH had the highest sensitivity (100%) and specificity (100%) for identifying IHH in both sexes. Basal inhibin B had good sensitivity (male: 85.7% and female: 83.8%) and specificity (male: 93.3% and female: 100%) for diagnosing IHH. 24 hours post-triptorelin testosterone (<34.5 ng/dl), day 4 post-HCG testosterone (<99.7 ng/dl) and 24 hours post-triptorelin oestradiol (<31.63 pg/ml) had reasonable sensitivity and specificity for identifying IHH. Basal LH, FSH and AMH were poor discriminators for IHH in both sexes. The best indicator was post-triptorelin 4-hour LH followed by inhibin B, which had a reasonable diagnostic utility to distinguish IHH from CDGP in both boys and girls.

COMPARISON OF SINGLE DOSE AND MULTI-DOSE hCG STIMULATION TESTS

Objective: The human chorionic gonadotropin (hCG) stimulation test is widely used to assess testicular steroidogenesis. This test evaluates Leydig cell function and helps to evaluate testosterone synthesis in testicular enzyme defects, hypogonadism, 46,XY sexual development disorders (DSD), and micropenis. This study will compare testosterone responses to a single dose of 5000 IU/m2 and three consecutive days of 1500 IU/m2 hCG regimens. Materials and Methods: The study evaluated 18 patients who were admitted with micropenis, hypospadias, or undescended testis (Group 1) and 18 patients with a molecular diagnosis of androgen receptor insensitivity (56%) or 5α reductase deficiency (44%) (Group 2). The median (interquartile range; IQR) age of the patients were 1.4 (0.8-4.2) years for Group 1 and 0.7 (0.3-0.8) years for Group 2. Baseline testosterone levels were checked and after a single dose of hCG 5000 IU/m2 injection into the first group, testosterone levels were observed on day one and day four. In the second group, after the injection of hCG 1500 IU/m2 for three days, testosterone levels were checked on the fourth day. Results: There was no significant difference in height, weight, BMI SDS, and baseline testosterone levels between groups. After hCG, stimulation testosterone responses did not vary among the groups. Testosterone levels were increased 40-fold and 40.1- fold on day four compared to the baseline in Group 1 and Group 2. In Group 1, testosterone response was significantly higher on day four compared to day one (p=0.001). Conclusions: The hCG tests performed with a single dose or multidoses showed that there was no difference between testosterone responses and these two tests were applicable the 5000 IU/m2 hCG test requires fewer injections and is easy to administer, this test may be preferred to an evaluation of the Leydig cell function. For an adequate testosterone response, the researchers suggest measuring testosterone levels on the fourth day after the single dose of 5000 IU/m2 .

Disorders of Sex Development.

Disorders of Sex Development.

Changes in circulating concentrations of testosterone and estrone sulfate after human chorionic gonadotropin administration and subsequent to castration of 2-year-old stallions

Reproductive steroids testosterone (T) and estrone sulfate (E1S) are used as diagnostic markers for cryptorchidism in horses. The human chorionic gonadotropin (hCG) stimulation test is used as a diagnostic aid because administration of this hormone results in greater incremental differences in circulating steroid concentrations. Thoughts regarding optimal sampling times following hCG administration, however, are inconsistent. Additionally, determination of half-life of these steroids is important in postsurgical samples to confirm complete removal of testicular tissue. Objectives of this study, therefore, were to determine optimal sampling periods for peak T and E1S after hCG administration and half-life of these steroids after castration. Eight pony stallions were randomly assigned to control or treatment groups (5000 IU hCG). Blood samples were collected following hCG administration. Subsequently, stallions were castrated and blood samples were collected post-castration. The T concentrations were greatest at 72 h after hCG and were greater (P < 0.02) in samples from hCG-treated than control animals: 9,903.4 ± 384 and 784.0 ± 192 pg/mL, respectively (Mean ± SEM). The T concentrations were also greater at 1, 12, 24, 48 and 96 h. The E1S concentrations did not change after administration of hCG. The T response to hCG administration was biphasic with a maximal response between 48–96 h after administration. Half-lives of T and E1S were 1.1 and 0.7 h, respectively, and concentration of T and E1S was similar to that of geldings at 24 h post-castration, which, therefore, should be considered an optimal time to ensure complete castration has occurred.

