High-throughput RNA Sequencing Research Articles

MIST1 regulates endoplasmic reticulum stress-induced hepatic apoptosis as a candidate marker of fatty liver disease progression

The liver regenerates after injury; however, prolonged injury can lead to chronic inflammation, fatty liver disease, fibrosis, and cancer. The mechanism involving the complex pathogenesis of the progression of liver injury to chronic liver disease remains unclear. In this study, we investigated the dynamics of gene expression associated with the progression of liver disease. We analyzed changes in gene expression over time in a mouse model of carbon tetrachloride (CCl4)-induced fibrosis using high-throughput RNA sequencing. Prolonged CCl4-induced liver injury increased the expression levels of genes associated with the unfolded protein response (UPR), which correlated with the duration of injury, with substantial, progressive upregulation of muscle, intestine, and stomach expression 1 (Mist1, bhlha15) in the mouse fibrosis model and other liver-damaged tissues. Knockdown of MIST1 in HepG2 cells decreased tribbles pseudokinase 3 (TRIB3) levels and increased apoptosis, consistent with the patterns detected in Mist1-knockout mice. MIST1 expression was confirmed in liver tissues from patients with metabolic dysfunction-associated steatohepatitis and alcoholic steatohepatitis (MASH) and correlated with disease progression. In conclusion, MIST1 is expressed in hepatocytes in response to damage, suggesting a new indicator of liver disease progression. Our results suggest that MIST1 plays a key role in the regulation of apoptosis and TRIB3 expression contributing to progressive liver disease after injury.

Illumina SBS Sequencing and DNBSEQ Perform Similarly for Single-Cell Transcriptomics

Background/Objectives: High-throughput single-cell RNA sequencing (scRNA-seq) workflows produce libraries that demand extensive sequencing. However, standard next-generation sequencing (NGS) methods remain expensive, contributing to the high running costs of single-cell experiments and often negatively affecting the sample numbers and statistical strength of such projects. In recent years, a plethora of new sequencing technologies have become available to researchers through several manufacturers, often providing lower-cost alternatives to standard NGS. Methods: In this study, we compared data generated from mouse scRNA-seq libraries sequenced with both standard Illumina sequencing by synthesis (Illumina SBS) and MGI’s DNA nanoball sequencing (DNBSEQ). Results: Our findings reveal similar overall performance using both technologies. DNBSEQ exhibited mildly superior sequence quality compared to Illumina SBS, as evidenced by higher Phred scores, lower read duplication rates and a greater number of genes mapping to the reference genome. Yet these improvements did not translate into meaningful differences in single-cell analysis parameters in our experiments, including detection of additional genes within cells, gene expression saturation levels and numbers of identified cells, with both technologies demonstrating equally robust performance in these aspects. The data produced by both sequencing platforms also produced comparable analytical outcomes for single-cell analysis. No significant difference in the annotation of cells into different cell types was observed and the same top genes were differentially expressed between populations and experimental conditions. Conclusions: Overall, our data demonstrate that alternative technologies can be applied to sequence scRNA-seq libraries, generating virtually indistinguishable results compared to standard methods, and providing cost-effective alternatives.

Quantifying defective and wild-type viruses from high-throughput RNA sequencing.

Defective viral genomes (DVGs) are variants of the wild-type (wt) virus that lack the ability to complete autonomously an infectious cycle. However, in the presence of their parental (helper) wt virus, DVGs can interfere with the replication, encapsidation and spread of functional genomes, acting as a significant selective force in viral evolution. DVGs also affect the host's immune responses and are linked to chronic infections and milder symptoms. Thus, identifying and characterizing DVGs is crucial for understanding infection prognosis. Quantifying DVGs is challenging due to their inability to sustain themselves, which makes it difficult to distinguish them from the helper virus, especially using high-throughput RNA sequencing (RNA-seq). An accurate quantification is essential for understanding their very dynamical interactions with the helper virus. We present a method to simultaneously estimate the abundances of DVGs and wt genomes within a sample by identifying genomic regions with significant deviations from the expected sequencing depth. Our approach involves reconstructing the depth profile through a linear system of equations, which provides an estimate of the number of wt and DVG genomes of each type. Until now, in silico methods have only estimated the DVG-to-wt ratio for localized genomic regions. This is the first method that simultaneously estimates the proportions of wt and DVGs genome wide from short-reads RNA sequencing. The MATLAB code and the synthetic datasets are freely available at https://github.com/jmusan/wtDVGquantific.

