Human C-myc Research Articles

A tunable assay for modulators of genome-destabilizing DNA structures.

Regions of genomic instability are not random and often co-localize with DNA sequences that can adopt alternative DNA structures (i.e. non-B DNA, such as H-DNA). Non-B DNA-forming sequences are highly enriched at translocation breakpoints in human cancer genomes, representing an endogenous source of genetic instability. However, a further understanding of the mechanisms involved in non-B DNA-induced genetic instability is needed. Small molecules that can modulate the formation/stability of non-B DNA structures, and therefore the subsequent mutagenic outcome, represent valuable tools to study DNA structure-induced genetic instability. To this end, we have developed a tunable Förster resonance energy transfer (FRET)-based assay to detect triplex/H-DNA-destabilizing and -stabilizing ligands. The assay was designed by incorporating a fluorophore-quencher pair in a naturally-occurring H-DNA-forming sequence from a chromosomal breakpoint hotspot in the human c-MYC oncogene. By tuning triplex stability via buffer composition, the assay functions as a dual-reporter that can identify stabilizers and destabilizers, simultaneously. The assay principle was demonstrated using known triplex stabilizers, BePI and coralyne, and a complementary oligonucleotide to mimic a destabilizer, MCRa2. The potential of the assay was validated in a 384-well plate with 320 custom-assembled compounds. The discovery of novel triplex stabilizers/destabilizers may allow the regulation of genetic instability in human genomes.

The Efficacy and Safety of Sendai Viral Reprograming of Mouse Primary Cells Using Human Vectors.

Induced pluripotent stem cells (iPSCs) remain a promising approach to target diseases with a loss of functional parenchyma. This technology comes with a number of concerns for clinical applications, including teratogenic potential and genomic instability. Here we focused on evaluating the safety of cross-species Sendai viral reprogramming, as well as investigating the transcriptional dynamics during reprogramming and differentiation. We established that Sendai viral vectors carrying human Oct4, Sox2, Klf4, and c-Myc (OSKM) could produce mouse iPSCs free of transduced viral materials. Gene expression analysis revealed an efficient silencing of the virally-introduced human pluripotency factors and upregulation of the endogenous pluripotency network over time. In addition, single cell gene expression analysis of proof-of-principle-derived cardiomyocytes revealed distinct expression patterns indicative of subspecialized cardiac cell lineages. Moreover, our results demonstrate the importance of monitoring genomic aberrations before any clinical or preclinical applications, as we detected a high prevalence of chromosomal instability. Taken together, we demonstrated the successful use of a clinically germane method to reprogram terminally differentiated mouse cells and their potential to generate specialized cardiac cell types. Additionally, our results suggest a plasticity of OSKM to reprogram more divergent species and provide a new application of an established reprogramming approach.

Novel triazole and morpholine substituted bisnaphthalimide: Synthesis, photophysical and G-quadruplex binding properties

Four bisnaphthalimides derivatives 3a, 3b, 5a and 5b with polyamine linkage have been synthesized and characterized. Different spectroscopic techniques, including UV–Vis spectroscopy, fluorescence spectroscopy, circular dichroism and fluorescence resonance energy transfer (FRET), have been used to explore the interaction of these compounds with G-quadruplex structures (Htelo, c-myc, c-kit). The compounds 3a, 3b and 5b show high affinity toward Htelo, c-myc and c-kit G-quadruplexes (Ka > 4.42 × 106 M−1), and exhibit more than 40-fold selectivity for the quadruplex versus CT DNA. Binding of 3a, 3b to telomeric and oncogenic G-quadruplexes induce strong enhancement of the fluorescence intensity (18–27-fold), whereas the duplex CT DNA induces much weaker fluorescence enhancement (around 2-fold). Being fluorescent, the cellular localization of 3a, 3b can be conveniently tracked by fluorescence imaging. The results indicate that 3a, 3b can readily be taken up by A549 lung cancer cells. Molecular docking studies indicate that 3a, 3b, 5a and 5b mainly bind in the groove and/or loop region of the G-quadruplexes, and hydrogen bonding plays an important role in the interaction of bisnaphthalimide derivatives with G-quadruplexes. CD spectroscopy and FRET melting assay indicate that 3a, 3b and 5b can promote the formation and the stabilization of human telomeric and c-myc G-quadruplex DNA. The compound 3b can inhibit the growth of A549 cells (IC50 = 0.15 μM), with a much higher antitumor activity than amonafide.

