Holliday Junction Resolvase Research Articles

The yeast Holliday junction resolvase, CCE1, can restore wild-type mitochondrial DNA to human cells carrying rearranged mitochondrial DNA

Rearrangements of mitochondrial DNA (mtDNA) are a well-recognized cause of human disease; deletions are more frequent, but duplications are more readily transmitted to offspring. In theory, partial duplications of mtDNA can be resolved to partially deleted and wild-type (WT) molecules, via homologous recombination. Therefore, the yeast CCE1 gene, encoding a Holliday junction resolvase, was introduced into cells carrying partially duplicated or partially triplicated mtDNA. Some cell lines carrying the CCE1 gene had substantial amounts of WT mtDNA suggesting that the enzyme can mediate intramolecular recombination in human mitochondria. However, high levels of expression of CCE1 frequently led to mtDNA loss, and so it is necessary to strictly regulate the expression of CCE1 in human cells to ensure the selection and maintenance of WT mtDNA.

Structure, flexibility, and mechanism of the Bacillus stearothermophilus RecU holliday junction resolvase

Here we report a high resolution structure of RecU-Holliday junction resolvase from Bacillus stearothermophilus. The functional unit of RecU is a homodimer that contains a "mushroom" like structure with a rigid cap and two highly flexible loops extending outwards. These loops appear to be highly flexible/dynamic, and presumably are directly involved in DNA binding and holding it for catalysis. Structural modifications of both the protein and DNA upon their interaction are essential for catalysis. An Mg2+ ion is present in each of the two active sites in this homodimeric enzyme, and two water molecules are coordinated with each Mg2+ ion. Our data are consistent with one of these water molecules acting as a nucleophile and the other as a general acid. The identities of the general base and general acid involved in catalysis and the Lewis acid that stabilizes the pentacovalent transition state phosphate ion are proposed. A model for the RecU-Holliday junction DNA complex is also proposed and discussed in the context of DNA binding and cleavage.

Identification of a Single HNH Active Site in Type IIS Restriction Endonuclease Eco31I

Type IIS restriction endonuclease Eco31I is a “short-distance cutter”, which cleaves DNA strands close to its recognition sequence, 5′-GGTCTC(1/5). Previously, it has been proposed that related endonucleases recognizing a common sequence core GTCTC possess two active sites for cleavage of both strands in the DNA substrate. Here, we present bioinformatic identification and experimental evidence for a single nuclease active site. We identified a short region of homology between Eco31I and HNH nucleases, constructed a three-dimensional model of the putative catalytic domain and validated our predictions by random and site-specific mutagenesis. The restriction mechanism of Eco31I is suggested by analogy to the mechanisms of phage T4 endonuclease VII and homing endonuclease I- PpoI. We propose that residues D311 and N334 coordinate the cofactor. H312 acts as a general base-activating water molecule for the nucleophilic attack. K337 together with R340 and D345 are located in close proximity to the active center and are essential for correct folding of catalytic motif, while D345 together with R264 and D273 could be directly involved in DNA binding. We also predict that the Eco31I catalytic domain contains a putative Zn-binding site, which is essential for its structural integrity. Our results suggest that the HNH-like active site is involved in the cleavage of both strands in the DNA substrate. On the other hand, analysis of site-specific mutants in the region, previously suggested to harbor the second active site, revealed its irrelevance to the nuclease activity. Thus, our data argue against the earlier prediction and indicate the presence of a single conserved active site in type IIS restriction endonucleases that recognize common sequence core GTCTC.

Mus81-Eme1-dependent and -independent crossovers form in mitotic cells during double-strand break repair in Schizosaccharomyces pombe.

