493 G EN E TIC D IVER SITY is a major characteristic of the human immunodeficiency virus type 1 (HIV-1). On the basis of nucleotide sequence analysis the HIV-1 group M srains are phylogenetically grouped into 10 distinct subtypes, almost all of which have been found in Central Africa.1 Recombination between different subtypes respresents an important means by which HIV-1 generates genetic diversity. More than 10% of full gene regions or full HIV-1 genome sequences in the database appear to be intersubtype recom binants,2 although studies indicate that the prevalence in some countries in Africa may be as high as 25%.3 In South Africa, the epidemic is dominated by subtype C viruses transm itted mainly through heterosexual contact.4,5 A smaller epidemic, which peaked in the mid-1980s among homosexual/ bisexual men, is associated with subtype B and a few subtype D infections. 6 More recently two subtype A infections have been docum ented.5 Previous studies have not revealed the existence of recombinant viruses in South Africa.7 In this study a gag heteroduplex mobility assay (HMA) was developed to complement the env HMA to facilitate HIV subtype determination in two regions of the genom e and to identify intersubtype recom binant viruses. We describe the identification of HIV-1 subtypes A, B, and C, and the relatively low prevalence of intersubtype recombinants, in South Africa. Between 1995 and 1998 blood was collected from 172 HIV1-seropositive individuals representing different HIV risk groups. Except for seven commercial sex workers from KwaZulu-Natal, all samples were from Johannesburg. Signed informed consent was obtained from all study subjects prior to collection of blood and the majority of patients were interviewed for demographic information including route and place of transmission. Specifically, this included patients admitted with tuberculosis and other AIDS-defining illnesses, individuals attending hemophiliac or antenatal clinics, immigrant and mobile persons using urban AIDS clinics, as well as individuals under the care of private physicians. There was a similar number of men (n 5 84) and women (n 5 88) in the cohort, with ages ranging from 18 to 59 years. The majority of individuals were infected through heterosexual contact, followed by blood transfusion, homosexual transmission, intravenous drug use, and occupational exposure. CD4 1 lymphocyte counts were determined in 117 individuals, 52% of whom had fewer than 200 CD4 1 T cells/ m l, indicating that they had advanced disease. This cohort does not reflect the HIV infection rates across the different risk groups, but rather an attempt to sample different risk groups. Peripheral blood mononuclear cells (PBMCs) were isolated and used to amplify an , 700-bp product in the gp120 V3–V5 region for use in an env HMA as described previously. 4 The same cellular lysates were used to amplify an , 520-bp product comprising 100 bp in the long terminal repeat (LTR) region and the whole p17 gag gene. For this, outer primers MSF12 (5 9 AAATCTCTAGCAGTGGCGCCCGAACAG at positions 622 to 648 of the HXB2 genome)8 and SK431 (5 9 AGAGAACCAAGGGGAAGTGACATAGCAGG at positions 1475 to 1503)9 and inner primers LTR236 (5 9 CGCAGGACTCGGCTTGC at positions 688 to 704) and gag 778 (5 9 CACCTAGAACTTTAAATGCATGGG at positions 1231 to 1254)10 were used. Five microliters of DNA input was used in the firstand second-round amplification in a reaction mixture containing 10 pmol of each primer, 200 m M dNTPs, 1.5 mM MgCl2, and 0.625 U of Super-Therm DNA polymerase with supplied 10 3 buffer (Advanced Biotechnologies Limited, UK). The following HIV-1 isolates provided by the NIH AIDS Research and Reference Reagent Program (Rockville, MD) were used as subtype preferences: 92RW009A (gag C/env A), 92UG029 (A/A), 92BR021B (B/B), 92BR025 (C/C), and 92UG001 (D/D). The amplification reactions were performed in a Perkin-Elmer (Norwalk, CT) Thermocycler 2400 or 9600 for 28 cycles under the following conditions: 3 cycles at 94°C for 2 min, 45°C for 2 min, and 72°C for 4 min; 25 cycles at 94°C for 45 sec, 45°C for 1 min, and 72°C for 1.5 min; and a final extension at 72°C for 7 min. A gag HMA was performed essentially as described