High Infestation Levels Research Articles

Vegetative Growth Responses of Pinot gris (Vitis viniferaL.) Grapevines to Infestation by Potato Leafhoppers (Empoasca fabaeHarris)

The potato leafhopper (<i>Empoasca fabae</i> Harris) can be a damaging pest of vineyards throughout eastern North America, causing leaf curling and yellowing in sensitive cultivars. To determine the relationship between infestations by this insect and vine growth and resource allocation, potted and fruitless Pinot gris (<i>Vitis vinifera</i> L.) grapevines grafted to rootstock 1103 Paulsen (<i>V. berlandieri</i> Planch. x <i>V. rupestris</i> Scheele) were infested for 7 days with 0.0 to 4.5 potato leafhopper (<i>E. fabae</i>) nymphs per leaf. Shoot growth, leaf growth, and infestation symptoms of the leaves were quantified before and after the infestation period, and biomass of vegetative vine structures was measured at the end of the experiment. Leaf symptoms of cupping and discoloration were positively correlated with infestation severity, while shoot and leaf growth declined with increasing leafhopper density. Root mass at the end of the experiment was lower in vines with higher infestation levels. Analysis of these results enabled damage symptom and leaf growth thresholds to be determined at between 0.5 and 1.0 <i>E. fabae</i> per leaf. However, recovery of vines after infestation was observed in leaf and shoot growth parameters, and vine biomass was reduced only when <i>E. fabae</i> densities exceeded 3.0 nymphs per leaf. This study reveals the negative effect of low densities of <i>E. fabae</i> on a sensitive grape cultivar and suggests that vines can recover from low infestation levels during the postinfestation period.

Períodos de interferência de plantas daninhas na cultura do sorgo forrageiro em terras baixas

Objetivou-se com este trabalho avaliar a eficiência do método mecânico de controle de plantas daninhas na cultura do sorgo e determinar o período crítico de competição da cultura com a comunidade infestante em terras baixas de clima temperado, considerando o estádio de desenvolvimento das plantas de sorgo. O experimento foi instalado em condições de campo, em Planossolo hidromórfico cultivado nos últimos cinco anos com arroz, com população elevada de plantas daninhas, principalmente capim-arroz (Echinochloa sp.) e papuã (Brachiaria plantaginea). Os tratamentos consistiram de diferentes períodos de convivência das plantas daninhas com a cultura ou de manutenção da cultura no limpo. Esses períodos foram da emergência até o sorgo atingir três, cinco, sete e nove folhas. Foram mantidas, ainda, uma testemunha constantemente limpa e uma permanentemente infestada. Concluiu-se que o controle das plantas daninhas na cultura do sorgo, cultivado em terras baixas de clima temperado, deve ser realizado no período entre a emissão da terceira e a da sétima folha, podendo-se utilizar com segurança o controle mecânico para esse fim, sem prejuízos no rendimento de grãos da cultura.

Tilletia barclayana: biologia e manejo em arroz irrigado

A cárie-do-arroz (Tilletia barclayana), doença considerada secundária na cultura do arroz irrigado, vem ganhando importância nos últimos anos devido aos níveis elevados de infestação e à redução do rendimento. A doença é favorecida por temperatura e umidade do ar elevadas, doses altas de nitrogênio e semeadura tardia. Para o manejo, recomenda-se uso de resistência varietal, semeadura na época recomendada e adubação equilibrada.

Tobacco streak virus infecting faba bean (Vicia faba) reported for the first time

