Host Cell Phenotype Research Articles

The evolution of a mechanism of cell suicide.

In the vertebrates, programmed cell death or apoptosis frequently involves the relocalization of mitochondrial cytochrome c to the cytoplasm. This prominent role in the regulation of apoptosis is in addition to the primary function of cytochrome c in the mitochondrial electron transport chain. These seemingly divergent roles become plausible when considering the symbiotic origin of the mitochondrion. Symbiosis involves conflicts between levels of selection, in this case between the primitive host cell and the protomitochondria. In an aerobic environment, selection on the protomitochondria may have favored routine manipulations of the host cell's phenotype using products and by-products of oxidative phosphorylation, in particular reactive oxygen species (ROS). Blocking the mitochondrial electron transport chain by removing cytochrome c enhances the production of ROS; thus cytochrome c release by protomitochondria may have altered the host cell's phenotype via enhanced ROS production. Subsequently, this signaling pathway may have been refined by selection so that cytochrome c itself became the trigger for changes in the host's phenotype. A mechanism of apoptosis in metazoans may thus be a vestige of evolutionary conflicts within the eukaryotic cell.

Analysis of methylation patterns in the regulatory region of the latent Epstein-Barr virus promoter BCR2 by automated fluorescent genomic sequencing.

We analyzed the methylation patterns of CpG dinucleotides in the regulatory region of the latent Epstein-Barrvirus (EBV) promoter BCR2 (also called C promoter, Cp) using automated fluorescent genomic sequencing after bisulfite-induced modification of DNA. BCR2 is one of the alternative promoters for transcripts encoding the growth-transformation-associated nuclear antigens EBNA 1-6 which are expressed in a host cell phenotype dependent manner. Well characterized clones isolated from the Burkitt's lymphoma (BL) line Mutu differing from each other as to their phenotype and EBV latent gene expression were used in the present study. We found that in Mutu BL III clone 99 which is actively using the BCR2 promoter the regulatory sequences are unmethylated with two exceptions (position 10702 and 10799). In contrast, there are 15 methylated cytosines in the same region in Mutu BL I clone 216 where the BCR2 promoter is silent. Cytosines which are potential targets of DNA methyltransferase in the immediate vicinity or within the attachment sites of cellular C promoter binding factors CBF1 and CBF2 remained hypomethylated in Mutu BL I clone 216. This suggests a role for a hypermethylated region (nucleotides 10666 -10865, -639 to -440 bases upstream from the beginning of the TATA box at position 11305) in silencing of the BCR2 promoter in these cells.

An oligodeoxyribonucleotide-directed dual amber method for site-directed mutagenesis

A simple procedure for in vitro site-directed mutagenesis (SDM) was developed using two oligodeoxyribonucleotide (oligo) primers, one serving as selection primer and the other for mutagenesis in the target DNA (mutagenic primer). The mutant clones can be selected by reversion mutations of dual amber (am) to dual Gln codons in the cat gene, resulting in a chloramphenicol-resistant phenotype in supo host cells. Unlike previously reported procedures, the new method requires neither special chemical reagents, nor single-stranded DNA purification, nor any additional biochemical treatments such as multiple PCRs, restriction digestion and so on, but utilises one of the oligo-directed dual am (ODA) plasmids, i.e., pKF16c, pKF17c, pKF18c or pKF19c. The two amber (am) mutations located two codons apart from each other in cat (catam2) can be simultaneously reverted with a 20-nucleotide primer (CQ, pAACCAGACCGTTCAGCTGGA) during primer extension. In a model experiment using the lacZ′ gene, an am mutation or a single-bp deletion (sbd) mutation was frequently co-introduced in lacZ′ using a mixture of am- or sbd-encoding mutagenic primer for lacZ′, and the CQ primer for catam2. Applying this procedure to the human AT cDNA (encoding antithrombin), a missense mutation (Arg406 → Met) in one of the human AT variants, AT-Kyoto, involved in congenital thrombosis disease, was introduced efficiently into the wild-type cDNA (> 85%).