Serum Anti-Müllerian Hormone in the Prediction of Response to hCG Stimulation in Children With DSD

The relationship between serum anti-Müllerian hormone (AMH) and the testosterone response to human chorionic gonadotropin (hCG) stimulation test is unclear. Children who had hCG stimulation tests in one tertiary centre from 2001 to 2018 were included (n = 138). Serum testosterone was measured before (day 1 [D1]) and after 3 days (D4) of hCG stimulation. Sixty-one of these children also had prolonged hCG stimulation for 2 more weeks and serum testosterone measured after 21 days (D22). All children had a serum AMH measured on D1. Of the 138 children, D4 testosterone was normal in 104 (75%). AMH was low in 24/138 (17%) children, and 16 (67%) of these had a low D4 testosterone. Median AMH in those who had a normal vs low D4 testosterone was 850 pmol/L (24, 2280) and 54 pmol/L (0.4, 1664), respectively (P < 0.0001). An AMH > 5th centile was associated with a low D4 testosterone in 18/118 (13%; P < 0.0001). Of the 61 children who had prolonged hCG stimulation, D22 testosterone was normal in 39 (64%). AMH was low in 10/61(16%) children and 9 (90%) of these had a low D22 testosterone. Median AMH in children who responded and did not respond by D22 was 639 pmol/L (107, 2280) and 261 pmol/L (15, 1034) (P < 0.0001). A normal AMH may provide valuable information on overall testicular function. However, a low AMH does not necessarily predict a suboptimal testosterone response to hCG stimulation.

Growth Pattern in Chinese Children With 5α-Reductase Type 2 Deficiency: A Retrospective Multicenter Study.

Background5α-reductase type 2 deficiency (5αRD) is an autosomal recessive hereditary disease of the group of 46, XY disorders of sex development (DSD).ObjectiveTo study the growth pattern in Chinese pediatric patients with 5αRD.SubjectsData were obtained from 141 patients with 5αRD (age: 0–16 years old) who visited eight pediatric endocrine centers from January 2010 to December 2017.MethodsIn this retrospective cohort study, height, weight, and other relevant data were collected from the multicenter hospital registration database. Baseline luteinizing hormone (LH), follicle stimulating hormone (FSH), testosterone (T), and dihydrotestosterone (DHT) after human chorionic gonadotropin (HCG) stimulation test were measured by enzyme enhanced chemiluminescence assay. Bone age (BA) was assessed using the Greulich-Pyle (G-P) atlas. Growth curve was constructed based on λ-median-coefficient of variation method (LMS).ResultsThe height standard deviation scores (HtSDS) and weight standard deviation scores (WtSDS) in 5αRD children were in the normal range as compared to normal boys. Significantly higher HtSDS was observed in patients with 5αRD who were <1 year old (t = 3.658, 2.103, P = 0.002, 0.048, respectively), and higher WtSDS in those <6 months old (t = 2.756, P = 0.012). Then HtSDS and WtSDS decreased gradually and fluctuated near the median of the same age until 13 years. WtSDS in 5αRD children from northern China were significantly higher than those from the south (Z = -2.670, P = 0.008). The variation tendency of HtSDS in Chinese 5αRDs was consistent with the trend of stimulating T. HtSDS and stimulating T in the external masculinization score (EMS) <7 group were slightly higher than those in EMS ≥ 7 group without significant difference. Additionally, the ratio of BA over chronological age (BA/CA) was significantly <1 in children with 5αRD.ConclusionChildren with 5αRD had a special growth pattern that was affected by high levels of T, while DHT played a very small role in it. Their growth accelerated at age <1 year, followed by slowing growth and fluctuating height near normal median boys’ height. The BA was delayed in 5αRD children. Androgen treatment, which may be considered anyway for male 5αRD patients with a micropenis, may also be beneficial for growth.