During meiosis, double-strand breaks (DSBs) lead to crossovers, thought to arise from the resolution of double Holliday junctions (HJs) by an HJ resolvase. In Schizosaccharomyces pombe, meiotic crossovers are produced primarily through a mechanism requiring the Mus81-Eme1 endonuclease complex. Less is known about the processes that produces crossovers during the repair of DSBs in mitotic cells. We employed an inducible DSB system to determine the role of Rqh1-Top3 and Mus81-Eme1 in mitotic DSB repair and crossover formation in S. pombe. In agreement with the meiotic data, crossovers are suppressed in cells lacking Mus81-Eme1. And relative to the wild type, rqh1Delta cells show a fourfold increase in crossover frequency. This suppression of crossover formation by Rqh1 is dependent on its helicase activity. We found that the synthetic lethality of cells lacking both Rqh1 and Eme1 is suppressed by loss of swi5(+), which allowed us to show that the excess crossovers formed in an rqh1Delta background are independent of Mus81-Eme1. This result suggests that a second process for crossover formation exists in S. pombe and is consistent with our finding that deletion of swi5(+) restored meiotic crossovers in eme1Delta cells. Evidence suggesting that Rqh1 also acts downstream of Swi5 in crossover formation was uncovered in these studies. Our results suggest that during Rhp51-dependent repair of DSBs, Rqh1-Top3 suppresses crossovers in the Rhp57-dependent pathway while Mus81-Eme1 and possibly Rqh1 promote crossovers in the Swi5-dependent pathway.

Restriction endonuclease BpuJI specific for the 5′-CCCGT sequence is related to the archaeal Holliday junction resolvase family

Type IIS restriction endonucleases (REases) recognize asymmetric DNA sequences and cleave both DNA strands at fixed positions downstream of the recognition site. REase BpuJI recognizes the asymmetric sequence 5′-CCCGT, however it cuts at multiple sites in the vicinity of the target sequence. We show that BpuJI is a dimer, which has two DNA binding surfaces and displays optimal catalytic activity when bound to two recognition sites. BpuJI is cleaved by chymotrypsin into an N-terminal domain (NTD), which lacks catalytic activity but binds specifically to the recognition sequence as a monomer, and a C-terminal domain (CTD), which forms a dimer with non-specific nuclease activity. Fold recognition approach reveals that the CTD of BpuJI is structurally related to archaeal Holliday junction resolvases (AHJR). We demonstrate that the isolated catalytic CTD of BpuJI possesses end-directed nuclease activity and preferentially cuts 3 nt from the 3′-terminus of blunt-ended DNA. The nuclease activity of the CTD is repressed in the apo-enzyme and becomes activated upon specific DNA binding by the NTDs. This leads to a complicated pattern of specific DNA cleavage in the vicinity of the target site. Bioinformatics analysis identifies the AHJR-like domain in the putative Type III enzymes and functionally uncharacterized proteins.

Mus81 cleavage of Holliday junctions: a failsafe for processing meiotic recombination intermediates?

The Holliday junction (HJ) is a central intermediate of homologous recombination. Its cleavage is critical for the formation of crossover recombinants during meiosis, which in turn helps to establish chiasmata and promote genetic diversity. Enzymes that cleave HJs, called HJ resolvases, have been identified in all domains of life except eukaryotic nuclei. Controversially, the Mus81-Eme1 endonuclease has been proposed to be an example of a eukaryotic nuclear resolvase. However, hitherto little or no HJ cleavage has been detected in recombinant preparations of Mus81-Eme1. Here, we report the purification of active forms of recombinant Schizosaccharomyces pombe Mus81-Eme1 and Saccharomyces cerevisiae Mus81-Mms4, which display robust HJ cleavage in vitro, which, in the case of Mus81-Eme1, is as good as the archetypal HJ resolvase RuvC in single turnover kinetic analysis. We also present genetic evidence that suggests that this activity might be utilised as a back-up to Mus81-Eme1's main activity of cleaving nicked HJs during meiosis in S. pombe.

Defective Ribonucleoside Diphosphate Reductase Impairs Replication Fork Progression inEscherichia coli

The observed lengthening of the C period in the presence of a defective ribonucleoside diphosphate reductase has been assumed to be due solely to the low deoxyribonucleotide supply in the nrdA101 mutant strain. We show here that the nrdA101 mutation induces DNA double-strand breaks at the permissive temperature in a recB-deficient background, suggesting an increase in the number of stalled replication forks that could account for the slowing of replication fork progression observed in the nrdA101 strain in a Rec(+) context. These DNA double-strand breaks require the presence of the Holliday junction resolvase RuvABC, indicating that they have been generated from stalled replication forks that were processed by the specific reaction named "replication fork reversal." Viability results supported the occurrence of this process, as specific lethality was observed in the nrdA101 recB double mutant and was suppressed by the additional inactivation of ruvABC. None of these effects seem to be due to the limitation of the deoxyribonucleotide supply in the nrdA101 strain even at the permissive temperature, as we found the same level of DNA double-strand breaks in the nrdA(+) strain growing under limited (2-microg/ml) or under optimal (5-microg/ml) thymidine concentrations. We propose that the presence of an altered NDP reductase, as a component of the replication machinery, impairs the progression of the replication fork, contributing to the lengthening of the C period in the nrdA101 mutant at the permissive temperature.

