High-throughput Sequencing Libraries Research Articles

Evidence of Grapevine enamovirus 1 Infecting Grapevine (Vitis vinifera L.) in Canada.

Grapevine enamovirus 1 (GEV1) belongs to the genus Enamovirus, in the family Solemoviridae. It has been reported from several countries infecting grapevines including Brazil (Silva et al. 2017), China (Ren et al. 2021) and France (Hily et al. 2022). To assess the prevalence and diversity of economically important grapevine viruses in nine Canadian vineyards, total RNA and double-stranded RNA (dsRNA) (Fall et al. 2020) were extracted from 30 and 100 composite samples respectively, with each consisting of five vines of the same cultivars. The cultivars included in this study are Frontenac noir (n=34), Vidal (n=32), Marquette (n=33), Riesling (n=31), and Pinot noir (n=31). The total RNA and dsRNA samples were subsequently multiplexed and diagnosed by high-throughput sequencing (HTS) on NovaSeq (600 S4 PE100) and MiSeq (2 × 250 cycle PE) respectively. From NovaSeq and MiSeq sequencing, an average of 410,000 to 1.3 million reads/sample were obtained, respectively, with mapped viral reads representing 10.92% to 12.48% of the total reads. After sequence quality was verified using Trimmomatic v.0.40 (Bolger et al. 2014), the clean sequences were screened against all possible viruses in the databases using the Virtool (Rott et al. 2017) and VirFind virus detection pipelines (Ho and Tzanetakis 2014). GEV1 was detected in clean sequences from two, three, and two leaf samples of cultivars 'Marquette' 'Riesling' and 'Frontenac noir' respectively. Six of the seven HTS-assembled GEV1 genomes were partial, ranging from 4,523 to 6,000 nucleotide (nt) with genome coverage varying from 71% to 89%. Only one 6,314 nt long assembled contig (Accession No. OR021829), represented a nearly complete genome, being only 53 and 3 nt shorter than Sd-CG (MT536978) at 5' and 3' untranslated regions (UTR), respectively. Isolate 3- Riesling-CAN (OR021829) shares 90.56 to 94.19% nt identities with several GEV1isolates at 96-99% of query coverage. Phylogenetically, OR021829 is closer to GEV1 isolates from France and China (Figure S1). To validate the HTS results, the developed primer pair SetF and Set1R (Silva et al., 2017) was used for RT-PCR detection. The amplicons from all seven HTS-positive samples were sequenced using Sanger sequencing, confirming the presence of GEV-1 in three studied grape cultivars in Canadian vineyards. Symptoms associated with the specific GEV1-infected vines could not be explained as composite samples were used. Each of the combined samples HTS library also tested positive for at least one of the known grape virus/viroids, namely grapevine leafroll associated-virus -3, grapevine pinot gris virus, grapevine rupestris stem pitting-associated virus, Marafivirus syrahense grapevine Syrah virus-1 and hop stunt viroid. To our knowledge, this is the first report of GEV1 being detected in grapevines in Canada, or in any North American vineyard. GEV1 is a relatively new virus, and its biology remains largely unknown. Based on this sequence new GEV1 primers can be developed to know the genetic variability among GEV-1 and improve the detection of this virus in vineyards.

Diversity of Parasitoid Wasps and Comparison of Sampling Strategies in Rice Fields Using Metabarcoding.

A comprehensive and precise evaluation of Arthropoda diversity in agricultural landscapes can enhance biological pest control strategies. We used Malaise traps and sweep nets to collect insects from three double-cropping paddy fields. DNA was extracted from the ethanol preservative of the Malaise traps and from tissue samples of selected parasitoid wasps. This was followed by amplification using DNA barcoding primers to prepare high-throughput sequencing libraries. We annotated a total of 4956 operational taxonomic units (OTUs), encompassing 174 genera and 32 families of parasitoid wasps. The ethanol filter method efficiently captured a wide range of information. However, the method has low resolution and may result in a reduced estimate of species abundance. Additional insect species were also identified in the parasitoid samples. This suggests that high throughput sequencing from adult parasitoid wasps can also detect host species, enabling a better understanding of host species and providing insights into food webs.

First report of barley yellow dwarf virus PAS (Luteovirus pashordei) in oat in Australia.

