Hormone Gene Research Articles

ODP305 Differentiation Potential of Marginal Layer-Derived Adult Pituitary Stem/Progenitor Cells into Vascular Endothelial Cells and Pericytes in Mice

Abstract The anterior lobe (AL) of the pituitary gland consists five types of hormone-producing cells and fenestrated sinusoids (i. e., vascular endothelial cells and pericytes) that cooperate to maintain the physiological function of the gland. In addition, the population of cells located in pituitary stem/ progenitor cell niche, the marginal layer, which faces the residual lumen of the Rathke's pouch, serve to renew pituitary cells throughout life. We recently established a protocol for isolating marginal layer-derived adult pituitary stem/progenitor cells (MPSCs) by using differences in cell adhesion (1), and then showed differentiation potential into hormone-producing cells by subjecting MPSCs to three-dimensional culture. However, it is unclear whether MPSCs are capable of differentiating into all types of cells that constitute the pituitary gland. In this study, we performed DNA microarray analysis in MPSCs, which were proliferated by two-dimensional (2D) culture, for studying comprehensively gene expression profiles. Next, we investigated what kind of cells MPSCs would differentiate into. Comparing gene expression profiles of the AL and MPSCs, in MPSCs, 1776 genes were increased more than 4-fold and 1715 genes were decreased 4-fold compared to the AL (p<0. 05, respectively). The upregulated genes included pituitary stem/progenitor cell markers (ex. Sox2, Sox9, Klf4, Prrx1), niche markers (ex. Cdh1, Krt8), and cell surface antigens (ex. Cd9, Cd34, Cd44). On the other hand, most of the downregulated genes were differentiation markers (ex. Pou1f1, Gata2, Tbx19, Kdr). Next, immunofluorescent analysis revealed that most of the MPSCs were positive for CD34, the hematopoietic stem cell marker. After further 2D culture of MPSCs for 5-7days, vascular endothelial marker PECAM1-positive cells were detected by immunofluorescent analysis, but pericyte marker CSPG4-positive cell not. When TGFβ was applied to 2D culture of MPSCs, CSPG4-positive cells were detected instead of PECAM1-positive cells. Expression levels of Pecam1and Cspg4 were also examined by qPCR analysis, which corresponded to the results of immunofluorescent analysis. On the other hand, expression levels of anterior hormone genes were almost unchanged. These results have demonstrated that MPSCs could differentiate into vascular endothelial cells and pericytes. The present study suggests that pituitary stem/progenitor cells, which derived from the marginal layer, are a source of not only hormone-producing cells but also cells that constitute blood vessels. Reference: (1) Shintani and Higuchi, Stem Cell Res. 2021 Feb 2;52: 102223. Presentation: No date and time listed

Effects of triazole plant growth regulators on molting mechanism in Chinese mitten crab (Eriocheir sinensis)

Rice crab co-culture is a new integrated farming model in China. The application of triazole plant growth regulators (PRGs) is often used as an advantageous option to combat rice lodging. However, there is still a gap regarding the toxicity of these PRGs on the growth and development of the Chinese mitten crab (Eriocheir sinensis, E. sinensis). Here the effect of triazoles (paclobutrazol and uniconazole) on the molting mechanism of E. sinensis was investigated. Monitoring of regulatory genes associated with molting showed that the two PRGs were found to inhibit the expression of ecdysteroid hormone (EH), ecdysteroid receptors gene (EcR), and retinoid X receptors gene (RXR) and induce secretion of molt-inhibiting hormone (MIH) gene. In addition, the activities of chitinase (CHIA) and N-acetyl-β-d-aminoglucosidase (β-NAGase) were also inhibited by exposure to PRGs. Exposure to PRGs also elevated the mRNA expression of the growth-related myostatin gene (MSTN). These results revealed that there is a long-term risk of exposure to triazoles PRGs that may inhibit molting and affect normal development and immune system of E. sinensis.

Regional association and transcriptome analysis revealed candidate genes controlling plant height in Brassica napus.