Role of non-coding RNA in lineage plasticity of prostate cancer.

The treatment of prostate cancer (PCa) has made great progress in recent years, but treatment resistance always develops and can even lead to fatal disease. Exploring the mechanism of drug resistance is of great significance for improving treatment outcomes and developing biomarkers with predictive value. It is increasingly recognized that mechanism of drug resistance in advanced PCa is related to lineage plasticity and tissue differentiation. Specifically, one of the mechanisms by which castration-resistant prostate cancer (CRPC) cells acquire drug resistance and transform into neuroendocrine prostate cancer (NEPC) cells is lineage plasticity. NEPC is a subtype of PCa that is highly aggressive and lethal, with a median survival of only 7 months. With the development of high-throughput RNA sequencing technology, more and more non-coding RNAs have been identified, which play important roles in different diseases through different mechanisms. Several ncRNAs have shown great potential in PCa lineage plasticity and as biomarkers. In the review, the role of ncRNA in PCa lineage plasticity and its use as biomarkers were reviewed.

Characterization of small RNAs in the spleen of MASH in a non-human primate model

Metabolic dysfunction-associated steatotic liver disease (MASLD) and its advanced stage, metabolic dysfunction-associated steatohepatitis (MASH), are increasingly recognized as a global health issue. This study examines the role of small RNAs in the spleen of MASH using a non-human primate model. We performed high-throughput small RNA sequencing on spleen tissues from MASH-primates, revealing significant alterations in the expression of small non-coding RNAs, especially miRNAs. Notably, miR-96, miR-182, miR-183, and miR-122 showed differential expression in MASH spleens. Predictive and validation studies have identified potential target genes, such as PTX3 and NFIX, that were significantly dysregulated in spleens of MASH. These findings characterized small RNAs in spleen of MASH and offer a novel insight for further research for MASH.

Systematic profiling and analysis of growth and development responsive DE-lncRNAs in cluster bean (Cyamopsis tetragonoloba)

Long non-coding RNAs (lncRNAs) play crucial role in regulating genes involved in various processes including growth & development, flowering, and stress response in plants. The study aims to identify and characterize tissue-specific, growth & development and floral responsive differentially expressed lncRNAs (DE-lncRNAs) in cluster bean from a high-throughput RNA sequencing data. We have identified 3309 DE-lncRNAs, with an average length of 818 bp. Merely, around 4 % of DE-lncRNAs across the tissues were found to be conserved as rate of evolution of lncRNAs is high. Among the identified DE-lncRNAs, 204 were common in leaf vs. shoot, leaf vs. flower and flower vs. shoot. A total of 60 DE-lncRNAs targeted 10 protein-coding genes involved in flower development and initiation processes. We investigated 179 tissue-specific DE-lncRNAs based on tissue specificity index. Three DE-lncRNAs: Cb_lnc_0820, Cb_lnc_0430, Cb_lnc_0260 and their targeted genes shown their involvement in floral development and stress mechanisms, which were validated by Quantitative real-time PCR (qRT-PCR). The identified DE-lncRNAs were expressed higher in flower bud than in leaf and similar expression pattern was observed in both RNA-seq data and qRT-PCR analyses. Notably, 362 DE-lncRNAs were predicted as eTM-lncRNAs with the participation of 84 miRNAs. Whereas 46 DE-lncRNAs were predicted to possess the internal ribosomal entry sites (IRES) and can encode for small peptides. The regulatory networks established between DE-lncRNAs, mRNAs and miRNAs have provided an insight into their association with plant growth & development, flowering, and stress mechanisms. Comprehensively, the characterization of DE-lncRNAs in various tissues of cluster bean shed a light on interactions among lncRNAs, miRNAs and mRNAs and help understand their involvement in growth & development and floral initiation processes. The information retrieved from the analyses was shared in the public domain in the form of a database: Cb-DElncRNAdb, and made available at http://backlin.cabgrid.res.in/Cb-DElncRNA/index.php, which may be useful for the scientific community engaged in future breeding programs of cluster bean.

Identifying the ceRNA Regulatory Network in Early-Stage Acute Pancreatitis and Investigating the Therapeutic Potential of NEAT1 in Mouse Models.