Role of RAD51C and XRCC3 in Genetic Recombination and DNA Repair

In germ line cells, recombination is required for gene reassortment and proper chromosome segregation at meiosis, whereas in somatic cells it provides an important mechanism for the repair of DNA double-strand breaks. Five proteins (RAD51B, RAD51C, RAD51D, XRCC2, and XRCC3) that share homology with RAD51 recombinase and are known as the RAD51 paralogs are important for recombinational repair, as paralog-defective cell lines exhibit spontaneous chromosomal aberrations, defective DNA repair, and reduced gene targeting. The paralogs form two distinct protein complexes, RAD51B-RAD51C-RAD51D-XRCC2 and RAD51C-XRCC3, but their precise cellular roles remain unknown. Here, we show that, like MLH1, RAD51C localized to mouse meiotic chromosomes at pachytene/diplotene. Using immunoprecipitation and gel filtration analyses, we found that Holliday junction resolvase activity associated tightly and co-eluted with the 80-kDa RAD51C-XRCC3 complex. Taken together, these data indicate that the RAD51C-XRCC3-associated Holliday junction resolvase complex associates with crossovers and may play an essential role in the resolution of recombination intermediates prior to chromosome segregation.

Single Holliday Junctions Are Intermediates of Meiotic Recombination

Crossing-over between homologous chromosomes facilitates their accurate segregation at the first division of meiosis. Current models for crossing-over invoke an intermediate in which homologs are connected by two crossed-strand structures called Holliday junctions. Such double Holliday junctions are a prominent intermediate in Saccharomyces cerevisiae meiosis, where they form preferentially between homologs rather than between sister chromatids. In sharp contrast, we find that single Holliday junctions are the predominant intermediate in Schizosaccharomyces pombe meiosis. Furthermore, these single Holliday junctions arise preferentially between sister chromatids rather than between homologs. We show that Mus81 is required for Holliday junction resolution, providing further in vivo evidence that the structure-specific endonuclease Mus81-Eme1 is a Holliday junction resolvase. To reconcile these observations, we present a unifying recombination model applicable for both meiosis and mitosis in which single Holliday junctions arise from single- or double-strand breaks, lesions postulated by previous models to initiate recombination.

Role of metal ions in catalysis by HIV integrase analyzed using a quantitative PCR disintegration assay

Paired metal ions have been proposed to be central to the catalytic mechanisms of RNase H nucleases, bacterial transposases, Holliday junction resolvases, retroviral integrases and many other enzymes. Here we present a sensitive assay for DNA transesterification in which catalysis by human immunodeficiency virus-type 1 (HIV-1) integrase (IN) connects two DNA strands (disintegration reaction), allowing detection using quantitative PCR (qPCR). We present evidence suggesting that the three acidic residues of the IN active site function through metal binding using metal rescue. In this method, the catalytic acidic residues were each substituted with cysteines. Mn2+ binds tightly to the sulfur atoms of the cysteine residues, but Mg2+ does not. We found that Mn2+, but not Mg2+, could rescue catalysis of each cysteine-substituted enzyme, providing evidence for functionally important metal binding by all three residues. We also used the PCR-boosted assay to show that HIV-1 IN could carry out transesterification reactions involving DNA 5′ hydroxyl groups as well as 3′ hydroxyls as nucleophiles. Lastly, we show that Mn2+ by itself (i.e. without enzyme) can catalyze formation of a low level of PCR-amplifiable product under extreme conditions, allowing us to estimate the rate enhancement due to the IN-protein scaffold as at least 60 million-fold.

RusA Holliday junction resolvase: DNA complex structure--insights into selectivity and specificity.