S-Nitrosoglutathione Reductase (GSNOR) Deficiency Results in Secondary Hypogonadism

BackgroundExcess reactive oxygen species and reactive nitrogen species are implicated in male infertility and impaired spermatogenesis. AimTo investigate the effect of excess reactive nitrogen species and nitrosative stress on testicular function and the hypothalamic-pituitary-gonadal axis using the S-nitrosoglutathione reductase-null (Gsnor−/−) mouse model. MethodsTestis size, pup number, and epididymal sperm concentration and motility of Gsnor−/− mice were compared with those of age-matched wild-type (WT) mice. Reproductive hormones testosterone (T), luteinizing hormone (LH), and follicle-stimulating hormone were compared in Gsnor−/− and WT mice. Immunofluorescence for Gsnor−/− and WT testis was performed for 3β-hydroxysteroid dehydrogenase and luteinizing hormone receptor (LHR) and compared. Human chorionic gonadotropin and gonadotropin-releasing hormone stimulation tests were performed to assess and compare testicular and pituitary functions of Gsnor−/− and WT mice. OutcomesEvaluation of fertility and reproductive hormones in Gsnor−/− vs WT mice. Response of Gsnor−/− and WT mice to human chorionic gonadotropin and gonadotropin-releasing hormone to evaluate LH and T production. ResultsGsnor−/− mice had smaller litters (4.2 vs 8.0 pups per litter; P < .01), smaller testes (0.08 vs 0.09 g; P < .01), and decreased epididymal sperm concentration (69 vs 98 × 106; P < .05) and motility (39% vs 65%; P < .05) compared with WT mice. Serum T (44.8 vs 292.2 ng/dL; P < .05) and LH (0.03 vs 0.74 ng/mL; P = .04) were lower in Gsnor−/− than in WT mice despite similar follicle-stimulating hormone levels (63.98 vs 77.93 ng/mL; P = .20). Immunofluorescence of Gsnor−/− and WT testes showed similar staining of 3β-hydroxysteroid dehydrogenase and LHR. Human chorionic gonadotropin stimulation of Gsnor−/− mice increased serum T (>1,680 vs >1,680 ng/dL) and gonadotropin-releasing hormone stimulation increased serum LH (6.3 vs 8.9 ng/mL; P = .20) similar to WT mice. Clinical TranslationThese findings provide novel insight to a possible mechanism of secondary hypogonadism from increased reactive nitrogen species and excess nitrosative stress. Strengths and LimitationsLimitations of this study are its small samples and variability in hormone levels. ConclusionDeficiency of S-nitrosoglutathione reductase results in secondary hypogonadism, suggesting that excess nitrosative stress can affect LH production from the pituitary gland.Masterson TA, Arora H, Kulandavelu S, et al. S-Nitrosoglutathione Reductase (GSNOR) Deficiency Results in Secondary Hypogonadism. J Sex Med 2018;15:654–661.

Dynamic GnRH and hCG testing: establishment of new diagnostic reference levels.