The online version contains supplementary material available at 10.1007/s11032-022-01337-1.

Dietary dragonhead effects on growth, immunity and antioxidant and related genes expression in zebrafish (Danio rerio)

The present study aimed to investigate the effects of the herbaceous plant, Dracocephalum kotschyi, on the immune response, antioxidant enzymes activity, growth performance, and related genes expression in zebrafish (Danio rerio). An in vivo trial was carried out by feeding zebrafish (initial weight of 0.47 ± 0.04 g) with different levels of powdered D. kotschyi: 0% (C-0%, control), 1% (Dk-1%), 2% (Dk-2%) and 3% (Dk-3%) for 10 weeks. The results show that total protein (TP) and total immunoglobulin (IG), were significantly increased in both skin mucus and whole body extract (WBE). Lysozyme (LYS) activity significantly increased in the WBE of zebrafish fed with D. kotschyi integrated diets compared to the control (P < 0.05). The superoxide dismutase (SOD) of WBE was significantly (P < 0.05) enhanced by dietary D. kotschyi. Additionally, this herb brought about a significant up-regulation in immune (LYS), pro-inflammatory (IL-1β) from intestine, and antioxidant (SOD and CAT) genes in liver, compared to the non-supplemented group (P < 0.05). Growth hormone (GH) and insulin growth factor (IGF) genes expression were upregulated significantly in zebrafish by the addition of D. kotschyi, although body weight did not change. The best results were obtained with the 3% inclusion of powdered D. kotschyi, except for LYS and IGF expressions that were best upregulated by 2% and 3% of D. kotschyi. Our results indicate that powdered D. kotschyi (suggested dose of 3%) could potentially improve zebrafish's immune response and antioxidant defense.

Impact of One-Week Administration of Dihydrotestosterone in Rat Anterior Pituitary Gland.

Hyperandrogenism causes dysfunction of the hypothalamic–pituitary–gonadal (HPG) axis in reproductive women. In this study, we examined the effects of dihydrotestosterone (DHT) on characteristic changes in rat anterior pituitary gland samples. DHT was administered to ovary-intact 6-week postnatal female rats for 7 days, after which the anterior pituitary glands were examined and compared with those in control rats. Estrous cyclicity was not drastically disrupted by DHT treatment. Common gonadotropin α subunit (Cga), luteinizing hormone β subunit (Lhb), and follicle-stimulating hormone (FSH) β subunit (Fshb) gene expression levels were not modulated by DHT treatment, while prolactin (Prl) gene expression was significantly repressed by DHT. Gonadotropin-releasing hormone (GnRH) receptor (Gnrh-r) gene expression was significantly inhibited by DHT, whereas pituitary adenylate cyclase-activating polypeptide (PACAP) receptor (Pca1-r) gene expression was increased by DHT. Gene expression levels of the receptors encoded by thyrotropin-releasing hormone (Trh-r) and kisspeptin (Kiss1-r) genes were unchanged. Expression of inhibin α subunit (Inha) and activin βA subunits (Actba) within the pituitary was inhibited by DHT treatment, while activin B subunit (Actbb) and follistatin (Fst) gene expression was unchanged by DHT. In mouse pituitary gonadotroph LβT2 cells, DHT did not modulate the gene expression of Gnrh-r, but it inhibited the expression of Inha and Actba subunits within the LβT2 cells. In rat prolactin-producing GH3 cells, DHT did not modulate prolactin gene expression, but it increased Pac1-r gene expression. The present observations suggest that DHT directly or indirectly affects the anterior pituitary gland and induces characteristic changes in hormone-producing cells.

Identification and Expression Analysis of Dsx and Its Positive Transcriptional Regulation of IAG in Black Tiger Shrimp (Penaeus monodon).