NMR Investigation of the Interaction between the RecQ C-Terminal Domain of Human Bloom Syndrome Protein and G-Quadruplex DNA from the Human c-Myc Promoter

Bloom syndrome protein (BLM) is one of five human RecQ helicases that participate in DNA metabolism. RecQ C-terminal (RQC) domain is the main DNA binding module of BLM and specifically recognizes G-quadruplex (G4) DNA structures. Because G4 processing by BLM is essential for regulating replication and transcription, both G4 and BLM are considered as potential targets for anticancer therapy. Although several studies have revealed the detailed mechanism of G4 unwinding by BLM, the initial recognition of the G4 structure by the RQC domain is unclear. Here, we investigated the interaction between BLM RQC and the G4 DNA from the c-Myc promoter by NMR spectroscopy. While the signals broadened upon reciprocal titrations, the β-wing of RQC had significant chemical shift perturbations and experienced millisecond timescale dynamics upon G4 binding. A point mutation in the β-wing (N1164A) reduced G4 binding affinity. Our hydrogen–deuterium exchange data indicate that imino protons of G4 were exchanged with deuterium much faster in the presence of RQC. We suggest that RQC binds to G4 by using the β-wing as a separating pin to destabilize the G4. By providing information about the RQC–G4 interaction, our study yields insight into potential strategies for preventing G4 processing by BLM.

Generation of Genetically Stable Human Direct-Conversion-Derived Neural Stem Cells Using Quantity Control of Proto-oncogene Expression

As the human lifespan has increased due to developments in medical technology, the number of patients with neurological diseases has rapidly increased. Therefore, studies on effective treatments for neurological diseases are becoming increasingly important. To perform these studies, it is essential to obtain a large number of patient-derived neural cells. The purpose of the present study was to establish a technology that allows the high-efficiency generation of genetically stable, direct-conversion-derived neural stem cells (dcNSCs) through the expression of a new combination of reprogramming factors, including a proto-oncogene. Specifically, human c-MYC proto-oncogene and the human SOX2 gene were overexpressed in a precisely controlled manner in various human somatic cells. As a result, the direct conversion into multipotent dcNSCs occurred only when the cells were treated with an MOI of 1 of hc-MYC proto-oncogene and hSOX2 retrovirus. When MOIs of 5 or 10 were utilized, distinct results were obtained. In addition, the pluripotency was bypassed during this process. Notably, as the MOI used to treat the cells increased, expression of the p53 tumor suppressor gene, which is typically a reprogramming hurdle, increased proportionately. Interestingly, p53 was genetically stable in dcNSCs generated through direct conversion into a low p53 expression state. In the present study, generation of genetically stable dcNSCs using direct conversion was optimized by precisely controlling the overexpression of a proto-oncogene. This method could be utilized in future studies, such as in vitro drug screening using generated dcNSCs. In addition, this method could be effectively utilized in studies on direct conversion into other types of target cells.

Targeting Burkitt Lymphoma By CAR-Extracellular Vesicles: A Tropism-Delivery Platform for CRISPR/Cas9 System