Gonadotropin-releasing hormone (GnRH) and human chorionic gonadotropin (hCG) stimulation tests may be used to evaluate the pituitary and testicular capacity. Our aim was to evaluate changes in follicular-stimulating hormone (FSH), luteinizing hormone (LH) and testosterone after GnRH and hCG stimulation in healthy men and assess the impact of six single nucleotide polymorphisms on the responses. GnRH and hCG stimulation tests were performed on 77 healthy men, 18-40 years (reference group) at a specialized andrology referral center at a university hospital. The potential influence of the tests was illustrated by results from 45 patients suspected of disordered hypothalamic-pituitary-gonadal axis. Baseline, stimulated, relative and absolute changes in serum FSH and LH were determined by ultrasensitive TRIFMA, and testosterone was determined by LC-MS/MS. For the reference group, LH and FSH increased almost 400% and 40% during GnRH testing, stimulated levels varied from 4.4 to 58.8 U/L and 0.2 to 11.8 U/L and FSH decreased in nine men. Testosterone increased approximately 110% (range: 18.7-67.6 nmol/L) during hCG testing. None of the polymorphisms had any major impact on the test results. Results from GnRH and hCG tests in patients compared with the reference group showed that the stimulated level and absolute increase in LH showed superior identification of patients compared with the relative increase, and the absolute change in testosterone was superior in identifying men with Leydig cell insufficiency, compared with the relative increase. We provide novel reference ranges for GnRH and hCG test in healthy men, which allows future diagnostic evaluation of hypothalamic-pituitary-gonadal disorders in men.

Low-dose Human Chorionic Gonadotropin Stimulation Test as a Prognostic Incontinent Indicator in Boys With Bladder Exstrophy-epispadias Complex

To investigate the effect of low-dose human chorionic gonadotropin (HCG) administration on structural changes in the lower urinary tract in boys with urinary incontinence in the setting of bladder exstrophy-epispadias complex (BEEC). We prospectively evaluated 30 patients (median age 7.5 years) with BEEC and randomly divided them into 2 groups. Patients in the HCG group were administered 250 IU HCG intramuscularly 3 times per week during a 4-week period. The other 15 patients served as the control group. The patients were followed up for a mean duration of 4 years. Incontinence rate, hormonal changes, penile length, prostate size, and bladder capacity were evaluated using 3D sonography or pelvic magnetic resonance imaging and uroflowmetry studies before and after HCG administration. The incontinence score improvement was significantly higher in the HCG group (P = .01). A significant increase was detected in the health-related quality of life score of both patients and parents at the final follow-up (P < .001). The total prostate size (P < .0001) and bladder capacity (P < .0001) increased significantly in all patients of the HCG group. Basal serum testosterone level increased significantly after the first (P = .001) and last (P < .001) injections with no significant increase 3 months after the last injection (P > .05). No major side effect was found following the administration of HCG, with no need for open surgical bladder neck reconstruction. Our preliminary results suggest the role of low-dose HCG in boys with BEEC suffering from urinary incontinence. The data also reveal the role of prostate enlargement in the improvement of urinary incontinence. Chronic treatment with HCG increases bladder capacity that may facilitate future reconstructive surgery.

Novel mutations of the SRD5A2 and AR genes in Thai patients with 46, XY disorders of sex development

Abnormalities of dihydrotestosterone conversion [5α-reductase deficiency: online Mendelian inheritance in man (OMIM) 607306] or actions of androgens [partial androgen insensitivity syndrome (PAIS): OMIM 312300] during the 8th-12th weeks of gestation cause varying degrees of undervirilized external genitalia in 46, XY disorders of sex development (DSD) with increased testosterone production. The objective of the study was to determine clinical and genetic characteristics of Thai patients with 46, XY DSD. A cross-sectional study was conducted in 46, XY DSD with increased testosterone production (n=43) evaluated by a human chorionic gonadotropin (hCG) stimulation test or clinical features consistent with 5α-reductase deficiency or PAIS. PCR sequencing of the entire coding regions of the SRD5A2 and AR genes was performed. Molecular modeling analysis of the androgen receptor-ligand-binding domain (AR-LBD) of a novel mutation was constructed. Mutations were found in seven patients (16.3%): five (11.6%) and two (4.7%) patients had mutations in SRD5A2 and AR, respectively. Two novel mutations, SRD5A2 c.383A>G (p.Y128C) and AR c.2176C>T (p.R726C), were identified. Dimensional structural analysis of the novel mutated AR (p.R726C) revealed that it affected the co-activator binding [binding function-3 (BF-3)], not the testosterone binding site. Short phallus length was associated with 5α-reductase deficiency. Around 16.3% of our patients with 46, XY DSD had 5α-reductase deficiency or PAIS. Two novel mutations of SRD5A2 and AR were identified. The novel mutated AR (p.R726C) might affect the co-activator binding (BF-3), not the testosterone binding site.

