Heteroduplex Single-strand Conformation Polymorphism Research Articles

Novel PITX2 Mutations including a Mutation Causing an Unusual Ophthalmic Phenotype of Axenfeld-Rieger Syndrome.

Purpose The aims of this study were to examine novel mutations in PITX2 and FOXC1 in Chinese patients with anterior segment dysgenesis (ASD) and to compare the clinical presentations of these mutations with previously reported associated phenotypes. Methods Twenty-six unrelated patients with different forms of ASD were enrolled from our paediatric and genetic eye clinic. The ocular manifestations of both eyes of each patient were recorded. Genomic DNA was prepared from venous leukocytes. All coding exons of PITX2 and FOXC1 were amplified by polymerase chain reaction (PCR) from genomic DNA and subjected to direct DNA sequencing. Analysis of mutations in control subjects was performed by heteroduplex single-strand conformation polymorphism (SSCP) analysis. Results Sequence analysis of the PITX2 gene revealed four mutations, including c.475_476delCT (P.L159VfsX39), c.64C > T (P.Q22X), c.296delG (P.R99PfsX56), and c.206G > A (P.R69H). The first three mutations were found to be novel. The c.475_476delCT (P.L159VfsX39) mutation, located at the 3′ end of the PITX2-coding region, was identified in a Chinese Axenfeld-Rieger syndrome (ARS) patient who presented with an unusual severe phenotype of bilateral aniridia. The clinical characteristics, including the severity and manifestations of the patient's phenotype, were compared with reported PITX2-associated aniridia phenotypes of ARS in the literature. Conclusions These results expand the mutation spectrum of the PITX2 gene in patients with ARS. The PITX2 gene may be responsible for a significant portion of ARS with additional systemic defects in the Chinese population. This is the first reported case of a mutation at the 3′ end of the PITX2-coding region extending the phenotypic consequences to bilateral aniridia. The traits of ARS could display tremendous variability in severity and manifestations due to the dominant-negative effect of PITX2. Our results further emphasize the importance of careful clinical and genetic analysis in determining mutation-disease associations and may lead to a better understanding of the role of PITX2 in ocular development.

CFTR Mutations Spectrum and the Efficiency of Molecular Diagnostics in Polish Cystic Fibrosis Patients

Cystic fibrosis (CF) is caused by mutations in the cystic fibrosis transmembrane regulator gene (CFTR). In light of the strong allelic heterogeneity and regional specificity of the mutation spectrum, the strategy of molecular diagnostics and counseling in CF requires genetic tests to reflect the frequency profile characteristic for a given population. The goal of the study was to provide an updated comprehensive estimation of the distribution of CFTR mutations in Polish CF patients and to assess the effectiveness of INNOLiPA_CFTR tests in Polish population. The analyzed cohort consisted of 738 patients with the clinically confirmed CF diagnosis, prescreened for molecular defects using INNOLiPA_CFTR panels from Innogenetics. A combined efficiency of INNOLiPA CFTR_19 and CFTR_17_TnUpdate tests was 75.5%; both mutations were detected in 68.2%, and one mutation in 14.8% of the affected individuals. The group composed of all the patients with only one or with no mutation detected (109 and 126 individuals, respectively) was analyzed further using a mutation screening approach, i.e. SSCP/HD (single strand conformational polymorphism/heteroduplex) analysis of PCR products followed by sequencing of the coding sequence. As a result, 53 more mutations were found in 97 patients. The overall efficiency of the CF allele detection was 82.5% (7.0% increase compared to INNOLiPA tests alone). The distribution of the most frequent mutations in Poland was assessed. Most of the mutations repetitively found in Polish patients had been previously described in other European populations. The most frequent mutated allele, F508del, represented 54.5% of Polish CF chromosomes. Another eight mutations had frequencies over 1%, 24 had frequencies between 1 and 0.1%; c.2052-2053insA and c.3468+2_3468+3insT were the most frequent non-INNOLiPA mutations. Mutation distribution described herein is also relevant to the Polish diaspora. Our study also demonstrates that the reported efficiency of mutation detection strongly depends on the diagnostic experience of referring health centers.