Doublesex (Dsx) is a polymorphic transcription factor of the DMRTs family, which is involved in male sex trait development and controls sexual dimorphism at different developmental stages in arthropods. However, the transcriptional regulation of the Dsx gene is largely unknown in decapods. In this study, we reported the cDNA sequence of PmDsx in Penaeus monodon, which encodes a 257 amino acid polypeptide. It shared many similarities with Dsx homologs and has a close relationship in the phylogeny of different species. We demonstrated that the expression of the male sex differentiation gene Dsx was predominantly expressed in the P. monodon testis, and that PmDsx dsRNA injection significantly decreased the expression of the insulin-like androgenic gland hormone (IAG) and male sex-determining gene while increasing the expression of the female sex-determining gene. We also identified a 5′-flanking region of PmIAG that had two potential cis-regulatory elements (CREs) for the PmDsx transcription. Further, the dual-luciferase reporter analysis and truncated mutagenesis revealed that PmDsx overexpression significantly promoted the transcriptional activity of the PmIAG promoter via a specific CRE. These results suggest that PmDsx is engaged in male reproductive development and positively regulates the transcription of the PmIAG by specifically binding upstream of the promoter of the PmIAG. It provides a theoretical basis for exploring the sexual regulation pathway and evolutionary dynamics of Dmrt family genes in P. monodon.

Long-day stimulation increases thyroid-stimulating hormone expression and affects gonadal development in chub mackerel

For seasonal breeders, photoperiodic changes are important signals that mark the start of the breeding season. Thyroid-stimulating hormone (TSH) is a glycoprotein hormone that not only promotes the secretion of thyroid hormone but also plays a key role in regulating seasonal reproduction in birds and mammals. However, whether TSH activation has been implicated as a seasonal indicator in fish breeding has not been fully investigated. In this study, we isolated tshb as a starting point to elucidate the effect of photoperiodic changes on the activation of the reproductive axis of chub mackerel. The isolated tshb was classified as tshba, which is widely conserved in vertebrates. The quantitative PCR results showed that tshb was strongly expressed in the pituitary. When female and male chub mackerel with immature gonads were reared for six weeks under different photoperiodic conditions, the gonads developed substantially in the long-day (LD) reared fish compared to those in the short-day reared fish. Real-time PCR results showed that the expression level of tshb in the pituitary gland was significantly elevated in the LD group. Although there was no difference in the gonadotropin-releasing hormone 1 gene expression level in the preoptic area of the brain, follicle-stimulating hormone and luteinizing hormone gene expression levels in the pituitary were also significantly elevated in the LD group. In conclusion, TSH is a potential mediator of seasonal information in the reproductive endocrine axis and may induce gonadal development during the breeding season of chub mackerel.

Effect of autoantibody against follicle stimulating hormone (Fsh) induced by DNA vaccine in rainbow trout Oncorhynchus mykiss

In this study, effects of DNA vaccine encoding rainbow trout (Oncorhynchus mykiss) follicle stimulating hormone (Fsh) gene (pCI-Fsh) was evaluated. pCI-Fsh was injected into the fish to analyze the specific antibody titer against Fsh and sexual maturation. The antibody titer against Fsh in the vector-injected fish was significantly higher than those in the PBS-injected fish at 13 and 146 days after injection. On the other hand, vitellogenin gene expression levels in the female fish and 11-ketoteststeron concentration in the male fish were not significantly different between the vector- and PBS-injected fish. In addition, gonad somatic index and body weight of the trout were not significantly different between the fish. These results suggested that the autoantibody induced by pCI-Fsh was not sufficient to inhibit sex steroidogenesis in the trout.

Novel pituitary actions of GnRH in teleost: The link between reproduction and feeding regulation.