IntroductionCRISPR/Cas9 system is a highly efficient genomic editing system. However, application of CRISPR/Cas9 system in vivo is somewhat limited for delivery methods and safety concerns. Extracellular vesicles (EVs) are released by exocytosis which results in consistent surface membrane proteins with original cells and capable to deliver several kinds of materials in vivo. However, EVs can be absorbed by other organs or tissues besides tumors, leading to possible off-target effects. Therefore, it is imperative to enhance the targeting property of EVs in vivo. Recently, clinical advances have confirmed that CAR-T cells possess great tropism and multiple choices of target. This may be an effective means to improve EVs' selective accumulation in tumors. In this proof-of-principle study, we exploit the target precision of CAR to establish an EV-derived tropism-delivery platform for CRISPR/Cas9 system as a novel therapeutic strategy for malignant diseases.MethodsWe established CD19-CAR-293T cell line by CAR lentivirus transfection. Raji cells (Burkitt lymphoma) were chosen as target tumor cells for it's CD19 positive. For the isolation of EVs from CD19-CAR-293T and 293T cells, culture medium was harvested, centrifuged and filtered through 0.45μm filters to remove the dead cells and large microvesicles. Purified EVs were examined by (NTA). The plasmids of CRISPR/Cas9 system targeting human cMyc gene were constructed by standard protocols and electroporated into EVs using Gene Pulser Xcell Electroporation System (BioRad). EVs were labelled with lipophilic fluorescent dye for visualization of confocal images. Uptake of EVs in Raji cells was analyzed using confocal microscope. To observe the biodistribution of EVs, Raji-bearing xenograft NOD/SCID mice were generated. When the tumors reached 200mm3, labelled EVs were intracardially injected to mice. Biofluorescence images were obtained using IVIS imaging system.ResultsNTA showed that a size distribution of approximately 100nm to 450nm for two types of EVs (Fig. 1A). The modifications didn't affect the physical properties. We used a fixed number ratio of Raji cells to EVs in incubation to compare the uptake efficiency between normal EVs and CD19-CAR-EVs. After one hour of incubation with Raji cells, uptake efficiency of the CD19-CAR-EVs was higher than that of the normal EVs, as indicated by signal intensity in the confocal microscope images (Fig. 1B). To confirm whether CD19-CAR-EVs could target tumors in vivo, we intracardially injected the same number of labelled EVs or CD19-CAR-EVs to Raji xenograft NOD/SCID mice and observed at 0h and 24h post-injection. As results, the CD19-CAR-EVs significantly accumulated in tumor sites compared to liver, kidney and other tissues. In contrast, the normal EVs were distributed throughout the body (Fig. 1C). Ex vivo images exhibited that compared with the EV group, the CD19-CAR-EVs accumulated more in tumors and less in liver, kidney and other tissues (Fig. 1C). The tumor/whole-body fluorescence intensity ratios were calculated in the EV and CD19-CAR-EV groups (Fig. 1D). At 24h post-injected, the ratios in the CD19-CAR-EV group were higher than that in EV group (P<0.05).Twelve days after the subcutaneous xenograft models were generated, CD19-CAR-EVs loaded with CRISPR/Cas9 system targeting human cMyc were injected intracardially or intratumorally (i.t.) to mice with interval of 4 days for 5 times. Mice injected with EVs only, with plasmid of cMyc sgRNA/Cas9 only, and with Cas9 loaded CD19-CAR-EVs without sgRNA were used as control groups. Tumor sizes were compared among groups at 18 days post the first EVs injection. Tumors from intracardially injected CD19-CAR-EVs+cMyc sgRNA/Cas9 group were smaller than those from EVs+cMyc sgRNA/Cas9 group. And the tumors from intratumoral injection of CD19-CAR-EVs+cMyc sgRNA/Cas9 were the smallest ones among groups (Fig. 1E).ConclusionIn this study, we take advantages of CAR's affinity to tumor cells and EVs' delivery capacity, and generated CD19-CAR-EVs capable of delivering CRISPR/Cas9 system. This CAR-EV-derived tropism-delivery system can be administered systemically or locally and accumulated selectively in tumor tissues to achieve gene editing in vivo. With evolving repertoires of CARs and multiplex genome engineering abilities of CRISPR/Cas9, this approach is with great potential for biotechnological and therapeutic applications. [Display omitted] DisclosuresNo relevant conflicts of interest to declare.

C-Myc is a regulator of the PKD1 gene and PC1-induced pathogenesis.

Autosomal dominant polycystic kidney disease (ADPKD) is among the most common monogenic disorders mainly associated with PKD1/PC1 mutations. We show herein that renal regulation in Pc1 dosage-reduced and -increased mouse models converge toward stimulation of c-Myc expression along with β-catenin, delineating c-Myc as a key Pkd1 node in cystogenesis. Enhanced renal c-Myc-induced ADPKD in SBM transgenic mice lead conversely to striking upregulation of Pkd1/Pc1 expression and β-catenin activation, lending credence for reciprocal crosstalk between c-Myc and Pc1. In adult SBM kidneys, c-Myc is strongly enriched on Pkd1 promoter with RNA pol II, consistent with Pkd1 upregulation during cystogenesis. Similar c-Myc direct binding at birth uncovers an equivalent role on Pkd1 regulation during renal developmental program. Concurrent with enriched c-Myc binding, recruitment of active chromatin modifying co-factors by c-Myc at the Pkd1 regulatory region probably opens chromatin to stimulate transcription. A similar transcriptional activation by c-Myc is also likely operant on endogenous human PKD1 gene from our transactivation analysis in response to human c-MYC upregulation. Genetic ablation of c-Myc in Pc1-reduced and -increased mouse models significantly attenuates cyst growth, proliferation and PKD progression. Our study determined a dual role for c-Myc, as a major contributor in Pc1-induced cystogenesis and in a feed-forward regulatory Pkd1-c-Myc loop mechanism that may also prevail in human ADPKD.