Luteoviruses (family Tombusviridae) and poleroviruses (family Solemoviridae) are economically important pathogens of cereals such as wheat (Triticum aestivum), barley (Hordeum vulgare) and oat (Avena sativa). In Australia, the luteoviruses barley yellow dwarf virus PAV (BYDV PAV) and barley yellow dwarf virus MAV (BYDV MAV), along with the poleroviruses cereal yellow dwarf virus RPV (CYDV RPV) and maize yellow dwarf virus RMV (MYDV RMV), were distinguished from each other and reported in the 1980s (Sward and Lister 1988; Waterhouse and Helms 1985). The poleroviruses barley virus G (BVG) and cereal yellow dwarf virus RPS (CYDV RPS) were reported in Australia more recently (Nancarrow et al. 2019; Nancarrow et al. 2023), while the luteovirus barley yellow dwarf virus PAS (BYDV PAS) has not previously been reported in Australia. During 2010, an oat plant exhibiting yellow/ red leaf discoloration and stunted growth was collected from a roadside in Horsham, Victoria, Australia. The plant tested positive for BYDV PAV and negative for BYDV MAV, CYDV RPV and MYDV RMV by tissue blot immunoassay (TBIA) as described by Trębicki et al (2017). The virus isolate has since been continuously maintained in a glasshouse in live wheat plants using aphids (Rhopalosiphum padi). In 2021, total RNA extracted from a wheat plant infected with this isolate (Nancarrow et al. 2023) tested positive for BYDV PAV by RT-PCR using the primers BYDV-1/BYDV-2 (Rastgou et al. 2005), but negative for BYDV PAV, CYDV RPV and MYDV RMV using other published primers (Deb and Anderson 2008). A high-throughput sequencing (HTS) library was prepared from the total RNA with the NEBNext Ultra II RNA Library Prep Kit for Illumina (NEB) without ribosomal RNA depletion and sequenced on a NovaSeq 6000 (Illumina). Raw reads were trimmed and filtered using fastp v0.20.0 (Chen et al. 2018) while de novo assembly of all of the resulting 5,049,052 reads was done using SPAdes v3.15.3 (Nurk et al. 2017). BLASTn analysis of the resulting 4,067 contigs (128- 12,457 bp in length) revealed only one large virus-like contig (5,649 bp) which was most similar to BYDV PAS isolates on NCBI GenBank, sharing 87% nucleotide (nt) identity with BYDV PAS isolate OH2 (MN128939), 86% nt identity with the BYDV PAS reference sequence (NC_002160) and 82% nt identity with the BYDV PAV reference sequence (NC_004750). Additionally, 4,008 HTS reads were mapped to the assembled genome sequence with Bowtie2 v2.4.5. (Langmead and Salzberg 2012) with 100% genome coverage and an average coverage depth of 101X. Primers were designed to the assembled genome sequence to generate overlapping amplicons across the genome, and the resulting amplicons were Sanger sequenced. This confirmed the genome sequence of BYDV PAS isolate PT from Australia (5649 bp, GC content 47.9%), which was deposited in GenBank (LC782749). Ten additional plant samples collected from western Victoria, Australia, all tested positive for BYDV PAS by RT-PCR using the primers PASF and PASR (Laney et al. 2018). The additional samples consisted of one oat sample collected in 2005, one barley sample collected in 2007, three wheat samples collected in 2016 and one barley, one brome grass (Bromus sp.) and three wheat samples collected in 2020. BYDV PAS is also efficiently transmitted by R. padi but is often more prevalent and severe than BYDV PAV; it can also overcome some sources of virus resistance that are effective against BYDV PAV (Chay et al. 1996, Robertson and French 2007). To our knowledge, this is the first report of BYDV PAS in Australia. Further work is needed to determine the extent of its distribution, incidence, impacts and epidemiology in Australia, along with its relationship to other BYDV PAS isolates.

PAR-dCLIP: Enabling detection of RNA binding protein target transcripts bound at 5' termini through the incorporation of a decapping step.

RNA binding proteins (RBPs) are responsible for facilitating a wealth of post-transcriptional gene regulatory functions. The role of an RBP on regulated transcripts can be investigated through a pull-down of the RBP and high-throughput sequencing (HTS) of the associated transcripts. PhotoactivatableRibonucleoside-Enhanced Crosslinking and Immunoprecipitation (PAR-CLIP), is one such pull-down method that isolates, detects, and sequences the cDNA of RBP-associated transcripts. PAR-CLIP relies on a photoactivatable ribonucleoside analogue, 4-thiouridine, to facilitate covalent RNA-protein crosslinks at 365nm. These crosslinks permit stringent wash conditions and result in T to C mismatch incorporations during reverse transcription, a unique parameter for the computational analysis of high-confidence binding sites. However, until now, RBPs that bind at the 5'-termini of RNAs have been uniquely restricted from the full potential bandwidth of autoradiographic detection and HTS library preparation. The 5'-termini of RNAs are highly modified, including the most common Pol-II derived modification: the 7-methylguanosine (m7G) cap. In the conventional PAR-CLIP protocol, cap-binding proteins protect the m7G cap from the RNase treatment that generates the necessary substrate for autoradiographic detection and 5' adapter ligation-thus occluding entire populations of RNA from visualization and HTS. Here, we introduce decapping-PAR-CLIP or PAR-dCLIP. We incorporate a decapping step into the PAR-CLIP protocol to generate the necessary substrate to sequence m7G capped transcripts. While PAR-dCLIP was originally targeted towards known m7G-cap binding proteins, we argue that all RBP inquiries, and particularly those suspected to regulate translation, should incorporate this decapping step to ensure that all possible populations of bound transcripts are identified.