During the period December 2005 to January 2006, unusual leaf symptoms suggestive of a virus infection were observed in faba bean (Vicia faba) in fields in the Gezira area and northern parts of Sudan. Symptoms in beans were coincident with a high level of crop infestation by Aphis craccivora that might play a role in the transmission of the virus. Chlorotic mottling and/or mosaic symptoms were accompanied by black streaks on stems and leaf petioles. In some bean varieties, severe leaf chlorosis subsequently developed into browning and blackening of the entire leave), resulting in plant death. Extracts from bean leaves were mechanically inoculated on to range of host plants, and Nicotiana benthamiana and Chenopodium quinoa were identified as suitable propagation hosts. Electron microscope analysis of leaf extracts from infected C. quinoa revealed virus-like particles with isometric particles approximately 30 nm in diameter. A specific antiserum raised against the purified virus was produced, and in Western-immunoblot analysis the size of the putative coat protein was estimated to be between 29 and 30 kDa. Using several reference viruses available at the DSMZ collection in Braunschweig, Germany, for a serological comparison, the virus isolated from faba bean was found to be related to Tobacco streak virus (TSV) (Scott, 2001), a virus that is a serious pathogen of groundnut, sunflower and okra in India (Reddy et al., 2002; Bhat et al., 2002; Krishnareddy et al., 2003). The identity of the faba bean virus isolate was confirmed by reverse transcription-polymerase chain reaction (RT-PCR) and sequence analysis. A fragment of 717 nucleotides corresponding to the complete TSV coat protein region was sequenced by using specific TSV primers (TSV Cps ATGAATACTTTGATCCAAGG–TSVCPcTCAGTCTTGATTCACCAGGA) (GenBank Acc. No. CAP71888). A comparison of the deduced 237 aa coat protein sequence revealed between 90 and 92% sequence identity with the coat proteins of TSV isolates from sunflower, cotton and a number of other crops in India (ABU55372, AY061928 and AF515824). The closest relationship (98% aa cp identity) of TSV from the Sudan was found with a TSV isolate from the ornamental Impatiens neuguinea (DSMZ PV-0909, origin unknown). An analysis of TSV isolates from legumes including Vicia faba revealed a 92% amino acid sequence identity with a soybean isolate from India (ABM 53 867) and only a distant relationship to a TSV soybean isolate from Brazil (AAQ 99 137, 83%). This shows a distinct geographic distribution of the TSV isolates from faba bean in Sudan. This is the first report of the natural occurrence of TSV in Vicia faba.

EFEITOS DA INTRODUÇÃO DO SISTEMA DE PLANTIO DIRETO DE MILHO POR AGRICULTORES FAMILIARES DO MUNICÍPIO DE UNAÍ, MG (CERRADO BRASILEIRO)

This paper evaluates the effects of the introduction of no-tillage systems (SPD) in rainfed maize grain production, by smallholders, under Cerrado conditions, in the region of Unai, Minas Gerais State, Brazil. The main constraints faced by farmers to produce are related to soil fertility management, difficulties in assessing tractors for preparing their land, and high levels of weed infestation. SPD was tested jointly with farmers trying to decrease these problems impacts. It showed promising results to stabilize, technically and economically, maize production. SPD solved completely the tractors dependency and contributed to decrease labour requirements for weed control. The production levels attained led to a better valorisation of the most scarce production factors, such as family labour and land. It was also evidenced the need to conduct more studies on the use of cover crops in those production systems. (Resume d'auteur)

Elevated female fecundity as a possible compensatory mechanism in response to trematode infestation in populations of Littorina saxatilis (Olivi)

Co-evolution between parasites and their hosts may lead to changes in the life-history traits of the host that promote sustainability of their populations despite parasite pressure. Such changes are expected to be especially pronounced in the host-parasite systems where parasites cause complete castration of their hosts. We have studied populations of the rough periwinkle, Littorina saxatilis, infested by castrating trematode species, in order to determine whether high infestation levels are associated with a compensatory increase in host fecundity. To test this hypothesis, we determined female fecundity in populations with trematode prevalence spanning from <1% to 30–75%, and followed long-term changes in female fecundity and trematode infestation in two heavily infested populations of L. saxatilis. The broad-scale geographic analysis of populations with different trematode burdens showed that fecundity of uninfected females is significantly higher in highly infested L. saxatilis populations than in those with low trematode burdens. This is also supported by a comparison of fecundity in two pairs of geographically adjacent populations with contrasting trematode levels, revealing higher fecundity of uninfected females in heavily infested populations. Higher fecundity could be explained by the larger size of uninfected females in some heavily infested populations but not in others. Long-term (15–20 years) intra-population analysis performed in two heavily infested L. saxatilis populations showed that female fecundity increased in parallel with a long-term increase in trematode prevalence from 20% to >75% in one population, but remained high and relatively stable in the second population, reflecting its consistently high trematode prevalence (40–65%). These data support the hypothesis that an increase in female fecundity may be a population compensation mechanism in response to heavy trematode infestation in L. saxatilis and suggest the possible involvement of both natural selection and fast (physiological) regulation mechanisms.