Crystal structure of the major quadruplex formed in the promoter region of the human c-MYC oncogene.

The c-MYC oncogene mediates multiple tumor cell survival pathways and is dysregulated or overexpressed in the majority of human cancers. The NHE III1 region of the c-MYC promoter forms a DNA quadruplex. Stabilization of this structure with small molecules has been shown to reduce expression of c-MYC, and targeting the c-MYC quadruplex has become an emerging strategy for development of antitumor compounds. Previous solution NMR studies of the c-MYC quadruplex have assigned the major conformer and topology of this important target, however, regions outside the G-quartet core were not as well-defined. Here, we report a high-resolution crystal structure (2.35 Å) of the major quadruplex formed in the NHE III1 region of the c-MYC promoter. The crystal structure is in general agreement with the solution NMR structure, however, key differences are observed in the position of nucleotides outside the G-quartet core. The crystal structure provides an alternative model that, along with comparisons to other reported quadruplex crystal structures, will be important to the rational design of selective compounds. This work will aid in development of ligands to target the c-MYC promoter quadruplex with the goal of creating novel anticancer therapies.

Oxadiazole/Pyridine-Based Ligands: A Structural Tuning for Enhancing G-Quadruplex Binding

Non-macrocyclic heteroaryls represent a valuable class of ligands for nucleic acid recognition. In this regard, non-macrocyclic pyridyl polyoxazoles and polyoxadiazoles were recently identified as selective G-quadruplex stabilizing compounds with high cytotoxicity and promising anticancer activity. Herein, we describe the synthesis of a new family of heteroaryls containing oxadiazole and pyridine moieties targeting DNA G-quadruplexes. To perform a structure–activity analysis identifying determinants of activity and selectivity, we followed a convergent synthetic pathway to modulate the nature and number of the heterocycles (1,3-oxazole vs. 1,2,4-oxadiazole and pyridine vs. benzene). Each ligand was evaluated towards secondary nucleic acid structures, which have been chosen as a prototype to mimic cancer-associated G-quadruplex structures (e.g., the human telomeric sequence, c-myc and c-kit promoters). Interestingly, heptapyridyl-oxadiazole compounds showed preferential binding towards the telomeric sequence (22AG) in competitive conditions vs. duplex DNA. In addition, G4-FID assays suggest a different binding mode from the classical stacking on the external G-quartet. Additionally, CD titrations in the presence of the two most promising compounds for affinity, TOxAzaPy and TOxAzaPhen, display a structural transition of 22AG in K-rich buffer. This investigation suggests that the pyridyl-oxadiazole motif is a promising recognition element for G-quadruplexes, combining seven heteroaryls in a single binding unit.

Generating a recombinant phosphothreonine-binding domain for a phosphopeptide of the human transcription factor, c-Myc

Transcription factor c-Myc is an oncoprotein that is regulated at the post-translational level through phosphorylation of two conserved residues, Serine 62 (Ser62) and Threonine 58 (Thr58). A highly specific tool capable of recognizing Myc via pThr58 is needed to monitor activation and localization. Through phage display, we have isolated 10 engineered Forkhead-associated (FHA) domains that selectively bind to a phosphothreonine (pThr)-containing peptide (53-FELLPpTPPLSPS-64) segment of human c-Myc. One domain variant was observed to bind to the Myc-pThr58 peptide with a KD value of 800 nM and had >1000-fold discrimination between the phosphorylated and non-phosphorylated peptide. The crystal structure of the engineered FHA Myc-pThr-binding domain (Myc-pTBD) was solved in complex with its cognate ligand. The Myc-pTBD was observed to be structurally similar to the yeast Rad9 FHA1 domain, except that its β4-β5 and β10-β11 loops form a hydrophobic pocket to facilitate the interaction between the domain and the peptide ligand. The Myc-pTBD’s specificity for its cognate ligand was demonstrated to be on a par with 3 commercial polyclonal antibodies, suggesting that this recombinant reagent is a viable alternative to antibodies for monitoring Myc regulation.