Full-Length Transcriptome and Gene Expression Analysis of Different Ovis aries Adipose Tissues Reveals Transcript Variants Involved in Lipid Biosynthesis.

Sheep have historically been bred globally as a vital food source. To explore the transcriptome of adipose tissue and investigate key genes regulating adipose metabolism in sheep, adipose tissue samples were obtained from F1 Dorper × Hu sheep. High-throughput sequencing libraries for second- and third-generation sequencing were constructed using extracted total RNA. Functional annotation of differentially expressed genes and isoforms facilitated the identification of key regulatory genes and isoforms associated with sheep fat metabolism. SMRT-seq generated 919,259 high-accuracy cDNA sequences after filtering. Full-length sequences were corrected using RNA-seq sequences, and 699,680 high-quality full-length non-chimeric (FLNC) reads were obtained. Upon evaluating the ratio of total lengths based on FLNC sequencing, it was determined that 36,909 out of 56,316 multiple-exon isoforms met the criteria for full-length status. This indicates the identification of 330,375 full-length FLNC transcripts among the 370,114 multiple-exon FLNC transcripts. By comparing the reference genomes, 60,276 loci and 111,302 isoforms were identified. In addition, 43,423 new genes and 44,563 new isoforms were identified. The results identified 185 (3198), 394 (3592), and 83 (3286) differentially expressed genes (transcripts) between tail and subcutaneous, tail and visceral, and subcutaneous and visceral adipose tissues, respectively. Functional annotation and pathway analysis revealed the following observations. (1) Among the differentially expressed genes (DEGs) of TF and SF tissues, the downregulation of ACADL, ACSL6, and NC_056060.1.2536 was observed in SF, while FFAR4 exhibited upregulation. (2) Among the DEGs of TF and VF tissues, expressions of ACADL, ACSL6, COL1A1, COL1A2, and SCD were downregulated in VF, with upregulation of FFAR4. (3) Among SF and VF expressions of COL1A1, COL1A2, and NC_056060.1.2536 were downregulated in VF. Specific differentially expressed genes (ACADL, ACSL6, COL1A1, COL1A2, FFAR4, NC_056060.1.2536, and SCD) and transcripts (NC_056066.1.1866.16 and NC_056066.1.1866.22) were identified as relevant to fat metabolism. These results provide a dataset for further verification of the regulatory pathway associated with fat metabolism in sheep.

Optimizing the Use of Solid-Phase Reversible Immobilization Beads for High-Throughput Full-Length 16S rDNA Sequencing Library Construction

Objective: Solid-phase reversible immobilization (SPRI) beads are widely used for high-throughput sequencing library construction to purify and recover nucleic acids. This research was aimed at investigating the effects of SPRI bead ratio, incubation time, and elution time on nucleic acid recovery during full-length 16S rDNA high-throughput sequencing library construction. Methods: The effects of different SPRI bead ratios, incubation times, and elution times were compared for three different initial sample amounts. An L9(33) orthogonal experiment was designed to determine the optimal combination of these factors. Results: The incubation time of three factors including SPRI beads ratio, incubation time, and elution time had a statistically significant effect on the recovery rate for the initial sample amount of 1500 ng and 3000 ng. The orthogonal experiment results indicated that incubation time had the greatest impact among the three factors. Conclusion: Incubation time significantly influences recovery rate in full-length 16S rDNA high-throughput sequencing library construction. The use of 0.8× SPRI beads, 15 minutes of incubation, and 10 minutes of elution resulted in the highest recovery rate. SPRI beads offer a viable method for recovering full-length 16S rDNA amplicons.

MiR-615 facilitates porcine epidemic diarrhea virus replication by targeting IRAK1 to inhibit type III interferon expression.