Human Chorionic Gonadotropin Stimulation Test in Prepubertal Children with Micropenis Can Accurately Predict Leydig Cell Function in Pubertal or Postpubertal Adolescents

Background/Aim: To evaluate the accuracy of the human chorionic gonadotropin (hCG) stimulation test in children with micropenis in predicting later Leydig cell function. Methods: We conducted a retrospective investigation of testosterone response to a 3-day hCG test (3,000 IU/m²/day) in prepuberty to indicate the need for hormone replacement therapy (HRT) in adolescence. Results: Fifty Japanese boys (range, 0.8-15.4 years of age; median, 8.9) with micropenis were enrolled. Thirty-four spontaneously developed puberty and preserved the ability of testosterone production (group 1), while 16 did not develop any pubertal signs without HRT (group 2). Serum testosterone levels after the hCG test (post-hCG T) in group 2 (range, <0.05-1.1 ng/ml; median, 0.24) were significantly lower than in group 1 (range, 0.5-8.7 ng/ml; median, 2.4; p < 0.0001). Based on true positives who required continuous HRT, the area under the receiver-operating characteristics curve for post-hCG T was 0.983 [95% confidence interval (CI), 0.90-1.00]. The post-hCG T cut-off level corresponding to the Youden index was 1.1 ng/ml (95% CI, 1.0-1.1), with a sensitivity of 100.0% (95% CI, 79.4-100.0) and a specificity of 94.1% (95% CI, 80.3-99.3). Conclusions: The hCG test in prepubertal children with micropenis can be useful for predicting Leydig cell function in pubertal or postpubertal adolescents. The post-hCG T cut-off level of 1.1 ng/ml is recommended to screen for those who will likely require HRT for pubertal development.

Case Report: A 54 base pair inactivating mutation of LHCGR in a 28-year old woman with poor ovarian response

The luteinizing hormone/choriogonadotropin (LH/CG) receptor plays an important role in male and female infertility. Many studies have demonstrated that mutations at specific sites in LHCGR gene may result in mild or complete loss of receptor function. Insertions in exon-1 of LHCGR gene were first studied in male Leydig cell hypoplasia and later extended to female reproductive disorders. Previous studies have shown that these insertions play an important role in intrauterine insemination (IUI) and in vitro fertilization (IVF) outcome. Here we report a 54bp insertion in a 28-year old woman with infertility, recurrent cyst formation and failed stimulated IUI cycles. As the patient showed a blunted response to the ovarian stimulation and human chorionic gonadotropin (hCG) stimulation test, follicle stimulating hormone receptor (FSHR) and luteinizing hormone/choriogonadotropin (LHCGR) gene sequencing was performed. Gene sequence analysis revealed a 54bp homozygous insertion (GCTGCTGAAGCTGCTGCTGCTGCTGCAGCTGCTGAAGCTGCTGCTGCTGCTGCA) in the exon-1 of LHCGR gene. This mutation might have caused a decrease in receptor function in the present infertile patient, thus resulting in poor ovarian response.

Testes in Infants with Prader-Willi Syndrome: Human Chorionic Gonadotropin Treatment, Surgery and Histology