We have determined the structure of a catalytically inactive D70N variant of the Escherichia coli RusA resolvase bound to a duplex DNA substrate that reveals critical protein–DNA interactions and permits a much clearer understanding of the interaction of the enzyme with a Holliday junction (HJ). The RusA enzyme cleaves HJs, the fourway DNA branchpoints formed by homologous recombination, by introducing symmetrical cuts in the phosphodiester backbone in a Mg2+ dependent reaction. Although, RusA shows a high level of selectivity for DNA junctions, preferring to bind fourway junctions over other substrates in vitro, it has also been shown to have appreciable affinity for duplex DNA. However, RusA does not show DNA cleavage activity with duplex substrates. Our structure suggests the possible basis for structural selectivity as well as sources of the sequence specificity observed for DNA cleavage by RusA.

Quaternary Structure and Cleavage Specificity of a Poxvirus Holliday Junction Resolvase

Recently, poxviruses were found to encode a protein with signature motifs present in the RuvC family of Holliday junction (HJ) resolvases, which have a key role in homologous recombination in bacteria. The vaccinia virus homolog A22 specifically cleaved synthetic HJ DNA in vitro and was required for the in vivo resolution of viral DNA concatemers into unit-length genomes with hairpin telomeres. It was of interest to further characterize a poxvirus resolvase in view of the low sequence similarity with RuvC, the absence of virus-encoded RuvA and RuvB to interact with, and the different functions of the viral and bacterial resolvases. Because purified A22 aggregated severely, studies were carried out with maltose-binding protein fused to A22 as well as to RuvC. Using gel filtration, chemical cross-linking, analytical ultracentrifugation, and light scattering, we demonstrated that A22 and RuvC are homodimers in solution. Furthermore, the dimeric form of the resolvase associated with HJ DNA, presumably facilitating the symmetrical cleavage of such structures. Like RuvC, A22 symmetrically cleaved fixed HJ junctions as well as junctions allowing strand mobility. Unlike RuvC and other members of the family, however, the poxvirus enzyme exhibited little cleavage sequence specificity. Structural and enzymatic similarities of poxvirus, bacterial, and fungal mitochondrial HJ resolvases are consistent with their predicted evolutionary relationship based on sequence analysis. The absence of a homologous resolvase in mammalian cells makes these microbial enzymes excellent potential therapeutic targets.

The Endonuclease Domain of Bacteriophage Terminases Belongs to the Resolvase/Integrase/Ribonuclease H Superfamily: A BIOINFORMATICS ANALYSIS VALIDATED BY A FUNCTIONAL STUDY ON BACTERIOPHAGE T5

Bacteriophage terminases are essential molecular motors involved in the encapsidation of viral DNA. They are hetero-multimers whose large subunit encodes both ATPase and endonuclease activities. Although the ATPase domain is well characterized from sequence and functional analysis, the C-terminal region remains poorly defined. We describe sequence-structure comparisons of the endonuclease region of various bacteriophages that revealed new sequence similarities shared by this region and the Holliday junction resolvase RuvC and to a lesser extent the HIV integrase and the ribonuclease H. Extensive sequence comparison and motif refinement led to a common signature of terminases and resolvases with three conserved acidic residues engaged in catalytic activity. Sequence analyses were validated by in vivo and in vitro functional assays showing that the nuclease activity of the endonuclease domain of bacteriophage T5 terminase was abolished by mutation of any of the three predicted catalytic aspartates. Overall, these data suggest that the endonuclease domains of terminases operate autonomously and that they adopt a fold similar to that of resolvases and share the same divalent cation-dependent enzymatic mechanism.

Crystal structure of TBP‐interacting protein (Tk‐TIP26) and implications for its inhibition mechanism of the interaction between TBP and TATA‐DNA

TATA-binding protein (TBP)-interacting protein from the hyperthermophilic archaeon Thermococcus kodakaraensis strain KOD1 (Tk-TIP26) is a possible transcription regulatory protein in Thermococcales. Here, we report the crystal structure of Tk-TIP26 determined at 2.3 A resolution with multiple-wavelength anomalous dispersion (MAD) method. The overall structure of Tk-TIP26 consists of two domains. The N-terminal domain forms an alpha/beta structure, in which three alpha-helices enclose the central beta-sheet. The topology of this domain is similar to that of holliday junction resolvase Hjc from Pyrococcus furiosus. The C-terminal domain comprises three alpha-helices, six beta-strands, and two 3(10)-helices. In the dimer structure of Tk-TIP26, two molecules are related with the crystallographic twofold axis, and these molecules rigidly interact with each other via hydrogen bonds. The complex of Tk-TIP26/Tk-TBP is isolated and analyzed by SDS-PAGE and gel filtration column chromatography, resulting in a stoichiometric ratio of the interaction between Tk-TIP26 and Tk-TBP of 4:2, i.e., two dimer molecules of Tk-TIP26 formed a complex with one dimeric TBP. The electrostatic surfaces of Tk-TIP26 and TBP from Pyrocuccus woesei (PwTBP) allowed us to build a model of the Tk-TIP26/TBP complex, and to propose the inhibition mechanism where two dimer molecules of Tk-TIP26 bind to a dimeric TBP, preventing its binding to TATA-DNA.