DANOS CAUSADOS POR PERCEVEJO-DE-RENDA NA PRODUÇÃO DE PARTE AÉREA E RAÍZES DE MANDIOCA

Esta pesquisa avaliou o dano provocado pelo percevejo-de-renda Vatiga illudens (Drake, 1922) (Hemiptera: Tingidae) na produtividade de raízes e da parte aérea em mandioca. Os experimentos foram conduzidos entre 1994 e 1997 na área experimental da Embrapa Cerrados, no município de Planaltina - DF. Utilizou-se o delineamento experimental de blocos ao acaso, com quatro repetições, em esquema de parcelas subdivididas. As parcelas foram constituídas pelas variedades e nas subparcelas, casualizadas dentro de cada bloco, foram testados os tratamentos sem controle e com controle químico do percevejo-de-renda, através de pulverizações quinzenais com inseticidas à base de monocrotofós, dimetoato e vamidotion. Os resultados revelaram que 1) elevados níveis de infestação de ninfas e de adultos do percevejo-de-renda reduziram a produtividade da parte aérea e das raízes em mandioca e 2) pulverizações com inseticidas resultaram em acréscimos de produção de raízes e parte aérea em mandioca.

MARKETING OF CHERIMOYA IN THE ANDES FOR THE BENEFIT OF THE RURAL POOR AND AS A TOOL FOR AGROBIODIVERSITY CONSERVATION

ISHS International Symposium on Underutilized Plants for Food Security, Nutrition, Income and Sustainable Development MARKETING OF CHERIMOYA IN THE ANDES FOR THE BENEFIT OF THE RURAL POOR AND AS A TOOL FOR AGROBIODIVERSITY CONSERVATION

Amblyomma variegatum Ticks and Heartwater on Three Caribbean Islands

Amblyomma variegatum tick infestation, tick infection by Ehrlichia ruminantium (ER), and ER genetic diversity were studied in the Caribbean Islands of Guadeloupe, Marie-Galante, and Antigua between 2003 and 2005. Nested PCR for pCS20 was used to detect ER, while ER strains were characterized by sequencing or by restriction fragment length polymorphism (RFLP) profiles of map-1 PCR products. In 2003 in Guadeloupe, the prevalence of tick-infested herds was 35.6%. In Marie-Galante 79.1% of herds in 2003 and 73.8% in 2005 were infested, while only an average of 2.2% of the herds were infected in Antigua between this same period. In Marie-Galante, 19.1% of ticks were ER positive, and ER-infected ticks were found in 33.3% of the herds. In Antigua only 5.8% of the ticks were ER positive. High ER tick infection rate combined with a very high level of tick infestation highlight the risk of heartwater in Marie-Galante and Guadeloupe more than in Antigua. The three islands still represent a reservoir for tick and heartwater in the Caribbean. Nine different African and Caribbean map-1 ER genotypes were identified. This diversity was observed even in restricted areas, and identical map-1 genotypes were observed on all three islands. This high genetic diversity of ER strains suggests that there was a simultaneous introduction of several strains from African countries into the Caribbean region.

Free proline accumulation in sugarcane under water restriction and spittlebug infestation

Mahanarva fimbriolata (Stål) (Hemiptera: Cercopidae) has become a key pest in the sugarcane (Saccharum officinarum) fields of center-south Brazil. Although some control technologies have shown to be efficient, the damage promoted by this spittlebug species and its interaction with sugarcane are poorly characterized. At high infestation levels the symptoms are similar to those of severe water restriction. This work was conducted to determine whether the stress promoted by spittlebug infestation can be measured in terms of free proline accumulation. The water restriction tolerance of two sugarcane genotypes was also compared. Two experiments were set up in a greenhouse and arranged in a completely randomized design in a 2 x 2 x 4 factorial, with two cultivars (SP80-1816 and RB72454), two stress levels (control and ten nymphs per plant or 50% water restriction), and four sampling dates. The water deficit caused by spittlebug nymphs sucking xylem sap does not result in proline accumulation, illustrating that there are different mechanisms to sense when the water deficit is caused by insect feeding or water potential variation in root cells. The cultivar RB72454 accumulates more free-proline, and the dry mass accumulation and stalk growth are less affected in this cultivar under water restriction. The levels of compatible solutes probably cannot be used to measure spittlebug infestation stress in sugarcane and RB72454 is more tolerant to water shortage than SP80-1816.