Boys with Prader-Willi syndrome often have undescended testes. Prospective studies on the treatment of cryptorchidism in these patients are lacking. We evaluated the effects of human chorionic gonadotropin administration on testis position in 16 males with Prader-Willi syndrome. In patients who subsequently underwent orchiopexy biopsy was taken and testis histology was evaluated. A total of 16 boys (median age 1.6 years, IQR 1.2 to 1.8) with Prader-Willi syndrome and cryptorchidism underwent human chorionic gonadotropin stimulation test. After a positive test human chorionic gonadotropin treatment was initiated. Patients received 250 to 500 IU (depending on age) intramuscularly twice weekly for 6 weeks. We found 1 testis in a stable scrotal position, 1 vanished testis and 1 atrophic abdominal testis. Of 29 testes responding to human chorionic gonadotropin 23% reached a stable scrotal position, 62% reached a lower position and 14% did not change position. Thus, 22 testes required orchiopexy. Of 17 obtained biopsies in 12 patients 2 showed germ cells in more than 60% of seminiferous tubules, 3 in 30% to 60% and 7 in less than 30%. In addition, 4 boys had Sertoli cell only syndrome and 1 had a vanished testis. In patients undergoing orchiopexy younger age and increased inhibin B and testosterone levels after human chorionic gonadotropin stimulation were associated with a greater number of germ cell containing tubules. Human chorionic gonadotropin administration resulted in an anatomically lower testis position in most of our patients with Prader-Willi syndrome, and 23% of testes reached a stable scrotal position. Of the cases 76% required orchiopexy to ensure a stable position in the scrotum.

Assessment of theca cell function: a prerequisite to androgen or luteinizing hormone supplementation in poor responders

Poor responders are a heterogeneous population, with some patients displaying a diminished ovarian reserve and others a poor ovarian reserve with preserved granulosa cell function. Androgen and LH/hCG supplementation has been advocated for poor responders, mainly those >40 years old. Although androgens synergistically act with FSH to support folliculogenesis, and ovarian androgen secretion declines with age, there is still no evidence that androgen therapy is actually effective to improve ovarian FSH sensitivity. The main reason seems to be that theca cell function has not been appropriately assessed in patients at risk of poor response. The definition of theca insufficiency is hampered by methodologic shortcomings in routine bioassays. Provocative tests for theca cells might help to identify those patients who could benefit from androgen supplementation. The lack of data regarding theca cells in these patients might contribute to explaining the absence of evidence for a positive effect of androgen therapy.

The value of human chorionic gonadotropin stimulation test in predicting ovarian response during in-vitro fertilization

To assess the predictive value of human Chorionic Gonadotropin (hCG) theca-stimulation test for ovarian reserve in women undergoing in-vitro fertilization (IVF) treatments. 39 women were included in the study. All participants received a single hCG 10000 IU injection on cycle day 2-3. Serum levels of estradiol, testosterone, androstenedione and 17-OH progesterone were measured prior to the injection and on days 1, 3 and 7 following the injection. hCG-induced hormone levels were compared with ovarian response during the subsequent IVF cycle. There were 11 good responders (>10 oocytes) and 22 low responders (<3 oocytes). Before hCG stimulation serum E2 levels were higher in low responders compared to good responders (370.3 ± 443 vs. 138.3 ± 54 pmol/ml). Following hCG stimulation, day 3 androstendione levels showed an increase in good responders compared to low responders. The ratio between day 3 androstendione and day 0 estradiol was significantly different between the two groups (p = 0.03). ROC analysis of this test revealed area = 0.837 (good prediction), which was much better than day 3 FSH (area = 0.635, poor prediction). These preliminary results demonstrate the potential use of the hCG theca stimulation test in differentiating between good and poor responders. Larger series are needed for further verification of the test in routine clinical application.

Clinical features of 9 patients with X-linked adrenal hypoplasia congenita caused by DAX1/NR0B1 gene mutations