Gonadotropin-releasing hormone (GnRH), as a vital hypothalamic neuropeptide, was a key regulator for pituitary luteinizing hormone (LH) and follicle-stimulating hormone (FSH) in the vertebrate. However, little is known about the other pituitary actions of GnRH in teleost. In the present study, two GnRH variants (namely, GnRH2 and GnRH3) and four GnRH receptors (namely, GnRHR1, GnRHR2, GnRHR3, and GnRHR4) had been isolated from grass carp. Tissue distribution displayed that GnRHR4 was more highly detected in the pituitary than the other three GnRHRs. Interestingly, ligand–receptor selectivity showed that GnRHR4 displayed a similar and high binding affinity for grass carp GnRH2 and GnRH3. Using primary culture grass carp pituitary cells as model, we found that both GnRH2 and GnRH3 could not only significantly induce pituitary reproductive hormone gene (GtHα, LHβ, FSHβ, INHBa, secretogranin-2) mRNA expression mediated by AC/PKA, PLC/IP3/PKC, and Ca2+/CaM/CaMK-II pathways but also reduce dopamine receptor 2 (DRD2) mRNA expression via the Ca2+/CaM/CaMK-II pathway. Interestingly, GnRH2 and GnRH3 could also stimulate anorexigenic peptide (POMCb, CART2, UTS1, NMBa, and NMBb) mRNA expression via AC/PKA, PLC/IP3/PKC, and Ca2+/CaM/CaMK-II pathways in grass carp pituitary cells. In addition, food intake could significantly induce brain GnRH2 mRNA expression. These results indicated that GnRH should be the coupling factor to integrate the feeding metabolism and reproduction in teleost.

De Novo Transcriptome Assembly, Gene Annotations, and Characterization of Functional Profiling Reveal Key Genes for Lead Alleviation in the Pb Hyperaccumulator Greek Mustard (Hirschfeldia incana L.).

Lead (Pb) contamination is a widespread environmental problem due to its toxicity to living organisms. Hirschfeldia incana L., a member of the Brassicaceae family, commonly found in the Mediterranean regions, is characterized by its ability to tolerate and accumulate Pb in soils and hydroponic cultures. This plant has been reported as an excellent model to assess the response of plants to Pb. However, the lack of genomic data for H. incana hinders research at the molecular level. In the present study, we carried out RNA deep transcriptome sequencing (RNA-seq) of H. incana under two conditions, control without Pb(NO3)2 and treatment with 100 µM of Pb(NO3)2 for 15 days. A total of 797.83 million reads were generated using Illumina sequencing technology. We assembled 77,491 transcript sequences with an average length of 959 bp and N50 of 1330 bp. Sequence similarity analyses and annotation of these transcripts were performed against the Arabidopsis thaliana nr protein database, Gene Ontology (GO), and KEGG databases. As a result, 13,046 GO terms and 138 KEGG maps were created. Under Pb stress, 577 and 270 genes were differentially expressed in roots and aboveground parts, respectively. Detailed elucidation of regulation of metal transporters, transcription factors (TFs), and plant hormone genes described the role of actors that allow the plant to fine-tune Pb stress responses. Our study revealed that several genes related to jasmonic acid biosynthesis and alpha-linoleic acid were upregulated, suggesting these components’ implication in Hirschfeldia incana L responses to Pb stress. This study provides data for further genomic analyses of the biological and molecular mechanisms leading to Pb tolerance and accumulation in Hirschfeldia incana L.

Effect of weight loss on pregnancy outcomes, neuronal-reproductive-metabolic hormones and gene expression profiles in granulosa cells in obese infertile PCOS patients undergoing IVF-ET.