Acute pancreatitis (AP) is a common digestive disorder characterized by high morbidity and mortality. This study aims to uncover differentially expressed long noncoding RNAs (lncRNAs) and mRNAs, as well as related pathways, in the early stage of acute pancreatitis (AP), with a focus on the role of Neat1 in AP and severe acute pancreatitis (SAP). In this study, we performed high-throughput RNA sequencing on pancreatic tissue samples from three normal mice and three mice with cerulein-induced AP to describe and analyze the expression profiles of long non-coding RNAs (lncRNAs) and mRNAs. Gene Ontology (GO) and Kyoto Encyclopedia of Genes and Genomes (KEGG) pathway analyses were conducted on the differentially expressed mRNAs to identify enriched pathways and biological processes. An lncRNA-miRNA-mRNA interaction network was constructed to elucidate potential regulatory mechanisms. Furthermore, we utilized Neat1 knockout mice to investigate the role of Neat1 in the pathogenesis of cerulein-AP and L-arginine-severe acute pancreatitis (SAP). Our results revealed that 261 lncRNAs and 1522 mRNAs were differentially expressed in the cerulein-AP group compared to the control group. GO and KEGG analyses of the differentially expressed mRNAs indicated that the functions of the corresponding genes are enriched in cellular metabolism, intercellular structure, and positive regulation of inflammation, which are closely related to the central events in the pathogenesis of AP. A ceRNA network involving 5 lncRNAs, 226 mRNAs, and 61 miRNAs were constructed. Neat1 was identified to have the potential therapeutic effects in AP. Neat1 knockout in mice inhibited pyroptosis in both the AP/SAP mouse models. We found that lncRNAs, particularly Neat1, play a significant role in the pathogenesis of AP. This finding may provide new insights into further exploring the pathogenesis of SAP and could lead to the identification of new targets for the treatment of AP and SAP.

Discovery of a cryptic founder variant in MYBPC3 associated with hypertrophic cardiomyopathy by promoting the most frequent natural missplicing events

Abstract Introduction MYBPC3 splicing errors are a common cause of hypertrophic cardiomyopathy (HCM). Most known actionable intronic variants are located near exons. However, genetic variants in deep intronic regions are also emerging as casuals factors of HCM. The previously undescribed variant MYBPC3 (NM_000256.3):c.2308+227G>A is not reported in gnomAD or dbSNP but is overrepresented in a cohort of probands with HCM from the same geographical area. This led us to suspect its clinical relevance despite the very low probability of being splice-altering as assigned by SpliceAI (Δ score = 0.03). Purpose To conduct a phenotypic and clinical description of the cohort, ascertain the pathogenicity of the variant, and investigate the existence of a common ancestor. Methods (1) Observational analysis of clinical data and familial evaluation results, (2) Functional study involving mRNA expression analysis in peripheral blood, along with in silico analysis of the splicing disruption mechanism, and (3) Haplotype analysis to evaluate the founder effect and assess the age of the mutation. Results MYBPC3:c.2308+227G>A was identified in 26 probands with HCM (69% male; mean age at diagnosis 53±10 years). Eighty relatives from 20 families were screened resulting in 17 cases diagnosed (mean age 49±19 years; 53% males), 19 positive genotype/negative phenotype and 38 non-carriers. The greatest cosegregation involved three cases carrying the variant, confirmed in four different families. Males were diagnosed at a younger age but without significant differences in clinical features or events during follow-up (table). RT-PCR expression analysis in patients' blood revealed that this variant disrupts pre-mRNA splicing by promoting the use of cryptic donor and acceptor splice sites, located downstream and upstream of the variant, respectively, which are already present in the intron 23 reference sequence. Strikingly, these cryptic splice sites represent one of the most frequent natural unannotated missplicing events in MYBPC3, as evidenced by SpliceVault analysis of high-throughput RNA sequencing databases. The direct primary event induced by the variant is expected to disrupt a regulatory RNA-protein binding site, thereby unblocking the use of preexisting cryptic splice sites and amplifying natural exonification missplicing events within intron 23 (figure). Finally, the haplotype analysis, based on the copy number of nine STRs covering a total of 29.2 Mb surrounding MYBPC3:c.2308+227G>A, revealed that 17 unrelated carriers shared a DNA segment of 10 Mb (10,067,150 bp). The origin of this mutation is estimated to be at least 82 generations ago and roughly 1649 years in the past (IC95%:1180-2300). Conclusions MYBPC3:c.2308+227G>A is an elusive novel deep intronic variant causing HCM by a molecular mechanism not previously described in this context. The founder effect of this variant is confirmed in our geographical area.Phenotypic and clinical characteristics

QUIC-seq: Quick ultra-affordable high-throughput convenient RNA sequencing.