Targeting G-quadruplex DNA structures in the telomere and oncogene promoter regions by benzimidazole‒carbazole ligands

Recent studies support the idea that G-quadruplex structures in the promoter regions of oncogenes and telomere DNA can serve as potential therapeutic targets in the treatment of cancer. Accordingly, several different types of organic small molecules that stabilize G-quadruplex structures and inhibit telomerase activity have been discerned. Here, we describe the binding of benzimidazole-carbazole ligands to G-quadruplex structures formed in G-rich DNA sequences containing the promoter regions of human c-MYC, c-KIT1, c-KIT2, VEGF and BCL2 proto-oncogenes. The fluorescence spectroscopic data indicate that benzimidazole-carbazole ligands bind and stabilize the G-quadruplexes in the promoter region of oncogenes. The molecular docking studies provide insights into the mode and extent of binding of this class of ligands to the G-quadruplexes formed in oncogene promoters. The high stability of these G-quadruplex structures was validated by thermal denaturation and telomerase-catalyzed extension of the 3' end. Notably, benzimidazole-carbazole ligands suppress the expression of oncogenes in cancer cells in a dose-dependent manner. We anticipate that benzimidazole-carbazole ligands, by virtue of their ability to stabilize G-quadruplex structures in the promoter regions of oncogenes, might reduce the risk of cancer through the loss of function in the proteins encoded by these genes.

Probing the Ionic Atmosphere and Hydration of the c-MYC i-Motif.

G-quadruplexes and i-motifs are noncanonical secondary structures of DNA that appear to play a number of regulatory roles in the genome with clear connection to disease. Characterization of the forces stabilizing these structures is necessary for developing an ability to induce G-quadruplex and/or i-motif structures at selected genomic loci in a controlled manner. We report here the results of pH-dependent acoustic and densimetric measurements and UV melting experiments at elevated pressures to scrutinize changes in hydration and ionic atmosphere accompanying i-motif formation by the C-rich DNA sequence from the promoter region of the human c-MYC oncogene [5'-d(TTACCCACCCTACCCACCCTCA)] (ODN). We also conducted pH-dependent acoustic and densimetric characterizations of two DNA molecules that are compositionally identical to ODN but do not adopt the i-motif conformation, 5'-d(CTCTCACCACACCACACCTCTC) (ODN1) and 5'-d(CACACTCCTCACCTCTCCACAC) (ODN2). Our results reveal that i-motif formation by ODN is not accompanied by changes in volume and compressibility. The volumetric similarity of the i-motif and coil states of ODN implies a fortuitous compensation between changes in the intrinsic and hydration contributions to volume and compressibility. Analysis of the pH-dependent volumetric profiles of ODN, ODN1, and ODN2, along with the data on volumetric changes accompanying the protonation of isolated cytosine and deoxycytidine, suggests that protonation of the cytosines in the oligonucleotides causes release of the majority if not all of their counterions to the bulk. Thus, in the i-motif conformation, the oligomer no longer acts as a polyelectrolyte insofar as counterions are concerned. We discuss the biological ramifications of our results.

Protein Charge Transfer Absorption Spectra: An Intrinsic Probe to Monitor Structural and Oligomeric Transitions in Proteins