First detection of Varroa destructor resistance to coumaphos in Argentina

In Argentina, studies on Varroa destructor resistance to coumaphos are still unknown. At present, high infestation levels of V. destructor are being detected in colonies of Apis mellifera after treatment with this acaricide. The aim of the present study was to determine the LC50 of coumaphos in V. destructor from four apiaries with high mite density after treatment with coumaphos. The LC50's were 112, 319, 127 and 133 microg/Petri dish for mites from the four apiaries. Significant LC50 differences were detected between resistant and susceptible mites. LC50 increased 197-559-fold when compared to the corresponding baseline, suggesting the development of resistance. These results are the first report of resistance to coumaphos in V. destructor in Argentina.

Seasonal variation of ectosymbiotic ciliates on farmed and wild shrimps from coastal Yucatan, Mexico

High levels of ciliate infestation can affect respiration, feed intake, and locomotion in farmed shrimps in the tropics. Information on seasonal variation of the infestation parameters of ciliates is scarce, but it would be useful for determining the suitability of preventive measures or therapeutic treatment if necessary. This study aimed to describe the prevalence and mean intensity of infestation (MII) of ciliates on wild native shrimps Penaeus ( Farfantepenaeus) brasiliensis and P. ( Farfantepenaeus) duorarum and farm-cultured juvenile shrimp Penaeus ( Litopenaeus) vannamei over an annual cycle and to determine whether an association existed among physicochemical factors and infestation on cultured shrimp. The ectosymbiotic ciliates Acineta tuberosa, Epistylis sp., and Zoothamnium sp . infested both farmed and wild shrimps. Based on examination of 360 farmed specimens of P. vannamei (30 examined each month), the species with highest infestation were Epistylis sp., (prevalence range = 22–100%; MII range = 13 ± 28–126 ± 124) and Zoothamnium sp. (0–87%; 0–144 ± 132). For both species, the highest values occurred during the rainy season. A total of 288 wild specimens of P. brasiliensis plus 120 of P. duorarum obtained during three recognized seasons—dry (February to May), rainy (June to September), and north-wind (October to January)—had ciliate infestations that were significantly lower than those from farmed shrimp. For P. brasiliensis, the ciliate species with the highest infestation values were Zoothamnium sp. (0–66%; 0.03 ± 0.2–66 ± 92), while on P. duorarum, were for Epistylis sp. (0–46%; 0–8 ± 16). Using multiple linear regression, we found significant relationships between stocking density, survival, temperature, turbidity and intensity of infestation of the ciliates. However, the regression only accounted for 11–26% of the variance ( R 2), meaning that there are still other environmental and biological variables that should be included to increase the reliability of the model. Thus, the physicochemical conditions of the farm increase the probability of ciliate transmission, especially during the rainy season.

Temporal changes in distribution, prevalence and intensity of northern fowl mite ( Ornithonyssus sylviarum) parasitism in commercial caged laying hens, with a comprehensive economic analysis of parasite impact

Establishment and spread of Ornithonyssus sylviarum were documented through time on sentinel hens (50 per house of 28,000–30,000 hens) in the first egg production cycle of three large commercial flocks (12 houses) of white leghorn hens. Mites were controlled using acaricide, and the impacts of treatment on mite populations and economic performance were documented. Mite prevalence and intensity increased rapidly and in tandem for 4–8 weeks after infestation. Intensity declined due to immune system involvement, but prevalence remained high, and this would affect mite sampling plan use and development. Early treatment was more effective at controlling mites; 85% of light infestations were eliminated by a pesticide spray (Ravap), versus 24% of heavy infestations. Hens infested later developed lower peak mite intensities, and those mite populations declined more quickly than on hens infested earlier in life. Raw spatial association by distance indices (SADIE), incorporating both the intensity and distribution of mites within a house, were high from week-to-week within a hen house. Once adjusted spatially to reflect variable hen cohorts becoming infested asynchronously, this analysis showed the association index tended to rebound at intervals of 5–6 weeks after the hen immune system first suppressed them. Large, consistent mite differences in one flock (high vs. low infestation levels) showed the economic damage of mite parasitism (assessed by flock indexing) was very high in the initial stages of mite expansion. Unmitigated infestations overall reduced egg production (2.1–4.0%), individual egg weights (0.5–2.2%), and feed conversion efficiency (5.7%), causing a profit reduction of $0.07–0.10 per hen for a 10-week period. Asynchronous infestation patterns among pesticide-treated hens may have contributed to a lack of apparent flock-level economic effects later in the production cycle. Individual egg weights differed with mite loads periodically, but could be either higher or lower, depending on circumstances and interactions with hen weight. Individual hen weight gains were depressed by high/moderate mite loads, but the heavier hens in a flock harbored more mites. This led to compensatory weight gains after mites declined. Tradeoffs between resource allocation to body growth or production versus immune system function appeared to be operating during the early and most damaging mite infestation period, when high egg production was beginning and the hens were gaining weight. The results were related to other studies of mite impact on domestic hens and to wild bird–ectoparasite studies. Much of the mite economic damage probably is due to engaging and maintaining the immune response.