Characterization of MHC class II A genes in Hainan Eld’s deer (Cervus eldi hainanus)

The major histocompatibility complex (MHC) genes play pivotal roles in the immune system of vertebrates against antigens. They are also significant indicators of genetic structure, and are vital to species-level population viability analyses and disease risk assessments. In this study, two DRA and two DQA sequences were isolated from Hainan Eld’s deer (Cervus eldi hainanus) using rapid amplification of cDNA ends (RACE) and single-strand conformation polymorphism-heteroduplex (SSCP-HD) analysis. Nucleotide sequence analysis revealed large differences between the two DQA sequences, especially in their exon 2 regions, but only minimal differences between the variants of the DRA gene. Comparison of the predicted amino acid sequences of the Ceel-MHC class II A variants with those from six other species revealed that these molecules share high homology among ruminants. A phylogenetic tree of four class II A sequences from Hainan Eld’s deer and the other species placed the newly identified DQA and DRA genes on two distinct branches (100%-supportively), and further divided the two DQA sequences into 98%-supportive DQA1 and 99%-supportive DQA2 clusters, respectively. Therefore, this study identified monomorphic Ceel-DQA1 and Ceel-DQA2 genes, and one dimorphic Ceel-DRA gene from Hainan Eld’s deer.

Molecular analysis of Ceruloplasmin in a South African cohort presenting with oesophageal cancer

Oesophageal cancer (OC) is a disease characterized by the development of malignant tumors in the epithelial cells lining the oesophagus. It demonstrates marked ethnic variation, with squamous cell carcinoma (SCC) being more prevalent in the Black population and adenocarcinoma (ADC) occurring more often in Caucasians. The etiology of this complex disease has been attributed to a variety of factors, including an excess of iron (resulting in increased tumourigenesis), oesophageal injury and inflammation (due in part to Barrett's oesophagus and smoking among others). The aim of this study was to determine if genetic variations identified in the ceruloplasmin (CP) gene (implicated in iron homeostasis) contribute to OC pathogenesis or susceptibility. The study cohort consisted of 96 unrelated OC patients from the Black Xhosa-speaking South African population and 88 population-matched control individuals. The promoter and coding regions of the CP gene were analyzed for DNA sequence variation using heteroduplex single-strand conformation polymorphism (HEX-SSCP) analysis, restriction fragment length polymorphism (RFLP) analysis and semi-automated bidirectional DNA sequencing analysis. Fourteen previously described and four novel variants were identified. Statistically significant associations were revealed for two of the novel variants with OC in this study and could, therefore, potentially contribute to disease susceptibility. In silico analysis of the region of the promoter spanning the identified variants sought to identify putative transcription factor binding sites (TFBSs) that could possibly regulate the expression of CP. To our knowledge, this is the first study to examine CP with respect to OC in the Black South African population.

Chasing the ubiquitous RET proto-oncogene in South African MEN2 families - implications for the surgeon

The RET proto-oncogene (REarranged during Transfection; RET) plays an important role in the causation of many thyroid tumours. Germline RET proto-oncogene missense mutations have been clearly linked to medullary thyroid carcinoma (MTC) and the inherited cancer syndrome multiple endocrine neoplasia type 2 (MEN2A, MEN2B). We investigated a cohort of MEN2-related patients referred to Tygerberg Hospital, W Cape (2003-2009). The study cohort was divided into three groups based on pathology (viz. MEN/MTC, phaeochromocytoma, and a miscellaneous group of MEN pathologies). Families with identified high-risk factors were recalled. Serum calcitonin levels were monitored where indicated. DNA was extracted from whole blood by standard techniques and polymerase chain reaction (PCR) products screened for RET gene variations by heteroduplex single-strand duplication techniques (heteroduplex single-strand conformation polymorphism analysis) being validated with automated sequencing techniques showing conformational variants in acrylamide gel. We screened 40 persons, male/female ratio 1:1.5. Three ethnic groups were represented (white (12), black (11) and mixed race (17)). Nine were index MTC cases, 5 phaeochromocytoma, 3 Hirschsprung's disease-MEN associations and 2 miscellaneous (1 neuroblastoma, 1 intestinal neuronal dysplasia), while 1 fell into the MEN2B category. The remaining 19 were unaffected relatives screened for carrier status, among whom afamilial recurrence was observed in 7. On genetic testing, an RET point mutation at the high-risk 634 cysteine allele was identified in 11 cases. A further cysteine radical mutation at the 620 position was related to MEN2 in 3 families plus 1 other family referred from elsewhere. Other less-recognised gene variations were detected throughout the RET gene in 70% of cases and included the 691 position on codon 11 (11 cases); the 432 position (4 cases, 1 homozygous) intronic mutations on exon 4 (1 case); and an IVS19-37G/C and a D1017N variation in exon 19 in 2 MEN families. Fifteen MTC patients have had thyroidectomies, of which 2 were prophylactic (C-cell hyperplasia; early occult MTC). A further 3 are awaiting prophylactic surgery. RET gene mutation carries a risk of MEN2 and MTC in all ethnic groups in South Africa. Prophylactic surgery may prevent MTC, so genetic screening is important to identify and treat high-risk patients.