Protein Charge Transfer Spectra (ProCharTS) originate when charged amino/carboxylate groups in Lys/Glu, act as electronic charge acceptors/donors for photoinduced electron transfer either from/to the polypeptide backbone or to each other (Prasad et. al., 2017, DOI: 10.1039/c7sc00880e). The absorption band intensities in ProCharTS (250—800 nm) are dependent on 3D spatial proximity between charged functional groups across the protein. Intrinsically disordered proteins (IDPs) are rich in charged amino acids, but lack structure promoting intrinsic spectral probes like Tyr or Trp in their sequence, making their structural characterisation difficult. Here, we exploit, the richness of charged amino acid population among IDPs to sense structural transitions among multiple IDPs (like PEST fragment of human c-Myc, its mutant and Dehydrin from maize) using ProCharTS absorption spectra. Conformational changes induced in the IDP by altering pH/temperature of aqueous medium was monitored by ProCharTS and confirmed by CD spectra. Further, utility of ProCharTS to detect protein aggregation was examined using Hen Egg-White Lysozyme (HEWL) protein. Significant changes in ProCharTS spectrum was observed with changing pH in the range 3—11, which correlated with changes in secondary structure of PEST fragment. Importantly, absorbance at 280 nm, which is often employed as a measure of protein concentration, was profoundly altered by changes in ProCharTS intensity in response to changing pH in Dehydrin. ProCharTS intensity was sensitive to temperature induced changes in the secondary structure of PEST fragments between 25—85oC. Finally, increase in ProCharTS absorbance with time, in HEWL at pH 2, directly correlated with growth of HEWL aggregates and amyloid fibrils as confirmed by rising thioflavin T fluorescence. Taken together, our work highlights the utility of ProCharTS absorption as a novel label-free intrinsic probe to monitor changes in protein charge, structure and oligomeric state.

Controlled and localized delivery of c-myc AS-ODN to cells by 3-aminopropyl-trimethoxylsilane modified SBA-15 mesoporous silica

SBA-15 mesoporous silicate was synthesized and functionalized with 3-aminopropyl organic groups through a post-synthesis method. The materials were characterized consecutively by powder X-ray diffraction (XRD), N2 adsorption/desorption analysis and solid-state magic-angle spinning 29Si nuclear magnetic resonance (MAS NMR). Human c-myc anti-sense oligodeoxyneucleotide (AS-ODN) was selected as a model molecule to be loaded onto the surface of bare and functionalized SBA-15 via different loading conditions. It has been found that the amount of AS-ODN incorporated into the porous matrix is strongly dependent on the surface properties, pH of the loading solvent and AS-ODN concentration. The release behaviour of AS-ODN from modified SBA-15 materials was also investigated and depended on conditions chosen. Cellular uptake of the eluted AS-ODN into Hela cells was observed by fluorescent microscopy. The materials showed excellent cytocompatibility. The AS-ODN keeps full transfection and expression activities indicating its structural integrity. The functionalized SBA-15 is an excellent prospect as a biomedical material candidate for the future.

The adaptive immune system promotes initiation of prostate carcinogenesis in a human c-Myc transgenic mouse model

Increasing evidence from epidemiological and pathological studies suggests a role of the immune system in the initiation and progression of multiple cancers, including prostate cancer. Reports on the contribution of the adaptive immune system are contradictive, since both suppression and acceleration of disease development have been reported. This study addresses the functional role of lymphocytes in prostate cancer development using a genetically engineered mouse model (GEMM) of human c-Myc driven prostate cancer (Hi-Myc mice) combined with B and T cell deficiency (RAG1-/- mice). From a pre-cancerous stage on, Hi-Myc mice showed higher accumulation of immune cells in their prostates then wild-type mice, of which macrophages were the most abundant. The onset of invasive adenocarcinoma was delayed in Hi-MycRAG1-/- compared to Hi-Myc mice and associated with decreased infiltration of leukocytes into the prostate. In addition, lower levels of the cytokines CXCL2, CCL5 and TGF-β1 were detected in Hi-MycRAG1-/- compared to Hi-Myc mouse prostates. These results from a GEMM of prostate cancer provide new insights into the promoting role of the adaptive immune system in prostate cancer development. Our findings indicate that the endogenous adaptive immune system does not protect against de novo prostate carcinogenesis in Hi-Myc transgenic mice, but rather accelerates the formation of invasive adenocarcinomas. This may have implications for the development of novel treatment strategies.