Effect of planting dates and maize hybrids on the infestation with sorghum shootfly, Atherigona soccata Rondani and its effect on the yield

Twenty maize hybrids plus local were tested for their susceptibility to major pests of sorghum shootfly, Atherigona soccata Rondani under field conditions at Sohag governorate during three planting dates (20th April, 20th May and 5th July) sown during two tested years (2004 and 2005 seasons). The investigation showed that when the sowing dates were considered irrespective of the different years or the maize hybrids it was evident that during the first planting date (20th April), the maize hybrids harboured the highest levels of infestation with sorghum shootfly, Atherigona soccata Rondani. The second planting date (20th May) was the least affected while the third planting date (5th July) received moderate levels of infestation. Results also showed that the average infestation of Atherigona soccata during both seasons was a significantly negative correlation affected by the sowing dates and maize hybrids. The yield of maize hybrids negatively correlated with percentage of infestation by Atherigona soccata. The highest yield obtained from the maize hybrids was slightly infested by Atherigona soccata and sown during the planting date of 20th May. Therefore, the second sowing date (20th May) may be recommended as a proper cultivating date for maize hybrids as it brought about reduction not only in infestation but was also a good method to reduce chemical control. Our results indicated that none of the maize hybrids evaluated were found to be resistant to Atherigona soccata attack but maize hybrids were significantly different in their susceptibility and less than of a local control to the infestation with Atherigona soccata and divided into four groups, the first one was highly susceptible including Giza Baladi; the second group was susceptible including ten maize hybrids namely, Hf 155, Bionear 3062, Bionear 30k8, Nagah 18, Watania 4, HC 326, HC 327, Nafratity, Watania 1 and Bionear; the third group was low resistance including six maize hybrids namely, Hf 122, Hf 123, Hf 129, Hc314, Hc 325 and Hc 352; while the fourth group included Hf 10, Hf 124, Hc 311and Hc 324 and moderately resisted the Atherigona soccata infestation. These may serve as a good material for growing in the areas where the pest is a problem.

Monitoring onion (Allium cepa) crops for onion thrips (Thrips tabaci) (Thysanoptera: Thripidae): Testing a commercial protocol

Onion thrips (Thrips tabaci) is the main insect pest on New Zealand onions (Allium cepa). Insecticide applications are triggered by thrips numbers exceeding action thresholds. A new crop monitoring protocol that involves sampling a minimum of 100 plants (up to 4 ha) or 25 plants/ ha, was tested in 10 young or mature onion crops. Two people independently sampled each crop by zigzagging up and down groups of onion beds defined by pairs of sprayer wheel tracks and selecting a plant at random at predetermined intervals along the crop beds. The number of thrips adults and larvae per plant was recorded. A strong relationship was found between total numbers of thrips and the percentage of plants infested. If the onion industry raised its spray action threshold from 0.1 thrips/plant to 2 or 3 thrips/plant (c. 50% plants infested), it could adopt presence‐absence sampling that would be faster than counting all thrips. The time to monitor a crop was affected by field size, and only increased slightly with higher levels of infestation. The new guidelines could also be used for monitoring disease and weeds.