QUIC-seq: Quick ultra-affordable high-throughput convenient RNA sequencing.

First Report of metaplexis yellow mottle-associated virus Infecting Metaplexis japonica (Thunb.) Makino in Shandong, China.

Metaplexis japonica (Thunb.) Makino, commonly known as rough potato, has a wide distribution in China, Japan, Korea, and adjacent Russia. In China, M. japonica is a traditional herbal medicinal plant, which is also cultivated as a vegetable (Shi et al. 2020; Wei et al. 2019). In July 2023, leaves of M. japonica plants growing near a soybean field in Qingdao, Shandong province, exhibited leaf crinkling, mosaic and distorting symptoms of probable virus infection (Supplementary Figure 1). The disease incidence in a 50 m2 area was approximately 40%. To identify the suspected viral etiological agents, symptomatic leaves from 10 M. japonica plants were collected and pooled to perform small RNA deep sequencing (sRNA-Seq). TransZol Up Total RNA Extraction Kit (TransGen Biotech, Beijing, China) was used to extract total RNA. Small RNA library construction and high-throughput sequencing (HTS) were performed on Illumina NovaSeq platform by Genepioneer (Nanjing, China) (Li et al. 2024). A total of 17,384,311 raw reads were obtained. Redundant reads were removed by cutadapt software (version 1.18) to obtain 11,580,876 clean reads with 18 to 26 nucleotide (nt) sizes. The clean reads were assembled using velvet software (version 1.1.07). A total of forty-six small contigs from 42 to 283 nt were identified, with 85 to 100% nucleotide sequence identities, respectively, to metaplexis yellow mottle-associated virus (MeYMaV, genus Caulimovirus, family Caulimoviridae, accession numbers: NC_077108.1). Finally, 1,355,955 reads (11.71% mapped ratio of total reads, cover 56.7% over the MeYMaV genome) were mapped to the genome of MeYMaV by bwa software (version 0.7.17-r1188). To confirm the sRNA-Seq results, PCR was performed with specific primers MeYMaV-N-F/MeYMaV-N-R (5'-TGGTATCAGAGCCTAGTTAA-3'/5'-GGAGTTGGTAATGTATTACC-3') and MeYMaV-C-F/MeYMaV-C-R (5'-AATGGAACGGCTGTTAGTAT3'/TTAATTTCTAGCCCTTGGCTACTTAC). Both the primer pairs were designed using GenBank accession numbers: NC_077108.1 (Yang et al. 2021) to obtain the N and C terminals genome fragments of 10 MeYMaV plants. Two amplicons approximately in 4000-, and 3900-bp sizes were amplified (Supplementary Figure 2), sequenced (tsingke, Beijing, China) and aligned to obtain 7,742-nt complete MeYMaV genome sequence (Accession no. PP892524). BLASTn analysis revealed 90.16% and 92.18% sequence identity, respectively, with the MeYMaV isolate LM-Cau-A (NC_077108.1) based on complete genome and coat protein sequences, respectively. Previously, cucumber mosaic virus and MeYMaV were reported in M. japonica from Jiangsu and Liaoning provinces in China, respectively (Yang et al. 2018; 2021). To our knowledge, this is the first natural infection report of MeYMaV in M. japonica in Shandong, China. The natural occurrence of MeYMaV is not only affects the quality of M. japonica, but also poses a potential threat to surrounding crops. This study enriches information on the disease distribution of MeYMaV and will be helpful for disease management.

Unique and Shared Molecular Mechanisms of Alcoholic and Non-Alcoholic Liver Cirrhosis Identified Through Transcriptomics Data Integration.