The ITGB2 immunomodulatory gene (CD18), enterocolitis, and Hirschsprung's disease

Hirschsprung's disease (HSCR)–associated enterocolitis (HAEC) remains a major contributor to morbidity and mortality associated with HSCR, being sometimes difficult to diagnose in its subclinical form. Its pathogenesis appears to include impaired local defense mechanisms as well as dysfunctional immune response and leukocyte function. In this context, the ITGB2 (CD18) immunomodulation-related gene is a possible candidate in HAEC pathogenesis as it codes for the β-subunit of leukocyte adhesion molecule lymphocyte function-associated antigen 1, which has an established role in T-cell development and function. ITGB2/CD18 has also been linked to chronic colitis in both human and animal models involving defense mechanisms within colonic mucosa. There is therefore a fairly compelling case for the potential involvement of the ITGB2 (CD18) in HAEC pathogenesis. Aim The aim of this study was to investigate the ITGB2 immunomodulatory gene (CD18) in a cohort of patients with HSCR and explore its correlation with enterocolitis. Patients and methods Screening for mutations of the ITGB2 (CD18) gene was performed on DNA extracted from colonic tissue samples and whole blood of 33 HSCR patients controlled by analysis of 60 unaffected individuals from the diverse South African population. Polymerase chain reaction amplification was performed, followed by heteroduplex single-strand conformation polymorphism analysis and bidirectional semiautomated DNA sequencing analysis. Results Heteroduplex single-strand conformation polymorphism banding patterns of the ITGB2 gene showed variations in 22 HSCR patients (66%), 13 of whom had severe episodes of HAEC, and 6 others had milder symptoms. Of the 13, 6 (46%) had Down's syndrome–associated HSCR. Genetic variations included 1 mutation (D77N), 2 known (V367, V441), and 4 novel polymorphisms (−111T/C, 24G/T, 295G/A, 892A/G). Significant associations were identified in the exon 5′ untranslated promotor region ( P < .0001), exon 10 ( P < .0007), and the 3′ untranslated promotor region at 122G/A ( P < .0001) and 370 G/T positions ( P = .04). Those regions of the gene most frequently associated with HAEC and severe symptoms were those with more than 1 variant identified in the gene. Conclusions This study shows that impaired CD18 leukocyte and T regulatory cell regulation can probably be linked to a genetic ( ITGB2) predisposition to HAEC. It furthermore provides a possible genetic link to HAEC patient selection, identifying a potential molecular target.