To study the clinical features of 9 patients with X-linked adrenal hypoplasia congenita (AHC) by gene sequencing so as to provide diagnostic rationales. The patients were 9 cases of X-linked AHC treated at our hospital from July 2007 to June 2009. The clinical manifestations were analyzed. The blood biochemistry tests and the hormone examinations including luteinizing hormone-releasing hormone (LHRH) stimulation tests and human chorionic gonadotropin (HCG) stimulation tests were conducted to evaluate the functions of gonads. And CT scans of adrenal glands and gene tests of DAX1/NR0B1 were performed. Nine AHC patients from 8 families were studied. All patients had DAX1/NR0B1 gene mutations. The main clinical features were: (1) some patients (3 families) had a family history of X-linked recessive inheritance; (2) the ages of onset were all below 10 years old (from 2 month after birth to 9 years old) and ages of being treated at our hospital were from 15 to 34 years old; (3) all patients had adrenocortical hypofunctions, but clinical situations were different, most of them had pigmentation (n = 9), nausea and vomiting (n = 8), hypotension (n = 6), Addisonian crisis (n = 4). Others were debility, hypoglycemia and cold susceptibility. Laboratory tests indicated that all patients had hyponatremia at the onset and higher blood adrenocorticotropic hormone level, lower blood 17-hydroxyprogesterone level compared to normal controls; (4) none of the patients had puberty and there was no responses to LHRH stimulation tests, 3 of them had normal responses to HCG stimulation tests; (5) small bilateral adrenal glands were displayed on CT scans. The main clinical features of X-linked AHC are adrenocortical hypofunction and hypogonadotropic hypogonadism. But the phenotypes vary greatly in different patients. So male children with adrenal cortical hypofunction should be suspected of X-linked AHC and DAX1/NR0B1 gene tests should be performed. The sexual development of the patients also should be followed up.

Serum Basal Inhibin B And Antimullerian Hormone Levels to Show Testicular Tissue Existence: an Experimental Study in Rats

Purpose Diagnostic laparoscopic is the most appropriate method to approach children with bilateral non-palpable testes as imaging studies are not considered to be effective any more. However, some authors advocate endocrinological evaluation beforehand since laparoscopy is an invasive method. The serum basal antimullerian hormone(AMH) and human chorionic gonadotropin stimulation test are the most commonly used two endocrinological methods. We performed bilateral orchiectomy to simulate anorchia in new born rats and compared inhibin B and AMH levels of them with those of the bilateral cryptorchid and normal rats. Material and Methods Totally 108 Sprague-Dawley rats(3 groups of 36 each) were included in this study. Bilateral testis were placed and fixed to the intraabdominal region after birth in the first group. Bilateral orchiectomy was performed after birth in the second group. Third group was the control group. All rats were sacrified in 1, 3, 7, 14, 21 and 35th day and serum samples were collected with intracardiac aspiration.Serum inhibin B and AMH levels were measured. Results Mean serum inhibin B and AMH levels were 113,6 pg/ml and 3,38 ng/ml, respectively in the first group and 129,1 pg/ml and 3,4 ng/ml, respectively in the third group. On the 3rd day of orchiectomy, both inhibin B and AMH decreased to unmeasurable levels (mean inhibin B 0,887 pg/ml and AMH 0,64 pg/ml) in the second group. There was no significant difference between those two hormone levels in terms of sensitivity and specifity (p Conclusions Testicular tissue existence could be determined with the measurement of serum basal inhibin B and AMH levels.

Postnatal testicular regression mircopenis and microcephaly: Conformation of a new syndrome?

Testicular regression may develop at various phases of the intrauterine period and the clinical findings vary depending on the timing of the intrauterine phase. On the other hand, postnatal regression of the testicles is rare and few cases have been reported in the literature. Our patient presented with undescended testicles, micropenis, flat scrotum and microcephaly. The patient's levels of basal luteinizing hormone (LH) were low/normal and follicle stimulating hormone (FSH) was high. No response was obtained in the human chorionic gonadotropin (HCG) stimulation test. The levels of inhibin B and anti Mullerian hormone (AMH) were found to be low. Penile growth response to intramuscular testosterone injections was 2.5 cm. Testicles were visualized bilaterally in inguinal canal by ultrasound examination initially but by 2 years of age no testicular tissue was observed during inguinal exploration. In conclusion we recognized postnatal testicular regression in our patient that had started in the intrauterine period and persisted into infancy. The genital system anomalies, microcephaly and motor retardation in our patient confirm the hypothesis of Parisi et al. of a novel condition of postnatal regression and micropenis.