ObjectiveTo investigate the effect of weight loss on pregnancy outcomes, PCOS related neuronal-reproductive-metabolic hormones and ovarian granulosa cell gene expression profiles in obese PCOS infertile patients undergoing in vitro fertilization-embryo transfer (IVF-ET).Methods75 patients undergoing IVF-ET due to tubal factors alone collected as the control group (group A), and 352 patients with obese PCOS infertility were divided into four groups according to the amount of weight loss before IVF: 0 kg (group B), 1-5 kg (group C), 5-10 kg (group D), and >10 kg (group E). Six cases of ovarian granulosa cells were collected randomly with the random number table method in each group for detecting mRNA profiling. Pathway networks and biological functions of the differentially expressed genes were analyzed. Validation by RT-PCR was performed.Results(1) The levels of luteinizing hormone(LH), testosterone(T) and homeostasis model assessment insulin resistance(HOMA-IR) in group E were significantly lower than those in groups B and C (P<0.05). (2) Compared with groups A and E, groups B and C showed increased total gonadotropin (Gn) and days of Gn stimulation (P<0.05), and the E2 level on trigger day and number of oocytes obtained in group B was significantly less than that in group E (P<0.05 or 0.01). Embryo implantation rate, clinical pregnancy rate and live birth rate were increased and miscarriage rate was decreased in groups A, D and E compared with group B (P<0.05 or 0.01). (3) There were significant differences among the control group and PCOS groups in some genes that are involved in neuronal-reproductive-metabolic endocrine, transcriptional regulation, cell proliferation and differentiation, etc (P<0.05). RNA-Seq results were validated by real time PCR analysis for the expression of follicle stimulating hormone receptor (FSHR), drosophila mothers against decapentaplegic protein 7(Smad7) and glutathione peroxidase 3(GPX3) genes that are known to have an important role in follicular development. Functional alterations were confirmed by the improvement in the ovarian responsiveness to Gn and embryo quality.ConclusionWeight loss more than 5kg may regulate the neuroreproductive endocrine hormone secretion, insulin resistance and gene expression profiles of ovarian granulosa cells, so as to improve the ovarian responsiveness to Gn, the embryo quality, embryo implantation rate, clinical pregnancy rate, live birth rate, and reduce the spontaneous abortion rate in obese infertile PCOS patients undergoing IVF-ET.Clinical trial registration www.chictr.org.cn, identifier ChiCTR1800018298.

Neuropeptides and hormones in hypothalamus-pituitary axis of Chinese sturgeon (Acipenser sinensis)

The hypothalamus and pituitary serve as important neuroendocrine center, which is able to secrete a variety of neuropeptides and hormones to participate in the regulation of reproduction, growth, stress and feeding in fish. Chinese sturgeon is a basal vertebrate lineage fish with a special evolutionary status, but the information on its neuroendocrine system is relatively scarce. Using the transcriptome data on the hypothalamus-pituitary axis of Chinese sturgeon as reference, we found out 46 hypothalamus neuropeptide genes, which were involved in regulation of reproduction, growth, stress and feeding. The results of sequence alignment showed that the neuroendocrine system of Chinese sturgeon evolves slowly, which confirms that Chinese sturgeon is a species with a slow phenotypic evolution rate. In addition, we also isolated six pituitary hormones genes from Chinese sturgeon, including reproductive hormones: follicle-stimulating homone (FSH) and luteinizing hormone (LH), growth-related hormones: growth hormone (GH)/prolactin (PRL)/somatolactin (SL), and stress-related hormone gene: proopiomelanocortin (POMC). Similar to teleost, immunostaining localization analysis in Chinese sturgeon pituitary showed that LH and FSH were located in the pituitary proximal pars distalis, SL was located in the pituitary rostral pars distalis, and POMC was located in the pituitary pars intermedia and pituitary rostral pars distalis. This study will give a contribution to enrich our information on the neuroendocrine system in Chinese sturgeon.

Effects of Temperature on Growth, Molting, Feed Intake, and Energy Metabolism of Individually Cultured Juvenile Mud Crab Scylla paramamosain in the Recirculating Aquaculture System

An eight-week experiment was conducted to investigate the effects of temperature (20, 25, 30, and 35 °C) on growth performance, feed intake, energy metabolism, antioxidant capacity, and the stress response of juvenile Scylla paramamosain in a recirculating aquaculture system. The results showed that the survival rate of the 35 °C group was 80.36 ± 5.92%, significantly lower than that of the other three groups (100%). The high molt frequency of mud crabs was observed in high-temperature groups, accompanied by a higher ecdysone level and ecdysone receptor gene expression but lower molt inhibitory hormone gene expression. However, the molt increment (73.58 ± 2.18%), food intake, and feed conversion efficiency showed a parabolic trend, with the lowest value found in the 35 °C group. Oxygen consumption rate and ammonia excretion rate increased with the increasing temperature, and oxygen-nitrogen ratio, lactic acid, triglyceride, total cholesterol, glucose, and cortisol peaked at 35 °C. Temperature also significantly affected the antioxidant system of S. paramamosain. Crabs in the 25 °C and 30 °C had a significantly higher total antioxidant capacity and lower malondialdehyde compared with the 35 °C group (p &lt; 0.05). Although the high temperature promoted molting, it decreased the feeding rate and growth performance, leading to oxidative stress and functional hypoxia. The quadratic function model demonstrated the optimum temperature for the specific growth rate of juvenile S. paramamosain was 28.5–29.7 °C.