Porcine epidemic diarrhea virus (PEDV) in the Coronavirus family is a highly contagious enteric pathogen in the swine industry, which has evolved mechanisms to evade host innate immune responses. The PEDV-mediated inhibition of interferons (IFNs) has been linked to the nuclear factor-kappa B (NF-κB) pathway. MicroRNAs (miRNAs) are involved in virus-host interactions and IFN-I regulation. However, the mechanism by which the PEDV regulates IFN during PEDV infection has not yet been investigated in its natural target cells. We here report a novel mechanism of viral immune escape involving miR-615, which was screened from a high-throughput sequencing library of porcine intestinal epithelial cells (IECs) infected with PEDV. PEDV infection altered the profiles of miRNAs and the activities of several pathways involved in innate immunity. Overexpression of miR-615 increased PEDV replication, inhibited IFN expression, downregulated the NF-κB pathway, and blocked p65 nuclear translocation. In contrast, knockdown of miR-615 enhanced IFN expression, suppressed PEDV replication, and activated the NF-κB pathway. We further determined that IRAK1 is the target gene of miR-615 in IECs. Our findings show that miR-615 suppresses activation of the NF-κB pathway by suppressing the IRAK1 protein and reducing the generation of IFN-IIIs, which in turn facilitates PEDV infection in IECs. Moreover, miR-615 inhibited PEDV replication and NF-κB pathway activation in both IECs and MARC-145 cells. These findings support an important role for miR-615 in the innate immune regulation of PEDV infections and provide a novel perspective for developing new treatments.

Hyper-seq: A novel, effective, and flexible marker-assisted selection and genotyping approach

Recently, a novel extremely low-cost, effective, flexible, and high-throughput DNA sequencing library preparation and genotyping approach has been developed named Hyper-seq. This new technology has been adopted by more than 15 research institutes and universities, which has significantly improved the efficiency of crop breeding.

First Report of Blackcurrant-Associated Rhabdovirus in Blackcurrants in Latvia.

Blackcurrants (Ribes nigrum) are among the most important commercial berry crops in Latvia and, together with redcurrants and gooseberries, have a long history of local cultivation and breeding (Zuļģe et al. 2018). So far at least 20 viruses were reported to infect Ribes plants (Špak et al. 2021). Blackcurrant-associated rhabdovirus (BCaRV) was previously identified in USA by high throughput sequencing (HTS) of blackcurrant germplasm accession introduced from Russia (isolate Veloy) and now serves as an exemplar isolate for BCaRV (Wu et al. 2018). Presence of BCaRV was also confirmed by RT-PCR in blackcurrant germplasm accession of cv. Burga from France during the same study by Wu et al. (2018). Currently Blackcurrant betanucleorhabdovirus is one of the nine species recognized by ICTV in genus Betanucleorhabdovirus of family Rhabdoviridae, but the impact of BCaRV on the host still remains unknown. Leaf tissue from twelve asymptomatic blackcurrant cv. Mara Eglite plants that negatively tested for blackcurrant reversion virus from Dobele, Latvia (56°36'31.9"N, 23°18'13.6"E) was collected on May 17, 2019 and used for HTS study of local Ribes resistance genes. Total RNA from the leaf tissue of sampled plants was isolated following a method described by Kalinowska et al. (2012) with minor modifications. Briefly, RNeasy Plant Mini Kit (QIAGEN) was used with RLC lysis buffer being supplemented with 2% PVP and 1% β-mercaptoethanol. Plant rRNA was subsequently removed by a RiboMinus Plant Kit for RNA-Seq (Thermo Fisher Scientific (TFS)) prior to cDNA library construction. HTS libraries were prepared using MGIEasy RNA Directional Library Prep Set for 16 reactions (MGI), following a protocol for 150 bp pair-end reads. According to the manufacturers guidelines libraries were pooled, circularized and cleaned before being subjected to sequencing on DNBSEQ-G400 (MGI) using PE150 flow cell (MGI). The sequencing run yielded a total of 393660492 150 bp long read pairs. Reads were assembled into transcripts using rnaSPAdes v 3.13.1 (Bushmanova et al. 2019) and a 14424 base long contig with an average coverage of 684x was found to be 99.5% identical (14358/14432 identities and 8 gaps in the pairwise alignment) to the previously reported first complete genome of BCaRV (MF543022.1) using EMBOSS Needle (Madeira et al., 2019). This contig representing the genome of BCaRV isolate Mara Eglite, onto which 66768 of the raw reads could be mapped, was subsequently deposited at European Nucleotide Archive under accession number OU015520. All of the twelve individual samples were also tested for the presence of BCaRV by RT-PCR, using Verso cDNA Synthesis Kit with random hexamer primers (TFS) for first strand cDNA synthesis followed by PCR with N protein nested primers BCaRV-N-F (5' AGATGTGCTTCATCGATGGCTAGTTCTGCT 3') and BCaRV-N-R (5' TGCATTCCCACGGGTTAGGAATACATTGGTACT 3') resulting in a 243 bp long fragment for six of the samples. RT-PCR products from six BCaRV positive samples were directly sequenced by Sanger-based method using BigDye Terminator v3.1 Cycle Sequencing Kit (Applied Biosystems) with BCaRV-N-F and BCaRV-N-R primers. Acquired RT-PCR product sequences matched the corresponding region of BCaRV isolate Mara Eglite genome assembled from HTS data. In this report, we have documented the natural occurrence of BCaRV in Latvia, which makes it a second evidence on the presence of BCaRV in Europe.