Six novel mutations of the ADAR1 gene in patients with dyschromatosis symmetrica hereditaria: Histological observation and comparison of genotypes and clinical phenotypes

Dyschromatosis symmetrica hereditaria (DSH), is a pigmentary genodermatosis of autosomal dominant inheritance. Since we clarified that the disease is caused by a mutation of the adenosine deaminase acting on the RNA 1 gene (ADAR1) in 2003, the molecular pathogenesis of a peculiar clinical feature of the disease has been expected to be clarified. We examined five familial cases and one sporadic case of Japanese families with DSH. The mutation analyses were done with single-strand conformation polymorphism/heteroduplex (SSCP/HD) analysis and direct sequencing of ADAR1. The DNA analysis of each patient revealed one missense mutation (p.F1091S), two nonsense mutations (p.C893X, p.S581X) and three frame-shift mutations (p.E498fsX517, p.F1091fsX1092, p.L855fsX856). Visual and electron microscopic findings showed abundant melanin pigment deposited all over the basal layer, and enlarged melanocytes with long dendrites located in the pigmented lesions with small or immature melanosomes scattered sparsely in the cytoplasm, but in the adjacent keratinocytes many small melanosomes were singly dispersed or aggregated. The hypopigmented areas showed little melanin deposition and reduced numbers of melanocytes in which much degenerative cytoplasmic vacuole formation could be observed by electron microscopy. Herein, we report six cases of DSH with six novel mutations. The variety of their clinical phenotypes even in the pedigree may suggest the presence of factors other than the ADAR1 gene influencing the extent of the clinical skin lesion. Microscopic findings suggest that the clinical appearance must have developed directly by melanocyte variations mainly induced by the ADAR1 gene mutations.

Association of endothelin-β receptor (EDNRB) gene variants in anorectal malformations

Animal models have demonstrated the role of genetic influences in anorectal malformations (ARM), although the pathogenetic mechanism remains uncertain. A body of collateral evidence points to possible connection with the endothelin-β receptor (EDNRB) gene and the endothelin system. This study investigates the EDNRB gene in patients with ARM. Resected surgical specimens of terminal colonic tissue were obtained from 14 children (6 males and 8 females) undergoing surgery for ARM correction with ethical permission. DNA samples were screened for mutations in EDNRB. Polymerase chain reaction amplification of 7 exons of EDNRB was followed by heteroduplex single-strand conformation polymorphism analysis. Heteroduplex single-strand conformation polymorphism variants were validated with automated sequencing techniques on polymerase chain reaction products showing conformational variants in acrylamide gel. All investigated patients with ARM showed mobility shift aberrations and polymorphisms in the EDNRB gene. These included one previously described polymorphism in exon 4 (831G/A) seen in association with Hirschsprung disease and 6 novel polymorphisms identified in exons 1 (178G/A), 2 (552C/T and 561C/T), and 3 (702C/T). No aberrant banding patterns were observed. The exon 1 (178 G/A) variation was identified in 2 (50%) of 4 low lesions compared with 1 (1%) of 84 control samples. The exon 3 (702C/T) single nucleotide polymorphism was present in 3 (60%) of 5 of the supralevator lesions being associated with exon 4 (831G/A). The patient with VATER associations including cardiac and limb anomalies had the 831G/A variation only. Analysis revealed statistically significant differences for the polymorphism 178G/A ( P < .01, χ 2 with Yates correction = 8.24) compared to controls. Potential disease-related mutations were identified in South African patients with ARM, raising the question of its potential role in the pathogenesis of this condition.

Familial medullary carcinoma prevention, risk evaluation, and RET in children of families with MEN2

The ability to predict the risk of MEN2 and medullary thyroid carcinoma (MTC) by genetic RET proto-oncogene analysis has provided an essential tool in identifying patients in whom thyroid cancer can be prevented by prophylactic thyroidectomy but emphasizes the need for clear policy guidelines. Children of families with RET cysteine mutations (exons 10, 11, 13, and 16) may develop early metastatic tumours and require prophylactic thyroidectomy. The 918 mutation associated with MEN2B is associated with early aggressive behaviour and distant metastatic spread. This has led to active screening of affected families underlining the need for specific intervention strategies. Aim To evaluate the risk to children of families with MEN2 and to assess the risk and determine the treatment. Methods Twenty-five patients from 10 families with MEN2 phenotypes were screened for RET mutations. Polymerase chain reaction amplification was performed on all 21 exons of the RET proto-oncogene, followed by heteroduplex single-strand conformation polymorphism (HEX-SSCP) analysis. Polymerase chain reaction products demonstrating variation in the HEX-SSCP gels were subjected to automated DNA sequencing analysis. Results Eleven significant RET mutations were detected in affected families. Eight index cases received initial thyroidectomy for established MTC (plus 2 advised). In the family members screened, 3 prophylactic thyroidectomies (2 with early MTC) were performed and a further 2 recommended. An exon 10 C620W missense mutation (the “Janus” gene) was detected in a patient with Hirschsprung's disease plus 1 family member. Conclusion RET analysis of MEN has revolutionized the management of children of families with MEN2 and allowed surgical prediction and prophylaxis to take place. The presence of an exon 10 C620W mutation in association with Hirschsprung's disease was difficult to assess. We suggest possible guidelines for management of families with MTC and the role of genetic testing in their evaluation.