PSXII-6 Evaluation of the Influence of bGH Gene Polymorphism on Elemental Composition of Blood Serum and Beef Productivity of Black Spotted Bulls

Abstract The purpose of this study was to establish the effect of single-nucleotide polymorphism of the bovine growth hormone (bGH) gene on elemental status and beef productivity of Black Spotted bulls (n=100; age-18 months). DNA samples were isolated from whole blood. The bGH gene polymorphism was determined using the PCR-RFLP method followed by restriction analysis. The elemental composition of the samples was estimated according to 25 chemical elements (Al, As, B, Ca, Cd, Co, Cr, Cu, Fe, I, K, Li, Mg, Mn, Na, Ni, P, Pb, Se, Si, Sn, Hg, Sr, V, Zn) by ICP AES and ICP MS. The detection of SNP (rs135322669) in the bGH gene showed three genotypes: CC (n=58), CG (n=24), GG (n=18). A comparative analysis showed that blood serum of animals with CC genotype contained significantly (Р£0.05) more Co, Cr, Cu, Fe, Ca, I, Se, Si, Li, Sr compared to the CG and Cu, I genotypes, Se, Ca, Si, Li, V, Sr in comparison with the GG genotype. In bulls with genotype CG to GG more toxic elements-Al, Sn, Pb were accumulated significantly (P£0.01). The Black Spotted bulls with the CC genotype advanced over animals with CG and GG, according to fresh carcass weight by 5.1 (Р≤0.05) and 8.9% (Р≤0.05), carcass yield-by 0.38 and 0.91% (Р≤0.05), internal fat mass-by 5.9 (Р≤0.05) and 15.6% (Р≤0.01), slaughter weight-by 4.8 (Р≤0.05) and 9.1% (Р≤0.01), slaughter yield-by 0.51 and 1.2% (Р≤0.05), pulp weight-by 5.4 (Р≤0.05) and 10.8% (P≤0.01). Thus, selecting Black Spotted bulls according to the bGH gene polymorphism, it is advisable to select individuals homozygous for the CC genotype. Animals with the indicated genotype are characterized by higher beef productivity, increased metabolism of essential elements and a minimum quantity of toxic elements in relation to animals with the CG and GG genotypes.

Long Term Oral Administration of Oregano Essence Effectively Relieves Polycystic Ovarian Rats through Endocrine and Inflammatory Balance.

Polycystic ovarian syndrome (PCOS) is alarmingly rising and sustainable therapy/prevention is needed. Here, we evaluated the therapeutic effects of oregano or Origanum vulgare (O. vulgare) essence (OE) on the PCOS rat model system. Vaginal smears monitored the estrous cycle of 40 virgin adult rats, and they received 2 mg estradiol valerate (EV)/0.2 ml corn oil intramuscularly to induce PCOS. At 60 days post-EV injection, all rats were evaluated for follicular development/cysts. The EV-induced PCOS rats were orally administered 250 and 500 mg/kgBW/day of OE for 30 days. OE was also further assessed for its predominant components along with hormonal, histological, and inflammatory-related gene expressions in the ovaries. The main components of the OE were predominantly pulegone (36.3), L-menthone (31.3%), far less piperitone (7.8%), isopiperitone (6.4%), isomenthol (3.6%), humulene epoxide II (2.2%), α-pinene (1.7%), and thymol (1.5%). Hormonal, histological, and inflammatory-related gene expression results showed >4-fold and 1.5-fold increase in FSH and progesterone; ∼50%, 85%, 45%, 55%, and 30% decreased in LH, estradiol, estrogen, testosterone, and AMH; and dose-dependently decreased in mRNA expression of IL-6, IL-1α, NF-kB, TNF-α, and IL-1β by 25–65%, 55–75%, 15–40%, 30–55%, and 35–55%, respectively, and thus decreased the severity of PCOS, boosted endocrine balance, restored functional follicles and corpus luteum, and thus ovulation in PCOS rats. Overall, in the disrupted PCOS rats, OE oral treatment effectively relieved estradiol-induced PCOS rats via: (1) its endocrine balancing on GnRH, FSH, and LH and (2) its anti-inflammatory and antioxidant properties on ovary caused by OE's useful compounds like pulegone, thymol, and L-menthone. Though many aspects of the effects remain to be tested, such an underlying mechanistic reproductive regulatory effect observed in OE-administered rats further proves its sensible pharmaceutical applications in reproductive medicine and more specifically, PCOS.