Genome-Wide Mapping and Microscopy Visualization of Protein-DNA Interactions by pA-DamID.

Several methods have been developed to map protein-DNA interactions genome-wide in the last decades. ProteinA-DamID (pA-DamID) is a recent addition to this list with distinct advantages. pA-DamID relies on antibody-based targeting of the bacterial Dam enzyme, resulting in adenine methylation of DNA in contact with the protein of interest. This m6A can then be visualized by microscopy, or mapped genome-wide. The main advantages of pA-DamID are an easy and direct visualization of DNA that is in contact with the protein of interest, unbiased mapping of protein-DNA interactions, and the possibility to select specific subpopulations of cells by flow cytometry before further sample processing. pA-DamID is particularly suited to study proteins that form large chromatin domains or that are part of distinct nuclear structures such as the nuclear lamina. This chapter describes the pA-DamID procedure from cell harvesting to the preparation of microscopy slides and high-throughput sequencing libraries.

Extraction and high-throughput sequencing of oak heartwood DNA: Assessing the feasibility of genome-wide DNA methylation profiling.

Tree ring features are affected by environmental factors and therefore are the basis for dendrochronological studies to reconstruct past environmental conditions. Oak wood often provides the data for these studies because of the durability of oak heartwood and hence the availability of samples spanning long time periods of the distant past. Wood formation is regulated in part by epigenetic mechanisms such as DNA methylation. Studies of the methylation state of DNA preserved in oak heartwood thus could identify epigenetic tree ring features informing on past environmental conditions. In this study, we aimed to establish protocols for the extraction of DNA, the high-throughput sequencing of whole-genome DNA libraries (WGS) and the profiling of DNA methylation by whole-genome bisulfite sequencing (WGBS) for oak (Quercus robur) heartwood drill cores taken from the trunks of living standing trees spanning the AD 1776-2014 time period. Heartwood contains little DNA, and large amounts of phenolic compounds known to hinder the preparation of high-throughput sequencing libraries. Whole-genome and DNA methylome library preparation and sequencing consistently failed for oak heartwood samples more than 100 and 50 years of age, respectively. DNA fragmentation increased with sample age and was exacerbated by the additional bisulfite treatment step during methylome library preparation. Relative coverage of the non-repetitive portion of the oak genome was sparse. These results suggest that quantitative methylome studies of oak hardwood will likely be limited to relatively recent samples and will require a high sequencing depth to achieve sufficient genome coverage.

Tagmentation-based single-cell genomics.

It has been just over 10 years since the initial description of transposase-based methods to prepare high-throughput sequencing libraries, or “tagmentation,” in which a hyperactive transposase is used to simultaneously fragment target DNA and append universal adapter sequences. Tagmentation effectively replaced a series of processing steps in traditional workflows with one single reaction. It is the simplicity, coupled with the high efficiency of tagmentation, that has made it a favored means of sequencing library construction and fueled a diverse range of adaptations to assay a variety of molecular properties. In recent years, this has been centered in the single-cell space with a catalog of tagmentation-based assays that have been developed, covering a substantial swath of the regulatory landscape. To date, there have been a number of excellent reviews on single-cell technologies structured around the molecular properties that can be profiled. This review is instead framed around the central components and properties of tagmentation and how they have enabled the development of innovative molecular tools to probe the regulatory landscape of single cells. Furthermore, the granular specifics on cell throughput or richness of data provided by the extensive list of individual technologies are not discussed. Such metrics are rapidly changing and highly sample specific and are better left to studies that directly compare technologies for assays against one another in a rigorously controlled framework. The hope for this review is that, in laying out the diversity of molecular techniques at each stage of these assay platforms, new ideas may arise for others to pursue that will further advance the field of single-cell genomics.

Towards reproducible metabarcoding data: Lessons from an international cross-laboratory experiment.