Application of Multiplex ARMS and SSCP/HD Analysis in Molecular Diagnosis of Cystic Fibrosis in Indian Patients

Cystic fibrosis (CF) is an autosomal recessive disorder caused by mutations in the CFTR gene. The most severe, DeltaF508, mutation accounts for nearly 70% of CF cases worldwide. Besides DeltaF508, there are other point mutations, namely G542X, G551D, R553X, N1303K, and 621+1(G-->T), which are common among Caucasians. Additionally, a polyT polymorphism in intron 8 is also involved in the pathogenesis of CF. However, neither the prevalence nor the types of mutations causing CF in India are known. In this study, we aimed at estimating the frequency of the above common mutations and polymorphism in clinically suspected CF cases. We also carried out partial analysis of the CFTR gene, limited to exons 10 and 11, to identify other variations in these exons. The multiplex amplification refractory mutation system (ARMS) test was applied for rapid simultaneous analysis of six most common CF mutations, in 100 normal and 39 elevated sweat chloride cases. The scanning of exons 10 and 11 was carried out by single-stranded conformation polymorphism/heteroduplex (SSCP/HD) analysis, followed by DNA sequencing in 50 normal and 37 elevated sweat chloride cases. A single ARMS-polymerase chain reaction assay was used to distinguish the 5T, 7T, and 9T alleles in 100 normal and 33 elevated sweat chloride cases. The multiplex ARMS analysis identified the DeltaF508 mutation at an allele frequency of 24% in Indian CF cases. However, the other predominant CF mutations were found to be absent. The 7T polyT variant was observed to be the most common allele, followed by the 9T, and 5T, which was the lowest. The DeltaF508 mutation was observed in all instances with the 9T variant. The SSCP/HD and DNA sequencing additionally revealed a known polymorphism (M470V, exon 10) and a known mutation [1525-1(G-->A), intron 9]. The 1525-1(G-->A) mutation, observed in a single 4-year-old male, is predicted to code for a class II defective CFTR protein. The findings of this study suggest a difference in relative frequencies and spectrum of CFTR mutations in Indian CF cases. A larger screening study of the entire CFTR gene in clinically well defined CF cases is required to delineate common mutations in the CFTR gene and enable molecular diagnosis of CF in India.

The val 606met mutation in the cardiac beta-myosin heavy chain gene in patients with familial hypertrophic cardiomyopathy is associated with a high risk of sudden death at young age

