Case Report: A 54 base pair inactivating mutation of LHCGR in a 28-year old woman with poor ovarian response

Kalagara Madan,Godi Sudhakar,Ravi Krishna Cheemakurthi,Gottumukkala Achyuta Rama Raju,Kota Murali Krishna,Thota Sivanaryana

doi:10.12688/f1000research.6137.1

Kalagara Madan, Godi Sudhakar + Show 4 more

Open Access

https://doi.org/10.12688/f1000research.6137.1

Copy DOI

Abstract

The luteinizing hormone/choriogonadotropin (LH/CG) receptor plays an important role in male and female infertility. Many studies have demonstrated that mutations at specific sites in LHCGR gene may result in mild or complete loss of receptor function. Insertions in exon-1 of LHCGR gene were first studied in male Leydig cell hypoplasia and later extended to female reproductive disorders. Previous studies have shown that these insertions play an important role in intrauterine insemination (IUI) and in vitro fertilization (IVF) outcome. Here we report a 54bp insertion in a 28-year old woman with infertility, recurrent cyst formation and failed stimulated IUI cycles. As the patient showed a blunted response to the ovarian stimulation and human chorionic gonadotropin (hCG) stimulation test, follicle stimulating hormone receptor (FSHR) and luteinizing hormone/choriogonadotropin (LHCGR) gene sequencing was performed. Gene sequence analysis revealed a 54bp homozygous insertion (GCTGCTGAAGCTGCTGCTGCTGCTGCAGCTGCTGAAGCTGCTGCTGCTGCTGCA) in the exon-1 of LHCGR gene. This mutation might have caused a decrease in receptor function in the present infertile patient, thus resulting in poor ovarian response.

Highlights

Luteinizing hormone (LH) is a key regulator of the female menstrual cycle[1] and is produced by the anterior pituitary gland of gonadotroph cells
LH and chorionic gonadotrophin (CG) hormones act through the luteinizing hormone/choriogonadotropin (LH/CG) receptor which facilitates the activation of different cell groups in the ovaries
Hormonal, functional biomarkers are used to assess the ovarian response during controlled ovarian stimulation (COS)[15]

Summary

Introduction

Luteinizing hormone (LH) is a key regulator of the female menstrual cycle[1] and is produced by the anterior pituitary gland of gonadotroph cells. Women, whose LH receptor is down regulated with GnRH agonists or antagonists, may have decreased concentrations of luteinizing hormone and follicle stimulating hormone. This results in poor outcome due to low endogenous LH levels. LHCGR gene was detected in a patient with a clinical history of poor response to human menopausal gonadotrophin (hMG) stimulation and recurrent cyst formation. As the AMH (0.2 ng/dl) and the ovarian reserves were low and there was no other option available, in the cycle patient was super ovulated with a hMG dose of 225 units/day for 10 days. A day 2 scan in the subsequent cycle showed an ovarian cyst formation again

Materials and methods

Results and discussion

Dekel N