Advances in high-throughput sequencing (HTS) are revolutionizing monitoring in marine environments by enabling rapid, accurate and holistic detection of species within complex biological samples. Research institutions worldwide increasingly employ HTS methods for biodiversity assessments. However, variance in laboratory procedures, analytical workflows and bioinformatic pipelines impede the transferability and comparability of results across research groups. An international experiment was conducted to assess the consistency of metabarcoding results derived from identical samples and primer sets using varying laboratory procedures. Homogenized biofouling samples collected from four coastal locations (Australia, Canada, New Zealand and the USA) were distributed to 12 independent laboratories. Participants were asked to follow one of two HTS library preparation workflows. While DNA extraction, primers and bioinformatic analyses were purposefully standardized to allow comparison, many other technical variables were allowed to vary among laboratories (amplification protocols, type of instrument used, etc.). Despite substantial variation observed in raw results, the primary signal in the data was consistent, with the samples grouping strongly by geographical origin for all data sets. Simple post hoc data clean-up by removing low-quality samples gave the best improvement in sample classification for nuclear 18S rRNA gene data, with an overall 92.81% correct group attribution. For mitochondrial COI gene data, the best classification result (95.58%) was achieved after correction for contamination errors. The identified critical methodological factors that introduced the greatest variability (preservation buffer, sample defrosting, template concentration, DNA polymerase, PCR enhancer) should be of great assistance in standardizing future biodiversity studies using metabarcoding.

Benchmarking and optimization of a high-throughput sequencing based method for transgene sequence variant analysis in biotherapeutic cell line development.

In recent years, High-Throughput Sequencing (HTS) based methods to detect mutations in biotherapeutic transgene products have become a key quality step deployed during the development of manufacturing cell line clones. Previously we reported on a higher throughput, rapid mutation detection method based on amplicon sequencing (targeting transgene RNA) and detailed its implementation to facilitate cell line clone selection. By gaining experience with our assay in a diverse set of cell line development programs, we improved the computational analysis as well as experimental protocols. Here we report on these improvements as well as on a comprehensive benchmarking of our assay. We evaluated assay performance by mixing amplicon samples of a verified mutated antibody clone with a non-mutated antibody clone to generate spike-in mutations from ∼60% down to ∼0.3% frequencies. We subsequently tested the effect of 16 different sample and HTS library preparation protocols on the assay's ability to quantify mutations and on the occurrence of false-positive background error mutations (artifacts). Our evaluation confirmed assay robustness, established a high confidence limit of detection of ∼0.6%, and identified protocols that reduce error levels thereby significantly reducing a source of false positives that bottlenecked the identification of low-level true mutations.