Liver cirrhosis is a severe chronic disease that results from various etiological factors and leads to substantial morbidity and mortality. Alcoholic cirrhosis (AC) and non-AC (NAC) arise from prolonged and excessive consumption of alcohol and metabolic syndromes, respectively. Precise molecular mechanisms of AC and NAC are yet to be comprehensively understood for diagnostics and therapeutic advances to materialize. This study reports novel findings to this end by utilizing high-throughput RNA sequencing and microarray data from the Gene Expression Omnibus (GEO). We performed a meta-analysis of transcriptomics data to identify the differentially expressed genes specific to AC and NAC. Functional enrichment and protein-protein interaction network analyses uncovered novel hub genes and transcription factors (TFs) critical to AC and NAC. We found that AC is primarily driven by metabolic dysregulation and oxidative stress, with key TFs such as RELA, NFKB1, and STAT3. NAC was characterized by fibrosis and tissue remodeling associated with metabolic dysfunction, with TFs including USF1, MYCN, and HIF1A. Key hub genes such as ESR1, JUN, FOS, and PKM in AC, and CD8A, MAPK3, CCND1, and CXCR4 in NAC were identified, along with their associated TFs, pointing to potential therapeutic targets. Our results underscore the unique and shared molecular mechanisms that underlie AC and NAC and inform the efforts toward precision medicine and improved patient outcomes in liver cirrhosis.

Effects of inorganic phosphate on stem cells isolated from human exfoliated deciduous teeth

Calcium phosphate-based materials (CaP) are introduced as potential dental pulp capping materials for deciduous teeth. The present study investigated the influence of inorganic phosphate (Pi) on regulating stem cells isolated from human exfoliated deciduous teeth (SHED). SHEDs were treated with Pi. Cell cycle progression and apoptosis were examined using flow cytometry analysis. Osteo/odontogenic and adipogenic differentiation were analyzed using alizarin red S and oil red O staining, respectively. The mRNA expression profile was investigated using a high-throughput RNA sequencing technique. Pi increased the late apoptotic cell population while cell cycle progression was not altered. Pi upregulated osteo/odontoblastic gene expression and enhanced calcium deposition. Pi-induced mineralization was reversed by pretreatment of cells with Foscarnet, or p38 inhibitor. Pi treatment inhibited adipogenic differentiation as determined by decreased PPARγ expression and reduced intracellular lipid accumulation. Bioinformatic analysis of gene expression profiles demonstrated several involved pathways, including PI3K/AKT, MAPK, EGFR, and VEGF signaling. In conclusion, Pi enhanced osteo/odontogenic but inhibited adipogenic differentiation in SHED.

Reconstruction of cancer marker analysis with holistic anatomical precision implicates heterogeneity development during breast tumor progression

Biomarkers are not only of significant importance for cancer diagnosis and selection of treatment plans but also recently increasingly used for the evaluation of malignancy development and tumor heterogeneity. Large-size tumors from clinical patients can be unique and valuable sources for the study of cancer progression, particularly to the extent of intratumoral heterogeneity. In the present study, we obtained a series of post-surgery puncture samples from a breast cancer patient with a 4 × 3.5 × 2 cm tumor in its original size. Immunohistochemistry for Ki-67, COX-2, and CA IX was performed and the expression levels within the breast cancer tumor mass were evaluated in the reconstructed 3D models. To further evaluate the intratumoral heterogeneity, we performed high throughput whole transcriptome sequencing of 12 samples from different spatial positions within the tumor tissue. Comparing the reconstructed 3D distribution of biomarkers with projected tumor growth models, asymmetric and heterogeneous expansion of tumor mass was found to be possibly influenced by factors such as blood supply, inflammation and/or hypoxia stimulations, as suggested from the correlation between the results of Ki-67 and CA IX or COX-2 staining. Furthermore, high-throughput RNA sequencing data provided additional information for profiling the intratumoral heterogeneity and expanded the understanding of cancer progression. Digital technology for medical imaging once properly integrated with molecular pathology examinations will become particularly helpful in dissecting out in-depth information for precision medicine. We prospect that this approach, facilitated by rapidly advancing artificial intelligence, could provide new insights for clinical decision-making in the future. Strategies for the continuous development from the present study for better performance and application were discussed.

Unraveling potential gene biomarkers for dengue infection through RNA sequencing.