Effect of neonatal isolation on responses to subsequent exposure to isolation stress in young chickens

The aim of the present study was to investigate effects of isolation at an early age on behavioral and physiological responses of chickens to an isolation challenge at two weeks of age. Birds were assigned to a control group or to one of three treatments where chicks were isolated for 5 min per day. The groups were 1) no isolation (control); 2) early isolation (EI; 2 to 4 days of age); 3) late isolation (LI; 5 to 7 days of age); or 4) full isolation (FI; 2 to 7 days of age). All groups of chicks were challenged with isolation for 5 min at two weeks of age, with distress vocalizations (DV), stepping and jumping behavior measured. Hypothalamic and blood samples were collected at the end of isolation challenges. There were no significant differences between groups in body weight gain at 2 weeks of age. Latency of jump was lower in the LI group compared with the control group, but DV and number of steps were not affected by isolation treatment during the neonatal period. There were no significant differences among groups in plasma glucose or FFA concentrations. Gene expression for hypothalamic corticotropin-releasing hormone, was lower in the EI than the control group, with no differences in expression between control and LI or control and FI groups. There were no significant differences among groups in the expression of arginine vasotocin, thyrotropin-releasing hormone, neuropeptide Y, proopiomelanocortin, and orexin genes. These results suggest that isolation in the first week of life may affect responses to isolation of chicks when they are older, and that there may be a critical period of several days for this effect to occur.

Growth Characteristic and the Study of Polymorphism Growth Hormone Genes of Sentul Chicken

The research was conducted to study the characteristics of growth, carcass production and growth hormone gene polymorphisms in various male sentul chickens. The research was conducted using experimental methods with a completely randomized design. The research material was 100 male day old chickens of Sentul. The treatment was a fixed factor, namely the variation of the color of the feathers of various Sentul chickens consisting of: “Abu” Sentul, “Emas” Sentul, “Geni” Sentul, “Debu” Sentul, “Batu” Sentul.. Each experimental unit consisted of 5 chickens and 4 replications. The variables measured included: hatching weight, body weight, body weight gain and the percentage of carcass produced at the age of 8 weeks. Identification of growth hormone gene polymorphisms used the primary design Gallus gallus haplotype GH-h22 growth hormone (GH) gene, complete cds, GenBank: JN675393.1 with forward primer / Sequence: AGGTGGTTCGGTTTTCACTG and reverse primer / Sequence: TCCCTTCTTCCAGGTCCTTT. Characteristics of growth and carcass production data were analyzed by analysis of variance; while to determine the presence of GH gene, polymorphisms were analyzed using the bioedit program. Analysis of variance showed that there were no significant differences (P&gt; 0.05) between hatching weight, body weight, body weight gain and carcass percentage of various Sentul chickens. The results of GH Gallus gallus gene sequencing at base length 80 bp showed a mutation from adinine to cytosine, when comparing sentul chickens and Gallus gallus data in GenBank. The GH gene were present in various sentul chickens with monomorphic characteristics with homozygous genotypes of CC. The results of this study can be concluded that the characteristics of growth and carcass production in various Sentul chickens are relatively the same, as well as the monomorphic GH gene.&#x0D; Keywords: Sentul chickens, body weight, carcass percentage, growth hormone gene, monomorphic.