The Structure of Bacillus subtilis RecU Holliday Junction Resolvase and Its Role in Substrate Selection and Sequence-Specific Cleavage

We have determined the structure of the enzyme RecU from Bacillus subtilis, that is the general Holliday junction resolving enzyme in Gram-positive bacteria. The enzyme fold reveals a striking similarity to a class of resolvase enzymes found in archaeal sources and members of the type II restriction endonuclease family to which they are related. The structure confirms the presence of active sites formed around clusters of acidic residues that we have also shown to bind divalent cations. Mutagenesis data presented here support the key role of certain residues. The RecU structure suggests a basis for Holliday junction selectivity and suggests how sequence-specific cleavage might be achieved. Models for a resolvase-DNA complex address how the enzyme might organize junctions into an approximately 4-fold symmetric form.

Bacillus subtilis RecU Holliday-junction resolvase modulates RecA activities

The Bacillus subtilis RecU protein is able to catalyze in vitro DNA strand annealing and Holliday-junction resolution. The interaction between the RecA and RecU proteins, in the presence or absence of a single-stranded binding (SSB) protein, was studied. Substoichiometric amounts of RecU enhanced RecA loading onto single-stranded DNA (ssDNA) and stimulated RecA-catalyzed D-loop formation. However, RecU inhibited the RecA-mediated three-strand exchange reaction and ssDNA-dependent dATP or rATP hydrolysis. The addition of an SSB protein did not reverse the negative effect exerted by RecU on RecA function. Annealing of circular ssDNA and homologous linear 3′-tailed double-stranded DNA by RecU was not affected by the addition of RecA both in the presence and in the absence of SSB. We propose that RecU modulates RecA activities by promoting RecA-catalyzed strand invasion and inhibiting RecA-mediated branch migration, by preventing RecA filament disassembly, and suggest a potential mechanism for the control of resolvasome assembly.

Crystal Structures of RNase H Bound to an RNA/DNA Hybrid: Substrate Specificity and Metal-Dependent Catalysis

RNase H belongs to a nucleotidyl-transferase superfamily, which includes transposase, retroviral integrase, Holliday junction resolvase, and RISC nuclease Argonaute. We report the crystal structures of RNase H complexed with an RNA/DNA hybrid and a mechanism for substrate recognition and two-metal-ion-dependent catalysis. RNase H specifically recognizes the A form RNA strand and the B form DNA strand. Structure comparisons lead us to predict the catalytic residues of Argonaute and conclude that two-metal-ion catalysis is a general feature of the superfamily. In nucleases, the two metal ions are asymmetrically coordinated and have distinct roles in activating the nucleophile and stabilizing the transition state. In transposases, they are symmetrically coordinated and exchange roles to alternately activate a water and a 3'-OH for successive strand cleavage and transfer by a ping-pong mechanism.

Combination of His-Tagged T4 Endonuclease VII with Microplate Array Diagonal Gel Electrophoresis for High-Throughput Mutation Scanning