Cell Phenotype-Dependent Control of Epstein-Barr Virus Latent Membrane Protein 1 Gene Regulatory Sequences

Growth transformation-associated Epstein-Barr virus-encoded genes are differentially regulated depending on the host cell phenotype. We have previously identified an LMP1 regulatory region (LRS) 5′ of the LMP1 gene (+40 to -634) and analyzed its role in transcription initiation in the EBV-negative Burkitt's lymphoma line DG 75 (Fåhraeus et al., 1990a). In order to investigate the cell phenotype dependence of LMP1 gene regulation we have now compared the activity of positive and negative cis -acting LRS elements in cell lines of B lymphoid and epithelial cell origin in the presence and absence of the virus-encoded nuclear antigen EBNA2. Our results show that reporter plasmids that contain only the -54/+40 region of LRS are active in all tested cell lines. Furthermore, the previously identified negative cis-elements in the -144/-54 region were found to suppress promoter activity independent of the cell phenotype. EBNA2 was able to override the effect of the negative elements in all lines of B-cell origin, whereas it had no effect in epithelial lines. The positive effect of EBNA2 was mediated by cis-acting elements in the -214/-144-bp region. In all six tested cell lines of epithelial origin, reporter plasmids that carried the full-length LRS were active, independent of EBNA2. The LMP1 promoter in these constructs was activated by the concerted action of EBNA2-independent, positive elements in the -214/-144 and -324/-214 positions that counteracted the effect of the negative LRS elements.

Three short fragments of Rts1 DNA are responsible for the temperature-sensitive growth phenotype (Tsg) of host bacteria

Rts1 is a multiphenotype drug resistance factor, and one of its phenotypes is temperature-sensitive growth (Tsg) of host bacteria. A 3.65-kb fragment from Rts1 DNA was shown to cause the Tsg phenotype in host cells. This tsg fragment was split by a restriction enzyme, HincII, into four fragments. Two of these fragments were called HincII-S (short) and HincII-L (long), respectively. Each of these two fragments conferred the Tsg phenotype, indicating that, in fact, these two independent regions were responsible for the Tsg phenotype. The HincII-S 783-bp and HincII-L 1,479-bp fragments were sequenced. The region in the HincII-S fragment to which the Tsg phenotype was attributed was narrowed to a 146-bp (nucleotides 1 to 146) fragment by various restriction enzyme digestions. Further digestion of the 146-bp fragment with Bal 31 suggested that the 116-bp (nucleotides 9 to 124) fragment is the minimum sequence required for Tsg. On the other hand, in the HincII-L fragment, a fragment of 249 bp (nucleotides 1210 to 1458) and a fragment of 321 bp (nucleotides 1942 to 2262) contained separate temperature-sensitive growth activity. None of three tsg fragments contained open reading frames. The 249-bp fragment had very weak Tsg activity, while the 321-bp fragment had no Tsg activity. On the other hand, when these two fragments were together in the pUC19 vector, they exhibited very strong Tsg activity equivalent to that of the original 1,479-bp fragment. In addition, two of the 249-bp fragments gave similar, strong Tsg activity. The HincII-L 1,479-bp fragment contained an open reading frame for kanamycin resistance which was found between nucleotides 1423 and 2238. This kanamycin resistance gene sequence was different from that of the reported kanamycin resistance gene of Tn903 at 12 positions which were deduced to change seven amino acids.

Evaluation of phenotype of mononuclear host cells isolated from primary tumour and peripheral blood of patients with laryngeal carcinoma.

Mononuclear host cells isolated from primary laryngeal carcinoma were assessed by means of indirect immunofluorescence with a panel of monoclonal antibodies against various lymphocyte subsets and macrophages. Tumours of various staging groups were examined in parallel with cells isolated from patient and donor peripheral blood (PBL). It was found that percentage values of cells bearing T3 and T4 phenotype were reduced both in tumour infiltrating cells (TIC) and in PBL population. The fall in T4+ cells in PBL from cancer patients in T3 and T4 staging groups was statistically significant (p less than 0.01) as compared with donor cells. Corresponding values for T8+ cells from TIC were increased in T1 and T2 staging groups of cancer, but showed a gradual fall in advanced stages. The T4+/T8+ cell ratio was decreased in both TIC and PBL cells. The HNK-1+ (NK) cell pattern in TIC was analogous to that for T8+ cells, i.e. the cell percentage decreased with advance in tumour growth. Corresponding values for OKM-1+ were increased in TIC and in patient blood, though in TIC they grew in proportion to tumour growth. Ia+ (HLA-DR+) cells in peripheral blood were significantly increased in patients versus those of donors (p less than 0.01), but only in T3 and T4 staging groups of examined cancer. These results show that subsets of tumour infiltrating cells in laryngeal carcinoma are a complex phenomenon, associated with growth and progression of tumour.

Susceptibility of various human tissues to transformation in vivo with human papillomavirus type 11.