First Report of Impatiens Necrotic Spot Virus Infecting Lettuce in Greece

HomePlant DiseaseVol. 104, No. 10First Report of Impatiens Necrotic Spot Virus Infecting Lettuce in Greece PreviousNext DISEASE NOTES OPENOpen Access licenseFirst Report of Impatiens Necrotic Spot Virus Infecting Lettuce in GreeceD. Beris, I. Malandraki, O. Kektsidou, N. Vassilakos, and C. VarveriD. Beris†Corresponding author: D. Beris; E-mail Address: d.mperi@bpi.grhttp://orcid.org/0000-0003-3308-8742Laboratory of Virology, Department of Phytopathology, Benaki Phytopathological Institute, Kifissia, Athens 14561, GreeceSearch for more papers by this author, I. Malandrakihttp://orcid.org/0000-0001-5623-5261Laboratory of Virology, Department of Phytopathology, Benaki Phytopathological Institute, Kifissia, Athens 14561, GreeceSearch for more papers by this author, O. KektsidouLaboratory of Virology, Department of Phytopathology, Benaki Phytopathological Institute, Kifissia, Athens 14561, GreeceSearch for more papers by this author, N. VassilakosLaboratory of Virology, Department of Phytopathology, Benaki Phytopathological Institute, Kifissia, Athens 14561, GreeceSearch for more papers by this author, and C. VarveriLaboratory of Virology, Department of Phytopathology, Benaki Phytopathological Institute, Kifissia, Athens 14561, GreeceSearch for more papers by this authorAffiliationsAuthors and Affiliations D. Beris † I. Malandraki O. Kektsidou N. Vassilakos C. Varveri Laboratory of Virology, Department of Phytopathology, Benaki Phytopathological Institute, Kifissia, Athens 14561, Greece Published Online:18 Aug 2020https://doi.org/10.1094/PDIS-11-19-2316-PDNAboutSectionsSupplemental ToolsAdd to favoritesDownload CitationsTrack Citations ShareShare onFacebookTwitterLinked InRedditEmailWechat During the autumn of 2018 and the winter of 2019, virus-like disease symptoms were observed in four fields of lettuce (Lactuca sativa) in Kalamos, Marathonas, and Leonidio regions of central and south-eastern Greece. In all cases, the disease affected 30 to 40% of the plants. Symptoms consisted of brown ringspots, necrotic lesions, vein necrosis, and leaf distortion resembling those associated with tospovirus infections. Six symptomatic plants (four in 2018 and two in 2019) were collected from four different fields and were tested for the presence of tomato spotted wilt virus (TSWV), tomato chlorotic spot virus (TCSV), impatiens necrotic spot virus (INSV), groundnut ringspot virus (GRSV), and chrysanthemum stem necrosis virus (CSNV) with double antibody sandwich ELISA specific and generic polyclonal antisera, respectively (Loewe Biochemica, Germany). All samples were found negative for TSWV but positive for other Tospovirus infection with the generic ELISA test. Total RNA was purified from all six symptomatic samples and reverse transcription polymerase chain reaction (RT-PCR) was performed with the gM410/gM870c primer pair (Chen et al. 2012) targeting the conserved NSm genomic region of tospoviruses. Direct Sanger sequencing of the 500-bp PCR products obtained from all six samples revealed the presence of INSV Tospovirus, and showed 97.5 to 98.7% identity at nucleotide level with the respective region of the Chinese isolate HDL (GU112503). To further characterize our INSV isolate, total RNA isolated with NucleoZOL reagent (Macherey-Nagel, Germany) from one symptomatic lettuce was subjected to high-throughput sequencing (HTS) on a Next Seq platform (Illumina, U.S.A.) by using the TruSeq Stranded mRNA Library Prep kit (Illumina) for the construction of the poly-A selected HTS library. The analysis generated approximately 14,000,000 single-end reads of 75-bp length that were analyzed with Geneious bioinformatics software (Biomatters, New Zealand). After the de novo assembly of the unique reads (7,448,124 reads), contigs (in total 108,234 contigs ranging in size from 150 to 12,000 bp) were annotated with BLAST, and the presence of INSV was confirmed. Assembled nucleotide sequences of S (MN553562) and M (MN553561) segments exhibited 88 to 98% coverage and 99% identity at nucleotide level with an Italian isolate (DQ425096 and DQ425095, respectively). Nucleotide sequence of the L segment also showed 64% coverage with 88% identity with the Italian isolate (DQ425094). Furthermore, HTS analysis revealed the presence of lettuce big-vein associated virus (LBVaV, Rhabdoviridae, Varicosavirus genus). To isolate INSV, Nicotiana tabacum, an insusceptible host of LBVaV, was used. Infected N. tabacum tissues were used to reproduce symptoms in virus-tested-negative lettuce plants after mechanical inoculation. In the latter plants, INSV presence was confirmed with RT-PCR assays targeting specific regions of the three INSV segments by respective primer pairs designed based on the HTS analysis. Sequences of the three PCR products were 100% identical with the HTS-assembled INSV segments of the respective regions and confirmed the presence of all virus segments. INSV was first described in Impatiens spp. plants (Law and Moyer 1990) and is an important pathogen for several crops including ornamental plants, tomato, and lettuce (Kuo et al. 2014). The relatively high incidence of the virus in different regions of Greece suggests that INSV is an emerging pest for lettuce cultivation in Greece. To the best of our knowledge, this is the first report of INSV in Greece.The author(s) declare no conflict of interest.

Ribonucleotide incorporation in yeast genomic DNA shows preference for cytosine and guanosine preceded by deoxyadenosine

Despite the abundance of ribonucleoside monophosphates (rNMPs) in DNA, sites of rNMP incorporation remain poorly characterized. Here, by using ribose-seq and Ribose-Map techniques, we built and analyzed high-throughput sequencing libraries of rNMPs derived from mitochondrial and nuclear DNA of budding and fission yeast. We reveal both common and unique features of rNMP sites among yeast species and strains, and between wild type and different ribonuclease H-mutant genotypes. We demonstrate that the rNMPs are not randomly incorporated in DNA. We highlight signatures and patterns of rNMPs, including sites within trinucleotide-repeat tracts. Our results uncover that the deoxyribonucleotide immediately upstream of the rNMPs has a strong influence on rNMP distribution, suggesting a mechanism of rNMP accommodation by DNA polymerases as a driving force of rNMP incorporation. Consistently, we find deoxyadenosine upstream from the most abundant genomic rCMPs and rGMPs. This study establishes a framework to better understand mechanisms of rNMP incorporation in DNA.

Non-destructive genome skimming for aquatic copepods

Copepods are important ecologically and represent a large amount of aquatic biomass in both freshwater and marine systems. Despite this, the taxonomy of copepods and other meiofauna is not well understood, hampered by tiny sizes, cryptic taxa, intraspecific polymorphisms and total specimen destruction where DNA methods are employed. In this article we highlight these issues and propose a more up-to-date approach for dealing with them. Namely, we recommend non-destructive DNA extraction methods, coupled with high-throughput sequencing (HTS). Whilst DNA yields may be low, they should still be sufficient for HTS library preparation and DNA sequencing. At the same time morphological specimens can be preserved and the crucial link between morphology and DNA sequence is maintained. This is critical for an integrative taxonomy and a fuller understanding of biodiversity patterns as well as evolutionary processes in meiofauna.