Various physical mutation-scanning methods have been developed to avoid unnecessary resequencing of long stretches of DNA (1)(2)(3)(4)(5)(6). Protein-based mutation-scanning techniques include enzymatic digestion [reviewed in Ref. (7)], protein binding to a DNA duplex, and direct analyses of the in vivo or in vitro gene product. One such enzyme is T4 endonuclease VII (endoVII), the product of gene 49 of bacteriophage T4 (8). Radiolabel replacement with fluorescent tags has facilitated automated analysis (9). EndoVII recognizes heteroduplex structural distortions, nicking 2–6 bp 3′ to the distortion, with efficiency dependent on sequence context (10) and mismatch type(11). Perfectly matched DNA undergoes some background digestion, which produces a highly reproducible pattern (12). Mutation detection sensitivity obtained with endoVII digestion was found to be similar to that for denaturing HPLC and direct sequencing (13). Microplate array diagonal gel electrophoresis (MADGE) (14) provides an open-faced 96-well gel format for polyacrylamide gels. Recently, nondenaturing 192-, 384-, and 768-well formats of MADGE for high-throughput checking of PCR and post-PCR reactions (15) have been developed. We have combined, in proof-of-principle experiments, the mismatch digestion properties of endoVII with the high-throughput capabilities of MADGE and a newly developed denaturing MADGE format to create a simple mutation-scanning technique that can screen ∼1000 PCR samples during a single 35-min electrophoretic run. Plasmid pRB210 (T4 endonuclease VII in pET11a) was a kind gift from Professor B. Kemper (Institute for Genetics, University of Cologne, Germany). The PCR primers used to amplify the endoVII gene from pRB210 were as follows: forward, 5′-GCGCCATATGATGTTATTGAC-3′; reverse, 5′-CAGCGGATCCTCATTTTAAACT-3′. After trimming was performed with Bam HI and Nde I (New England Biolabs), pETendoVII was generated by ligation into pET15b (Novagen). Expressed N-terminal His-tagged endoVII was then purified by affinity chromatography. We used a single colony from pETendoVII-transfected BL21 …

Piv Site-Specific Invertase Requires a DEDD Motif Analogous to the Catalytic Center of the RuvC Holliday Junction Resolvases

Piv, a unique prokaryotic site-specific DNA invertase, is related to transposases of the insertion elements from the IS110/IS492 family and shows no similarity to the site-specific recombinases of the tyrosine- or serine-recombinase families. Piv tertiary structure is predicted to include the RNase H-like fold that typically encompasses the catalytic site of the recombinases or nucleases of the retroviral integrase superfamily, including transposases and RuvC-like Holliday junction resolvases. Analogous to the DDE and DEDD catalytic motifs of transposases and RuvC, respectively, four Piv acidic residues D9, E59, D101, and D104 appear to be positioned appropriately within the RNase H fold to coordinate two divalent metal cations. This suggests mechanistic similarity between site-specific inversion mediated by Piv and transposition or endonucleolytic reactions catalyzed by enzymes of the retroviral integrase superfamily. The role of the DEDD motif in Piv catalytic activity was addressed using Piv variants that are substituted individually or multiply at these acidic residues and assaying for in vivo inversion, intermolecular recombination, and DNA binding activities. The results indicate that all four residues of the DEDD motif are required for Piv catalytic activity. The DEDD residues are not essential for inv recombination site recognition and binding, but this acidic tetrad does appear to contribute to the stability of Piv-inv interactions. On the basis of these results, a working model for Piv-mediated inversion that includes resolution of a Holliday junction is presented.

A novel rudivirus, ARV1, of the hyperthermophilic archaeal genus Acidianus

Virus ARV1, the first member of the family Rudiviridae infecting hyperthermophilic archaea of the genus Acidianus, was isolated from a hot spring in Pozzuoli, Italy. The rod-shaped virions, 610 ± 50 nm long and 22 ± 3 nm wide, are non-enveloped and carry a helical nucleoprotein core, with three tail fibers protruding at each end which appear to be involved in adsorption onto the host cell surface. The virions contain two protein components, a major one of 14.4 kDa, which is glycosylated and a minor of about 124 kDa. The linear double-stranded DNA genome yielded 24,655 bp of sequence, including 1365 bp inverted terminal repeats. Coding is on both strands and about 40% of the predicted genes are homologous to those of other hyperthermophilic crenarchaeal viruses, mainly rudiviruses. They include genes encoding the coat protein, two glycosyl transferases and a Holliday junction resolvase. Other assigned functions include a thymidylate synthase and three DNA-binding proteins. The genome sequence and composition differ strongly from those of the Sulfolobus rudiviruses SIRV1 and SIRV2, and the genome stability is very high, with no sequence variants being detected. Although the sequences of the inverted terminal repeats of the three rudiviruses are different, they all carry the motif AATTTAGGAATTTAGGAATTT near the genome ends which may constitute a signal for the Holliday junction resolvase and DNA replication.