Dengue virus hijacks host cell mechanisms and immune responses in order to replicate efficiently. The interaction between the host and the virus affects the host's gene expression, which remains largely unexplored. This pilot study aimed to profile the host transcriptome as a potential strategy for identifying specific biomarkers for dengue prediction and detection. High-throughput RNA sequencing (RNA-seq) was employed to generate host transcriptome profiles in 16 dengue patients and 10 healthy controls. Differentially expressed genes (DEGs) were identified in patients with severe dengue and those with dengue with warning signs compared to healthy individuals. Gene Ontology (GO) and Kyoto Encyclopedia of Genes and Genomes (KEGG) analyses were performed to elucidate the functions of upregulated and downregulated genes. Compared to healthy controls, 6466 genes were significantly differentially expressed (p < 0.05) in the dengue with warning signs group and 3082 genes in the severe dengue group, with over half being upregulated. The major KEGG pathways implicated included transport and catabolism (14.4%-16.3%), signal transduction (6.6%-7.3%), global and overview maps (6.7%-7.1%), viral diseases (4.6%-4.8%), and the immune system (4.4%-4.6%). Several genes exhibited consistent and significant upregulation across all dengue patients, regardless of severity: Interferon alpha inducible protein 27 (IFI27), Potassium Channel Tetramerization Domain Containing 14 (KCTD14), Syndecan 1 (SDC1), DCC netrin 1 receptor (DCC), Ubiquitin C-terminal hydrolase L1 (UCHL1), Marginal zone B and B1 cell-specific protein (MZB1), Nestin (NES), C-C motif chemokine ligand 2 (CCL2), TNF receptor superfamily member 17 (TNFSF17), and TNF receptor superfamily member 13B (TNFRSF13B). Further analysis revealed potential biomarkers for severe dengue prediction, including TNF superfamily member 15 (TNFSF15), Plasminogen Activator Inhibitor-2 (SERPINB2), motif chemokine ligand 7 (CCL7), aconitate decarboxylase 1 (ACOD1), Metallothionein 1G (MT1G), and Myosin Light Chain Kinase (MYLK2), which were expressed 3.5 times, 2.9 times, 2.3 times, 2.1 times, 1.7 times, and 1.4 times greater, respectively, than dengue patients exhibiting warning signs. The identification of these host biomarkers through RNA-sequencing holds promising implications and potential to augment existing dengue detection algorithms, contributing significantly to improved diagnostic and prognostic capabilities.

CREB3L1 deficiency impairs odontoblastic differentiation and molar dentin deposition partially through the TMEM30B

Odontoblasts are primarily responsible for synthesizing and secreting extracellular matrix proteins, which are crucial for dentinogenesis. Our previous single-cell profile and RNAscope for odontoblast lineage revealed that cyclic adenosine monophosphate responsive element-binding protein 3 like 1 (Creb3l1) was specifically enriched in the terminal differentiated odontoblasts. In this study, deletion of Creb3l1 in the Wnt1+ lineage led to insufficient root elongation and dentin deposition. Assay for transposase-accessible chromatin with high-throughput sequencing (ATAC-seq) and RNA sequencing were performed to revealed that in CREB3L1-deficient mouse dental papilla cells (mDPCs), the genes near the closed chromatin regions were mainly associated with mesenchymal development and the downregulated genes were primarily related to biological processes including cell differentiation, protein biosynthesis and transport, all of which were evidenced by a diminished ability of odontoblastic differentiation, a significant reduction in intracellular proteins, and an even greater decline in extracellular supernatant proteins. Dentin matrix protein 1 (Dmp1), dentin sialophosphoprotein (Dspp), and transmembrane protein 30B (Tmem30b) were identified as direct transcriptional regulatory targets. TMEM30B was intensively expressed in the differentiated odontoblasts, and exhibited a significant decline in both CREB3L1-deficient odontoblasts in vivo and in vitro. Deletion of Tmem30b impaired the ability of odontoblastic differentiation, protein synthesis, and protein secretion in mDPCs. Moreover, overexpressing TMEM30B in CREB3L1-deficient mDPCs partially rescued the extracellular proteins secretion. Collectively, our findings suggest that CREB3L1 participates in dentinogenesis and facilitates odontoblastic differentiation by directly enhancing the transcription of Dmp1, Dspp, and other differentiation-related genes and indirectly promoting protein secretion partially via TMEM30B.

Identification of plasma exosomal lncRNA as a biomarker for early diagnosis of gastric cancer.