An SNP-Based High-Density Genetic Linkage Map for Tetraploid Potato Using Specific Length Amplified Fragment Sequencing (SLAF-Seq) Technology

Specific length amplified fragment sequencing (SLAF-seq) is a recently developed high-resolution strategy for the discovery of large-scale de novo genotyping of single nucleotide polymorphism (SNP) markers. In the present research, in order to facilitate genome-guided breeding in potato, this strategy was used to develop a large number of SNP markers and construct a high-density genetic linkage map for tetraploid potato. The genomic DNA extracted from 106 F1 individuals derived from a cross between two tetraploid potato varieties YSP-4 × MIN-021 and their parents was used for high-throughput sequencing and SLAF library construction. A total of 556.71 Gb data, which contained 2269.98 million pair-end reads, were obtained after preprocessing. According to bioinformatics analysis, a total of 838,604 SLAF labels were developed, with an average sequencing depth of 26.14-fold for parents and 15.36-fold for offspring of each SLAF, respectively. In total, 113,473 polymorphic SLAFs were obtained, from which 7638 SLAFs were successfully classified into four segregation patterns. After filtering, a total of 7329 SNP markers were detected for genetic map construction. The final integrated linkage map of tetraploid potato included 3001 SNP markers on 12 linkage groups, and covered 1415.88 cM, with an average distance of 0.47 cM between adjacent markers. To our knowledge, the integrated map described herein has the best coverage of the potato genome and the highest marker density for tetraploid potato. This work provides a foundation for further quantitative trait loci (QTL) location, map-based gene cloning of important traits and marker-assisted selection (MAS) of potato.

NirS-type N2O-producers and nosZ II-type N2O-reducers determine the N2O emission potential in farmland rhizosphere soils

Denitrification process in agricultural fields is a large source of nitrous oxide (N2O) emitted to the atmosphere. The rhizosphere soils tend to be the hotspots of denitrification in agricultural soils. Recent studies have reported the important role of nosZ II in eliminating N2O. However, little was known about how these more recently discovered N2O-reducing microorganisms together with other N2O-producers affected the N2O emission in agricultural rhizosphere soils. Here, we compared the potential N2O production rate, the denitrification end-product ratio, and the denitrifier communities between rhizosphere and non-rhizosphere soils of two types of crops in winter and summer. The potential activities were measured by acetylene inhibition technique. QPCR analysis was used to quantify the functional genes. High-throughput sequencing and clone library were conducted to analyze the community structure of denitrifiers. The rhizosphere soils had a higher N2O production potential but lower denitrification end-product ratio (N2O/(N2O+N2)) than the non-rhizosphere soils. The potential N2O production rate was correlated to the nirS-bacteria abundance, especially in terms of the genus Azospirillum. The N2O/(N2O+N2) ratio showed a negative correlation with both the diversity and abundance of the nosZ II-type N2O-reducers. Altogether, we propose that nirS-type N2O-producers and nosZ II-type N2O-reducers can affect the N2O emission in agricultural rhizosphere soils, and enhancement of diversity and abundance of nosZ II-type N2O-reducers may help with the N2O mitigation from upland crops.

Identification of Footprints of RNA:Protein Complexes via RNA Immunoprecipitation in Tandem Followed by Sequencing (RIPiT-Seq)

RNA immunoprecipitation in tandem (RIPiT) is a method for enriching RNA footprints of a pair of proteins within an RNA:protein (RNP) complex. RIPiT employs two purification steps. First, immunoprecipitation of a tagged RNP subunit is followed by mild RNase digestion and subsequent non-denaturing affinity elution. A second immunoprecipitation of another RNP subunit allows for enrichment of a defined complex. Following a denaturing elution of RNAs and proteins, the RNA footprints are converted into high-throughput DNA sequencing libraries. Unlike the more popular ultraviolet (UV) crosslinking followed by immunoprecipitation (CLIP) approach to enrich RBP binding sites, RIPiT is UV-crosslinking independent. Hence RIPiT can be applied to numerous proteins present in the RNA interactome and beyond that are essential to RNA regulation but do not directly contact the RNA or UV-crosslink poorly to RNA. The two purification steps in RIPiT provide an additional advantage of identifying binding sites where a protein of interest acts in partnership with another cofactor. The double purification strategy also serves to enhance signal by limiting background. Here, we provide a step-wise procedure to perform RIPiT and to generate high-throughput sequencing libraries from isolated RNA footprints. We also outline RIPiT's advantages and applications and discuss some of its limitations.