Entwicklungszyklus, Bionomie und Populationsökologie der Apfelblattminiermotte, Stigmella malella (STAINTON, 1854). (Lepidoptera, Nepticulidae)

During the work on parasitoids of the apple leaf miner, Stigmella mallella, some parameters of the life history of the species could be ascertained. St. malella is bivoltine in the GDR. The adults fly from late April to mid-June and again during July-August. In the course of the last years it became a serious pest of commercial apple orchards. At this sites parasitization and larval mortality are only of minor importance. In this way the species gains a high reproductive success. Already in the subsequent generation a sudden pest outbreak can take place. A hypothesis is suggested to account for the way in which larval mortality is decreasing only in commercial apple orchards. The regular pesticide application against other apple pests prevents an exponentially population growth, but not the establishment of high infestation levels. Concerning bionomics data could be provided to the following parameters: developmental time of eggs, immature stages and pupae, number of instars, correlation of mine variability and leaf thickness, sex ratio, the circadian rhythm of adult emergence, mortality factors and their influence on population dynamics.

Interactions of sunflower ( Helianthus annuus) and sunflower broomrape ( Orobanche cumana) as affected by sowing date, resource supply and infestation level

The holoparasitic weed Orobanche cumana (sunflower broomrape) constrains sunflower ( Helianthus annuus) production in many countries. The development of efficient control strategies requires an understanding of the processes underlying the complex environment–host–parasite interrelations. Growth and development of O. cumana and sunflower were quantified under field conditions in southeastern Romania. Sunflower hybrid Florom 350 was sown at two dates, in plots infested with 0, 50, 200 and 1600 viable O. cumana seeds kg −1 dry soil, under low-input (rainfed, low nitrogen supply) and high-input (irrigated, high nitrogen supply) conditions. Sunflower shoot biomass reached peak values of 760–1287 g m −2 between the end of anthesis and physiological maturity. Seed yield varied from 221 to 446 g m −2. Sunflower biomass and yield were affected by all experimental factors. Seed yield responded positively to delaying sowing from early April to late May as well as to irrigation and fertilisation, and negatively to O. cumana infestation. Yield reductions, which were a product of reduced seed number and size, amounted to 13%, 25% and 37% at parasite seed densities of 50, 200 and 1600 viable seeds kg −1 soil, respectively. Maximum O. cumana attachment numbers, recorded in late-sown high-input crops in 2004, ranged from 11 m −2 in plots with 50 parasite seeds kg −1 soil to 188 m −2 with 1600 seeds kg −1 soil. Parasite attachment number was a function of crop sowing date, water and nutrient supply, seedbank density, and sunflower biomass and root length density, via mechanisms of parasite seed stimulation, host carrying capacity and intraspecific competition. Delayed sowing and improved water and nitrogen supply were associated with increases in parasite number that neutralised yield-boosting effects of irrigation and fertilisation at the highest infestation level. Sunflower shoot biomass was significantly reduced by O. cumana infection, with reductions affecting organs in the order head > stem > leaves. Most of the discrepancy between infected and non-infected plants was accounted for by O. cumana biomass. Parasites mainly acted as an extra sink for assimilates during sunflower generative growth and impaired host photosynthesis to a much lesser degree. Results suggest that similar mechanisms govern infection level and host–parasite biomass partitioning across different Orobanche–host systems.

DETERMINING THE OPTIMAL SPATIAL RESOLUTION OF REMOTELY SENSED DATA FOR THE DETECTION OF SIREX NOCTILIO INFESTATIONS IN PINE PLANTATIONS IN KWAZULU-NATAL, SOUTH AFRICA

ABSTRACT Sirex noctilio is causing considerable mortality in commercial pine plantations in KwaZulu-Natal, South Africa. The ability to remotely detect variable (for example, low, medium and high) S. noctilio infestation levels remains crucial for monitoring of the actual spread of the disease and for the effective deployment of suppression activities. Although high resolution image data can detect and monitor S.noctilio infestations there are no guidelines to the appropriate spatial resolutions that are suitable for detection and monitoring purposes. This study examines the use of minimum variance to analyze S. noctilio infestations in an effort to determine an optimal spatial resolution of remotely sensed data for forest health monitoring purposes. High resolution (0.5 m) image data was collected using a four band airborne sensor and infestation levels were derived using the normalized difference vegetation index (NDVI) and Gaussian maximum likelihood classifier. It was determined that the appropriate spatial resolution for the detection and monitoring of S.noctilio infestations as estimated by the minimum variance of sub samples narrowly differed based on the level of localized infestations present in the study area. Pixel sizes larger than 2.3 m will not provide adequate information for high infestation levels, while using pixel sizes smaller than the 1.75 m for detecting low to medium infestation levels will yield inappropriate results. The results of this study establish the necessary spatial resolution guidelines needed for the operational detection and monitoring of S.noctilio.