There were about 1,090,000 gastric cancer (GC) cases in 2020 in China. The incidence and mortality rates ranked the fifth and third among all kinds of cancers in China. Early diagnosis plays an important role in the treatment and prognosis of gastric cancer. In recent years, noninvasive diagnosis, especially plasma exosome lncRNAs, has become a promissing biomarkers with high specificity and sensitivity for early diagnosis of cancers. In this study, plasma exosomes of patients with early gastric cancer were extracted efficiently by affinity membrane separation technology, including affinity adsorption, elution, affinity membrane regeneration and other steps. After identified by electron microscopy observation, particle size analysis and Western blot verification, the lncRNAs in the exosomes were extracted and were analysized by high-throughput RNA sequencing (RNA-Seq). The differentially expressed lncRNAs were verified by RT-qPCR in 93 patients with early gastric cancer and 49 normal controls. Electron microscopy, particle size analysis and Western blot showed that exosomes were successfully isolated from plasma. RNA-Seq results show that 76 lncRNAs were upregulated and 260 lncRNAs were downregulated in plasma exosomes of early gastric cancer patients compared with normal controls. RT-qPCR analysis indicated that a total of 6 lncRNAs were significantly and differentially expressed in gastric cancer patients compared to normal controls, with 2 (lncmstrg. 1319590, Lncmstrg. 2312697) highly expressed and 4 lowly expressed (lncmstr-g.1004024.1, lncmstrg. 2441832.8, lncmstrg. 315376.1, lncmstrg.907985.2,) (p < 0.05). The survival curve analysis indicated that lncmstrg.2441832.8 and lncmstrg.2312697 had higher sensitivity and specificity for the diagnosis of gastric cancer, respectively and AUC curve areas were 0.6211 and 0.631, p < 0.05, respectively, which were greater than the traditional clinical detection indexes CEA (0.61) and AFP (0.57). When combined lncmstrg.2441832.8 and lncmstrg.2312697 in gastric cancer diagnosis, AUC curve area reached 0.73, which was greater than CA199 (0.71). Lncmstrg.2441832.8 and lncmstrg.2312697 may be a potential and promissing biomarkers for early diagnosis of gastric cancer.

The RNA m5C methyltransferase NSUN1 modulates human malaria gene expression during intraerythrocytic development.

Plasmodium falciparum is the most damaging malaria pathogen and brings a heavy burden to global health. Host switching and morphological changes in P. falciparum are dependent on an effective gene expression regulatory system. C5 methylation of cytosines is a common RNA modification in eukaryotes, and the NSUN family are essential m5C modification executors. Currently, little is known about this family in Plasmodium spp. In this study, we focus on exploring the function of PfNSUN1 protein. An efficient CRISPR/Cas9 gene editing technique was applied to construct the PfNSUN1 knockdown strain. The knockdown efficiency was confirmed by growth curves and western blot experiments. The knockdown transcriptome data was acquired to find differentially expressed genes, and target genes of PfNSUN1 protein were identified by RNA immunoprecipitation and high-throughput sequencing experiments. The efficiency of PfNSUN1 protein down-regulated was about 34%. RNA-seq data revealed that differentially expressed genes were mainly down-regulated. And there were 224, 278, 556 genes that were down-regulated with more than 2-fold changes and p-adj<0.05 at ring, trophozoite and schizont stages, respectively. PfNSUN1 protein was significantly enriched on 154 target genes, including 28S ribosomal RNA and pfap2-g5 transcription factor. PfNSUN1 is a crucial RNA post-transcriptional modification protein in P. falciparum. It plays a pivotal role in regulating gene expression and parasite growth by targeting 28S ribosomal RNA and pfap2-g5 transcription factor.

CHAC1 blockade suppresses progression of lung adenocarcinoma by interfering with glucose metabolism via hijacking PKM2 nuclear translocation.

Patients with lung adenocarcinoma (LUAD) generally have poor prognosis. Abnormal cellular energy metabolism is a hallmark of LUAD. Glutathione-specific gamma-glutamylcyclotransferase 1 (CHAC1) is a member of the γ-glutamylcyclotransferase family and an unfolded protein response pathway regulatory gene. Its biological function and molecular regulatory mechanism, especially regarding energy metabolism underlying LUAD, remain unclear. By utilizing tissue microarray and data from The Cancer Genome Atlas and Gene Expression Omnibus, we found that CHAC1 expression was markedly higher in LUAD tissues than in non-tumor tissues, and was positively correlated with poor prognosis. Phenotypically, CHAC1 overexpression enhanced the proliferation, migration, invasion, tumor sphere formation, and glycolysis ability of LUAD cells, resulting in tumor growth both in vitro and in vivo. Mechanistically, through a shotgun mass spectrometry-based proteomic approach and high-throughput RNA sequencing, we found that CHAC1 acted as a bridge connecting UBA2 and PKM2, enhancing the SUMOylation of PKM2. The SUMOylated PKM2 then transferred from the cytoplasm to the nucleus, activating the expression of glycolysis-related genes and enhancing the Warburg effect. Lastly, E2F Transcription Factor 1 potently activated CHAC1 transcription by directly binding to the CHAC1 promoter in LUAD cells. The results of this study implied that CHAC1 regulates energy metabolism and promotes glycolysis in LUAD progression.