Identification of upregulated genes in Tricholoma matsutake mycorrhiza.

Many plant roots associate with fungi to form mycorrhizae; tree roots especially associate with ectomycorrhizal fungi, such as Tricholoma species. Tricholoma matsutake is an economically important fungus in Asian countries and usually inhabits forests primarily composed of Pinus densiflora (Japanese red pine). In this study, to understand the mycorrhizal association between T. matsutake and P. densiflora, genes specifically expressed in mycorrhiza compared with those expressed in mycelia and fruiting bodies were identified by RNA-seq. This revealed that genes for chromatin, proteasomes, signal transduction, pheromones, cell surface receptors, cytoskeleton, RNA processing and transporters from T. matsutake were highly expressed in mycorrhiza. It also identified 35 mycorrhiza-induced small secreted proteins (MiSSPs) that were highly expressed in mycorrhiza. Meanwhile, genes for proteases, defence-related proteins, cell-wall degradation, signal transduction, pinene synthesis, plant hormones and transporters from P. densiflora were highly expressed in mycorrhiza. These genes may be involved in mycorrhizal formation and maintenance. A MiSSP, 1460819, was highly expressed in mycorrhiza, and this expression was maintained for 24 months. These results provide insight into the mycorrhizal association between T. matsutake and P. densiflora.

Predicting cross-tissue hormone-gene relations using balanced word embeddings.

MotivationInter-organ/inter-tissue communication is central to multi-cellular organisms including humans, and mapping inter-tissue interactions can advance system-level whole-body modeling efforts. Large volumes of biomedical literature have fostered studies that map within-tissue or tissue-agnostic interactions, but literature-mining studies that infer inter-tissue relations, such as between hormones and genes are solely missing.ResultsWe present a first study to predict from biomedical literature the hormone–gene associations mediating inter-tissue signaling in the human body. Our BioEmbedS* models use neural network-based Biomedical word Embeddings with a Support Vector Machine classifier to predict if a hormone–gene pair is associated or not, and whether an associated gene is involved in the hormone’s production or response. Model training relies on our unified dataset Hormone-Gene version 1 of ground-truth associations between genes and endocrine hormones, which we compiled and carefully balanced in the embedded space to handle data disparities, such as between poorly- versus well-studied hormones. Our BioEmbedS model recapitulates known gene mediators of tissue–tissue signaling with 70.4% accuracy; predicts novel inter-tissue communication genes in humans, which are enriched for hormone-related disorders; and generalizes well to mouse, thereby holding promise for its extension to other multi-cellular organisms as well.Availability and implementationFreely available at https://cross-tissue-signaling.herokuapp.com are our model predictions & datasets; https://github.com/BIRDSgroup/BioEmbedS has all relevant code.Supplementary information Supplementary data are available at Bioinformatics online.

Reclassifying tumour cell cycle activity in terms of its tissue of origin

Genomic alterations resulting in loss of control over the cell cycle is a fundamental hallmark of human malignancies. Whilst pan-cancer studies have broadly assessed tumour genomics and their impact on oncogenic pathways, analyses taking the baseline signalling levels in normal tissue into account are lacking. To this end, we aimed to reclassify the cell cycle activity of tumours in terms of their tissue of origin and determine if any common DNA mutations, chromosome arm-level changes or signalling pathways contribute to an increase in baseline corrected cell cycle activity. Combining normal tissue and pan-cancer data from over 13,000 samples we demonstrate that tumours of gynaecological origin show the highest levels of corrected cell cycle activity, partially owing to hormonal signalling and gene expression changes. We also show that normal and tumour tissues can be separated into groups (quadrants) of low/high cell cycle activity and propose the hypothesis of an upper limit on these activity levels in tumours.