Amblyomma variegatum in cattle in Marie Galante, French Antilles: Prevalence, control measures, and infection by Ehrlichia ruminantium

We report Marie Galante as one of the Caribbean islands most heavily infested by the tropical bont tick (TBT) Amblyomma variegatum which is associated with two major diseases of ruminants: heartwater and dermatophilosis. In 2005, a survey was undertaken to assess the prevalence of TBT infestation in cattle, the prevalence of Ehrlichia ruminantium infection in TBTs, and the tick control measures implemented by livestock owners. A random sample of 195 cattle herds out of 1885 recorded on the island was investigated by thoroughly counting adult ticks on each animal and filling a questionnaire. A randomly collected sample of 136 TBTs was tested for infection by E. ruminantium by pCS20 nested PCR. Cattle herd prevalence (hp) was 73.8% for infestation by at least one TBT, 17.9% for infestation by at least one engorged female TBT, and 8.2% for clinical dermatophilosis. Cattle individual prevalence was 42.3% for infestation by at least one TBT, 6.6% for infestation by at least one engorged female TBT, and 2.2% for clinical dermatophilosis. The minimum, maximum and average numbers of TBTs per infested animal were, respectively 1, 108 and 11.5. Prevalence of TBT infection by E. ruminantium was 19.1%. No significant difference in herd prevalence was found among parishes or among ecological zones. For cattle owners treating against ticks (97.9% of all owners), all used aspersion of amitraz and herd prevalence was significantly different among those treating every 1–2-week (hp = 69.6%, n = 148), and less often than every 2-week (hp = 88.6%, n = 35) ( P = 0.031). Of the 42 herd subunits treated less than 4 days before the survey, 27 (64%) were infested with at least one TBT, and 6 (14%) with at least one engorged female TBT. These results indicate a high level of TBT infestation in Marie Galante, the inefficacy of tick treatments currently performed, and the need for an improved tick control strategy. Persisting high levels of infestation in Marie Galante threaten the success of on-going TBT eradication programs in the Caribbean because TBT can spread through migrating birds and trade of animals or of animal hides to other islands and potentially the American continent.

A Rapid Decision Sampling Plan for Implementing Area—Wide Management of the Red Palm Weevil,Rhynchophorus ferrugineus, in Coconut Plantations of India

The red palm weevil Rhynchophorus ferrugineus Olivier (Curculionidae/Rhynchophoridae/Dryophthoridae) is a lethal pest of young coconut palms, Cocos nucifera L. (Arecales: Arecaceae), with a highly aggregated population distribution pattern. R. ferrugineus is managed in several coconut growing countries using area-wide pheromone based programmes that need a substantial commitment of funds over a period of time. Often, decisions to implement area-wide management of R. ferrugineus are based on pheromone trap captures in surveillance traps and or infestation reports. Implementing area-wide management of this pest on the basis of such data can be inaccurate, as it may either under or over estimate the pest intensity in the field. This study presents sampling plans for rapid and accurate classification of R. ferrugineus infestation in coconut plantations of India by inspecting palms to detect infestation in a sequence until a decision to either implement or not to initiate area-wide management of R. ferrugineus can be made. The sampling plans are based on a common aggregation index of 3.45, assumed action threshold values of either 1.0 (plan A) or 0.5 (plan B) per cent infested palms and a risk factor of making the wrong decision set at 0.05. Using plans A and B, if the cummulative number of infested palms in a young 1 hectare coconut plantation is zero out of 150 palms for both plans, then area-wide management is not required, while on the other hand, if the cummulative number of infested palms for the same area is 6 (plan A), or 5 (plan B), then area-wide management of R. ferrugineus is essential. The proposed sampling plans are efficient tools in decision making, particularly at very low and high levels of infestation and can also be used to assess the performance of R. ferrugineus IPM programmes that are in progress. These plans not only save time and money as only a small area needs to be sampled to arrive at a correct decision, but are also efficient in rating the infestation level accurately.