Assessment on application value of combination of TCT, HPV, c-MYC and hTERC genes to screen cervical cancer

Objective To investigate the application value of combination of thinprep cytologic test (TCT), human papilloma virus (HPV), c-MYC and human chromosome telomerase gene (hTERC) genes to screen cervical cancer. Methods A total of 230 cases of the study objects was detected with TCT and HP, respectively. Amplification of c-MYC and hTERC genes was tested with fluorescence in situ hybridization (FISH) method. The histopathological results were the gold standard, and the sensitivity, specificity and accuracy of cervical intraepithelial neoplasia (CIN) Ⅱ/Ⅲ and squamous cell carcinoma (SCC) were compared with the four combined detection. Results Of 230 screened patients, there were 124 cases of TCT positive, 155 cases of HPV positive, c-MYC gene amplified in 118 cases, and hTERC gene amplified in 128 cases. When TCT, HPV, c-MYC, and hTERC were used alone, the highest sensitivity was HPV (84.5%), the highest specificity was c-MYC (97.6%), and the highest accuracy was hTERC (85.2%). When the three indexes were used in coordination with each other, the sensitivity and accuracy of TCT+ HPV+ hTERC were the highest (98.6% and 90.9%), and the specificity of TCT+ c-MYC+ hTERC was the highest (79.3%). When the four indexes were used together, the sensitivity was 98.6%, the specificity was 72.0%, and the accuracy was 89.1%. Conclusions Combined examination can improve the sensitivity and accuracy of screening cervical lesions, and the three combination of TCT+ HPV+ hTERC had the best effect, and c-MYC gene detection had the highest specificity. Key words: Biopsy; Papillomaviridae; Genes, myc; Telomerase; Uterine cervical neoplasms/DI

Abstract 1950: Introducing c-Myc into transformed human mesenchymal stem cells and osteoblasts to recapitulate the osteosarcoma phenotype

Abstract Osteosarcoma (OS) is the most common primary malignant bone tumor in children and young adults. It remains unclear at what point in the pathway of differentiation between human mesenchymal stem cells (hMSCs) and osteoblasts (OBs), OS originates. Since high grade OS frequently demonstrates histologic variability, as well as the potential for multi-lineage differentiation, some consider the hMSC as the cell of origin in OS, whereas others believe the osteoblast to be the most likely cell of origin. Identifying the primary cell of origin is crucial in understanding the molecular pathogenesis of OS. To address the potential for hMSCs or OBs to transform into OS, we have performed insertional mutagenesis in hMSCs and OBs with defined genetic elements which have the potential to lead to tumorigenesis and whose pathways have been altered in OS patient specimens. Serial introduction of the viral constructs hTERT (T), SV40Tag (S), and H-RAS (R), led to spindle cell tumor formation in mice. However, MSC-TSR tumors did not form osteoid, whereas OB-TSR tumors showed only scant production of osteoid. Also the addition of β-catenin to MSC-TS cells failed to lead to tumor formation in mice. Based on these findings, MSC-TS and OB-TS cell lines may be ideal platforms for further analysis of the impact of the genetic transformation of hMSCs and OBs into OS. c-Myc has been shown to be overexpressed in OS cells and hence has been suggested as an oncogene. It has been also suggested as a novel target of RUNX2 through rescue from the apoptosis. MSC-TS and OB-TS cells were transformed with a retrovirus containing human c-Myc. Drug resistant colonies were picked up 21 days after selection to obtain stably transformed cell lines. Quantitative PCR and western blots were carried out to detect both gene and protein expression patterns in transformed cell lines, respectively. Furthermore, in order to determine the expression pattern of c-Myc in OS, quantitative PCR and western blots were also performed on human osteosarcoma primary samples, xenografts and cell lines. All functional assays outlined below will be performed to determine the tumorigenic properties of transformed cell lines. Six out of seven (86%) osteosarcoma primary samples showed a significantly greater c-Myc gene expression level compared to the positive control cell lines. Selection of stably transformed clones and comparison between cell lines and characterizations are underway. Further ongoing characterization includes: soft agar assays, in-vivo tumorigenic assays, histological examination for osteoid production and other OS specific immunohistochemical markers, proliferation, invasion and migration, and differentiation assays. It is our hope that this study will highlight the model that closely recapitulates the human osteosarcoma phenotype by forming a malignant spindle cell tumor that produces aberrant osteoid, and has the potential for multi-lineage differentiation. Citation Format: Sajida Piperdi (Thein), Wendong Zhang, Daria Ivenitsky, Yidan Zhang, Yunjia Zhang, David S. Geller, Bang Hoang, Rui Yang, Jonathan B. Gill, Michael Roth, Richard Gorlick. Introducing c-Myc into transformed human mesenchymal stem cells and osteoblasts to recapitulate the osteosarcoma phenotype [abstract]. In: Proceedings of the American Association for Cancer Research Annual Meeting 2017; 2017 Apr 1-5; Washington, DC. Philadelphia (PA): AACR; Cancer Res 2017;77(13 Suppl):Abstract nr 1950. doi:10.1158/1538-7445.AM2017-1950