Transcriptional reprogramming in the entomopathogenic fungus Metarhizium brunneum and its aphid host Myzus persicae during the switch between saprophytic and parasitic lifestyles

BackgroundThe fungus Metarhizium brunneum has evolved a remarkable ability to switch between different lifestyles. It develops as a saprophyte, an endophyte establishing mutualistic relationships with plants, or a parasite, enabling its use for the control of insect pests such as the aphid Myzus persicae. We tested our hypothesis that switches between lifestyles must be accompanied by fundamental transcriptional reprogramming, reflecting adaptations to different environmental settings.ResultsWe combined high throughput RNA sequencing of M. brunneum in vitro and at different stages of pathogenesis to validate the modulation of genes in the fungus and its host during the course of infection. In agreement with our hypothesis, we observed transcriptional reprogramming in M. brunneum following conidial attachment, germination on the cuticle, and early-stage growth within the host. This involved the upregulation of genes encoding degrading enzymes and gene clusters involved in synthesis of secondary metabolites that act as virulence factors. The transcriptional response of the aphid host included the upregulation of genes potentially involved in antifungal activity, but antifungal peptides were not induced. We also observed the induction of a host flightin gene, which may be involved in wing formation and flight muscle development.ConclusionsThe switch from saprophytic to parasitic development in M. brunneum is accompanied by fundamental transcriptional reprogramming during the course of the infection. The aphid host responds to fungal infection with its own transcriptional reprogramming, reflecting its inability to express antifungal peptides but featuring the induction of genes involved in winged morphs that may enable offspring to avoid the contaminated environment.

A tumor cornification and immune-infiltration-based scheme for anti-PD-1 plus chemotherapy response in advanced squamous cell lung carcinoma

Anti-PD-1 immunotherapy plus chemotherapy (combo) exhibits significantly prolonged survival for squamous cell lung cancer (LUSC). An exploration of predictive biomarkers is still needed. High-throughput RNA sequencing (RNA-seq) of 349 LUSC samples from the randomized, multi-center, phase 3 trial ORIENT-12 (ClinicalTrials.gov: NCT03629925) was conducted for biomarker discovery, followed by flow cytometry and multiplex immunohistochemistry (mIHC) in additional clinical cohorts, and invitro experiments were performed for verification. A high abundance of activated CD8+ T and CD56bright natural killer (NK) cells benefited patients' outcomes (progression-free survival [PFS]; overall survival [OS]) with combo treatment. Tumor cornification level remarkably affected the infiltration of the two crucial immune cells. Thus, a novel scheme of LUSC immune infiltration and cornification characterization-based classification (LICC) was established for combo efficacy prediction. Patients who received combo treatment achieved significant PFS improvements in LICC1 (hazard ratio [HR]= 0.43, 95% confidence interval [CI]: 0.25-0.75, p= 0.0029) and LICC2 (HR= 0.32, 95% CI: 0.17-0.58, p= 0.0002) subtypes but not in the LICC3 subtype (HR= 0.86, 95% CI: 0.60-1.23, p= 0.4053). Via single-cell RNA-seq analysis, the tumor cornification signal was mainly mapped to SPRR3+ tumor cells, whose relationships with activated CD8+ T or CD56bright NK cells were verified using flow cytometry and mIHC. Our data suggest that SPRR3+ tumor cells might evade immune surveillance via the CD24-SIGLEC10 (M2 macrophage) axis to maintain a suppressive tumor microenvironment. Tumor cornification greatly impacts immune infiltration, and the LICC scheme may guide clinical medication of anti-PD-1+chemo treatment in patients with LUSC. The study was funded by the National Key R&D Program of China, the National Natural Science Foundation of China, Shanghia Multidisplinary Cooperation Building Project for Diagnosis and Treatment of Major Disease, and Innovent Biologics, Inc.