Human papillomaviruses (HPVs) are associated with proliferative lesions in a variety of human epithelial types. In some cases, the associations are highly specific in that a certain papillomavirus type may infect only one human epithelial cell phenotype. In other cases, one papillomavirus apparently infects several tissue types and not others. Further, HPV replication capacity varies considerably in different epithelia. Due to the lack of a suitable method, it has not been possible, until now, to define the role of the host cell phenotype in determining the outcome of infection with an HPV. We recently developed a system in which human epithelium was exposed to HPV-II and transplanted to athymic mice. Cervix and skin grafts developed into typical condylomata. We now test the hypothesis that the outcome of infection of diverse epithelial types with a single human papillomavirus is largely determined by the phenotype of the original epithelial cell. For example, skin obtained from a number of disparate sites from a single patient varied dramatically in its capacity for morphological transformation with HPV-II. Skin from penis was highly susceptible, but skin from abdomen did not transform. Vocal cord from 3 children and 2 adults responded to HPV-II infection by producing typical laryngeal papillomata. A variety of tissues were obtained from II donor infants and infected with HPV-II. Foreskin and cervical tissues of these children were transformed at a frequency of 100%. Vocal cord was transformed at an incidence of 88% and urethra at 73%. Only 37% of esophagus samples were transformed and both abdominal skin and urinary bladder from the same infants were totally resistant to morphological transformation. In a separate study, ureteral tissues from a child and an adult were completely resistant to HPV-II infection. Papillomavirus replication was readily detected as capsid antigen in foreskin, cervix, and urethra, but was poorly expressed in morphologically-transformed esophagi and vocal cords. In the last two tissues HPV-II DNA and RNA were demonstrated in cells by in situ hybridization techniques. We conclude that the epithelial cell phenotype is a major determinant of HPV-II infection, controlling both morphological transformation and viral replication.

Bacterial plasmid stability

AbstractBacterial plasmids are ubiquitous ‘minichromosomes’ that have major importance in clinical microbiology, as agents of pathogenicity and as carriers of antibiotic resistance, and in molecular genetics, through their role as vectors in gene manipulation. Plasmids carry a wide range of dispensable, transiently useful and often bizarre functions.1 Naturally occurring plasmids, in addition to modifying the host cell phenotype, carry genes involved in the control of their own vegetative replication, plasmid copy number2 and stable inheritance. They may also carry determinants for the conjugal transfer of DNA between bacteria.3 Whereas low‐copy‐number plasmids must be partitioned by some active process during cell division, the evidence suggests that multicopy plasmids are distributed randomly between daughter cells. Two independent determinants are necessary for the stable inheritance of multicopy plasmids, and both of these appear to act by maximizing the number of independent plasmid molecules.

The selection and characterization of two novel mutations in the overlapping promoters of the Escherichia coli galactose operon

Mutations that result in small decreases or increases in expression from the Escherichia coli galactose operon promoter region can be detected by using a plasmid in which the gal promoters were fused to the lac operon. We described how the level of lac expression was adjusted so that the Lac phenotype of host cells was optimally sensitive to changes in the gal promoter sequence. We have investigated the properties of two new gal promoter mutations both in vivo and in vitro, and have determined their effects on the two overlapping gal promoters, P1 and P2. Although one mutation causes only a small reduction in overall expression in vivo, it completely supresses transcription initiation at the P1 promoter. However, it also increases expression from the P2 promoter, which compensates for the change at P1. This mutation, a GC to AT transition, falls in a zone just upstream of the P1 Pribnow box, which is essential for P1 activity, whilst improving the homology between the P2 Pribnow box and the consensus sequence. The second mutation causes a small increase in P1 activity. This change, a GC to AT transition at −23, falls in the spacer region between the Pribnow box and the −35 region, a zone containing no know promoter consensus sequences. We suggest that this mutation, which creates a strecth of five AT base pairs, acts by increasing the twist angle of the sequences in the spacer region. We argue that the increase in promoter activity is due to this twist changing the relative orientation of the Pribnow box and −35 regions.

A genetic approach to the study of mitomycin-induced lysis of Escherichia coli K-12 strains which produce colicin E2.