Structural insight for the recognition of G-quadruplex structure at human c-myc promoter sequence by flavonoid Quercetin

Small molecule ligands that could stabilize G-quadruplex structure formed at the promoter region of human c-myc oncogene will regulate its expression in cancer cells. Flavonoids, a group of naturally available small molecule, have been known for their various promising effects on human health. In present study, we have performed detailed biophysical studies for the interaction of human c-myc G-quadruplex DNA with nine representative flavonoids: Luteolin, Quercetin, Rutin, Genistein, Kaempferol, Puerarin, Hesperidin, Myricetin and Daidzein. We found by using fluorescence titration that Quercetin interacts with c-myc G-quadruplex DNA sequence Pu24T with highest affinity. This interaction was further explored by using NMR spectroscopy and we have derived the first solution structure for the complex formed between Quercetin and biologically significant c-myc promoter DNA sequence forming G-quadruplex structure. In present solution structure, Quercetin stacks at 5′ and 3′ G-tetrads of Pu24T G-quadruplex structure and stabilize it via π-π stacking interactions. Furthermore, in vitro studies on HeLa cells suggested that Quercetin induces apoptosis-mediated cell death and down-regulated c-myc gene expression. This study emphasizes the potential of flavonoids as a promising candidate for targeting c-myc promoter region and thus, could act as a potential anti-cancer agent.

Indole-3-carbinol induces apoptosis of chronic myelogenous leukemia cells through suppression of STAT5 and Akt signaling pathways.

Signal transducer and activator of transcription 5 and Akt pathways, implicated in signaling transduction downstream of BCR-ABL, play critical roles in the pathogenesis of chronic myeloid leukemia. Therefore, idenication of novel compounds that modulate the activity of such pathways could be a new approach in the treatment of chronic myeloid leukemia. Previous studies have demonstrated that indole-3-carbinol inhibits the proliferation and induces apoptosis of various tumor cells. However, its anticancer activity against chronic myeloid leukemia cells and the underlying mechanism remain unclear. Our data revealed that indole-3-carbinol promoted mitochondrial apoptosis of chronic myeloid leukemia-derived K562 cells, as evidenced by the activation of caspases and poly (ADP-ribose) polymerase cleavage. Treatment with indole-3-carbinol was found to be associated with a decrease in the cellular levels of phospho-Akt and phospho-signal transducer and activator of transcription 5. In addition, real-time polymerase chain reaction analysis showed that the downregulation of genes is regulated by Akt and signal transducer and activator of transcription 5. We also found that treatment with indole-3-carbinol resulted in the activation of the p38 mitogen-activated protein kinase and reduced expression of human telomerase and c-Myc. Collectively, these results demonstrate that the oncogenic signal transducer and activator of transcription 5/Akt pathway is a cellular target for indole-3-carbinol in chronic myeloid leukemia cells. Thus, this clinically tested natural compound can be a potential candidate in the treatment of chronic myeloid leukemia following confirmation with clinical studies.

Targeted downregulation of dMyc restricts neurofibrillary tangles mediated pathogenesis of human neuronal tauopathies in Drosophila

Formation of Neurofibrillary Tangles (NFTs) in neuronal tissues has been implicated as the hallmark of disease pathogenesis and tau mediated toxicity in human and mammalian models. However, previous studies had failed to correlate NFT formation with pathogenesis of human neuronal tauopathies in Drosophila disease models. Though, a recent report suggests formation of tau mediated NFTs like structures confined to dopaminergic neurons in Drosophila adult brain; by utilizing various approaches, we demonstrate distinct and recurrent formation of NFTs in Drosophila neuronal tissues upon expression of wild type or mutant isoforms of human tau protein, and this appears as the key mediator of the pathogenesis of human neuronal tauopathy in Drosophila. Further, we show that tissue specific downregulation of dMyc (Drosophila homolog of human c-myc proto-oncogene) alleviates h-tau mediated cellular and functional deficits by restricting the formation of NFTs in neuronal tissues. Therefore, our findings provide very critical and novel insights about pathogenesis of human neuronal tauopathies in Drosophila disease models.