A 2,250 base pair Sau3A restriction digest fragment of the colicin plasmid ColE2-P9 was shown to contain all the information necessary for colicin production, immunity to colicin E2 and mitomycin-induced lysis in host cells. Transposon Tn5 insertions in the colicin structural gene (ceaB) completely abolished colicin production and mitomycin-induced immunity protein production and lysis. This indicates the existence of a SOS-regulated colicin E2 operon in which ceaB:: Tn5 mutations exert a polar effect on genes concerened with lysis and production of immunity protein. However, cells harbouring these plasmids were immune to colicin E2, a phenomenon which is probably explained by the existence of an internal, SOS-independent promotor in front of the immunity gene (ceiB). A Tn5 insertion in a site (celB) removed from ceaB and ceiB produced a colicin+ immunity+ lysis- phenotype in host cells treated with mitomycin. These cells produced abnormally low amounts of colicin both in the presence and absence of mitomycin induction. Another difference between these cells and those harbouring wild-type ColE2 plasmids is that the vast majority of the colicin they produced remained within the cells. Cells carrying the wild-type ColE2 plasmid were shown to produce four additional polypeptides when grown in the presence of mitomycin. The two small polypeptides (Mr 5,000 and 3,000) were specifically absent from mitomycin-treated cells harbouring the plasmid with the celB:: Tn5 mutation, whereas all four polypeptides (the other two being the colicin and immunity proteins) were not detected in mitomycin-treated cultures of cells harbouring the plasmids with ceaB:: Tn5 mutations. The possible role of the Mr 5,0000 and 3,000 polypeptides in the regulation of colicin synthesis, cell lysis and colicin release is discussed.

SUPPRESSOR CELLS IN TRANSPLANTATION TOLERANCE

In order to differentiate between donor (chimeric F1) cells and host cells as being responsible for suppression in transplantation tolerance (TT), cells from tolerant donors were first subject to negative selection through F1 hybrid intermediate host animals. This revealed that the suppressor cells was neither completely removed from the lymph nor recoverable from the lymphoid tissues of the filter rat when highly suppressive inocula were used, suggesting that suppression did not directly depend on cells with receptors for alloantigens. The phenotype of donor and host cells in the recirculating pool was studied with fluorescent antisera and showed that both host cells and chimeric F1 cells were in the thoracic duct lymph of tolerant rats and were capable of recirculation. T and B lymphocytes of both types were present but the IgG-positive, presumptive memory B cells were highly enriched in those rapidly recirculating cells, obtained by filtration of tolerant inocula through irradiated intermediate hosts. These cells were also highly enriched for suppressor function. Methods which selectively depleted either the chimeric T cells or the B cells were applied to tolerant inocula and on adoptive transfer of these inocula, suppression was eliminated only when chimeric T cells were eliminated. This strict dependence of suppression of F1 hybrid T cells is interpreted as evidence that these cells probably suppress directly, via an anti-idiotypic mechanism, the alloreactive cells bearing idiotype-positive major histocompatibility complex receptors.

Inhibition of sindbis virus replication by ribavirin: Influence of cultural conditions and of the host cell phenotype

Several factors which influence the ability of ribavirin to inhibit the replication of Sindbis virus in baby hamster kidney (BHK) cells are described; these include the cell passage level, the presence of serum in the medium and cell density. Inhibition of viral replication was much more effective with low passage cells than with high passage cells. However, with high passage cells antiviral activity was enhanced 1) when subconfluent cultures were infected, rather than confluent cultures, and 2) when infected cultures were maintained in the presence of serum rather than without serum. Under all conditions, a good correlation was found between the inhibition of virus replication by ribavirin and its ability to reduce cellular GTP levels. Using Chinese hamster ovary cell mutants we found that ribavirin inhibited Sindbis virus replication in cells lacking hypoxanthine phosphoribosyltransferase (HPRT −) but not in HPRT + cells. This result and the demonstration that Aedes albopictus cells (in which ribavirin is very effective) are unable to incorporate hypoxanthine suggest that certain salvage enzymes involved in purine metabolism can interfere with the antiviral activity of ribavirin.

Mutants of Escherichia coli variably resistant to bacteriophage T1.

Carta, Guy R. (Rutgers, The State University, New Brunswick, N.J.), and Vernon Bryson. Mutants of Escherichia coli variably resistant to bacteriophage T1. J. Bacteriol. 92:1055-1061. 1966.-Mutants resistant to bacteriophage T1 were isolated from ultraviolet (UV)-irradiated cultures of Escherichia coli B/r, a UV-resistant variant. Bacterial populations derived from some of these mutants were partially but not completely resistant to the bacteriophage. Such mutants, designated variably resistant (B/r/1v), could not be obtained from E. coli B. Phage-free mutant populations taken from different stages in growth consisted of significantly different proportions of T1-resistant and T1-sensitive cells. The growth stage-dependent range of variation exceeded 1,000-fold. In broth cultures, the highest proportion of resistant cells consistently appeared at mid-log phase, and the highest proportion of sensitive cells at lag and stationary phases. Comparable evidence for environmentally dependent changes in host-cell phenotype was obtained by efficiency of plating and cloning efficiency analysis tests. Micromanipulation showed that, in clones growing in the presence of phage T1, sensitive bacteria appeared with high frequency and underwent lysis.