F hypertrophic cardiomyopathy (FHC) is a phenotypically and genetically heterogenous myocardial disease with an autosomal dominant pattern of inheritance. FHC is a frequent cause of sudden death in young people. Knowledge of morbidity and mortality associated with different mutations in the different sarcomere genes associated with FHC may prove to be of importance for clinical decisions concerning treatment, thus, leading to improved patient management. Hence, based on genotype-phenotype analyses, mutations in the MYBPC3 encoding the cardiac myosin-binding protein C gene have generally been associated with a low morbidity and mortality early in life.1 Mutations in the TNNT2 gene encoding cardiac troponin T have been associated with a high incidence of sudden death at young age,2,3 whereas the prognosis associated with different mutations in the MYH7 gene encoding the cardiac b-myosin heavy chain (bMHC) have been more variable.2 FHC families often have their own “private” mutation, and the prognosis of FHC may vary between, as well as within, families with the same mutation, thereby compromising the value of the genotyping. The ValMet mutation is often presented as the prototype of a “benign” MYH7 gene mutation.4–7 We report the unfavorable prognosis in a family with FHC associated with the ValMet mutation in the MYH7 gene and provide cumulated data on the incidence of sudden death at young age based on the present and previously published studies. • • • From a consecutive cohort of 70 families with FHC, family JO of Danish origin was included in the present study at the The Heart Center, Rigshospitalet, University of Copenhagen. After informed consent was given (Local Science Ethics Committee, Copenhagen. Protocol No. KF V92213), patient and family histories were obtained, and physical examination, electrocardiography, and transthoracic echocardiography were performed. The clinical diagnosis of FHC in relatives was based on: (1) electrocardiographic criteria: pathologic Q-waves or signs of left ventricular hypertrophy,8,9 and/or (2) echocardiographic criteria: a maximal left ventricular wall thickness of $13 mm,8,9 in the absence of evidence of other specific heart muscle diseases.10 For family members with disease, clinical records, family histories, or both were obtained whenever available. The clinical diagnosis was made before molecular genetic analysis. Blood samples were collected from probands and family members. Genomic DNA was extracted using a QIAamp DNA purification kit (Qiagen, Hilden, Germany). Mutation analysis of the MYH7 gene was performed using single-strand conformation polymorphism-heteroduplex (SSCP-HD) formation analysis on exons 3–23.11 Specifically for exon 16 the primers were 16F, GTGATGCTCTCTCCTGCTTCCTCA, and 16R, CCGGGAGCCTCAGTCCCTACTT. DNA preparations from 100 randomly selected Guthriecards were used as controls (Local Science Ethics Committee, Copenhagen. Protocol No. 01 to 119/99). Nucleotide sequence determination was performed by cycle sequencing using a Dye Deoxy Terminator Cycle Sequencing kit (Perkin Elmer, Foster City, California) on an ABI373 DNA sequencer (Perkin Elmer). The presently reported family, JO, were also screened for mutations in 7 other cardiac sarcomere genes known to be associated with FHC. The pedigree of family JO is shown in Figure 1. The proband (V:1, 45 years of age) was diagnosed at the age of 15 years. His previously asymptomatic son (VI:1) died suddenly at the age of 14 years. Postmortem examination confirmed the diagnosis of severe hypertrophic cardiomyopathy. The family history revealed 2 additional sudden deaths at young age (I:1 before 30 years of age and IV:1 at the age of 16 years). No additional information concerning these deaths was available. The proband’s sister (V:3, 40 years of age) has FHC, but only with few symptoms, despite pronounced septal hypertrophy and atrial fibrillation. Neither the proband’s mother nor father was available for inclusion in the study. The proband’s 2 daughters (VI:2, 23 years of age and VI:3, 16 years of age) both developed FHC during adolescence. Reports of syncope, nonsustained ventricular tachycardia on Holter monitoring, or abnormal blood pressure response during exercise, and the present family history, led to From the Department of Medicine B, The Heart Centre, Rigshospitalet, University of Copenhagen; and Department of Clinical Biochemistry, Statens Serum Institut, Copenhagen, Denmark. The study was supported by grants from The Danish Heart Foundation; The “Kong Christian den Tiendes Fond”; The Novo Nordisk Foundation; Director Emil C. Hertz and Inger Hertz’s Foundation; Danish Medical Association Research Foundation; and H:S—Copenhagen Hospital Corporation, Copenhagen, Denmark. Dr. Christiansen’s address is: Department of Clinical Biochemistry, Statens Serum Institut, 5 Artillerivej, DK-2300 S., Copenhagen, Denmark. E-mail: mic@ssi.dk. Manuscript received October 8, 2000; revised manuscript received and accepted December 28, 2000.

Gain of chromosome arm 17q is associated with unfavourable prognosis in neuroblastoma, but does not involve mutations in the somatostatin receptor 2(SSTR2) gene at 17q24.

Deletion of chromosome arm 1p and amplification of the MYCN oncogene are well-recognized genetic alterations in neuroblastoma cells. Recently, another alteration has been reported; gain of the distal part of chromosome arm 17q. In this study 48 neuroblastoma tumours were successfully analysed for 17q status in relation to known genetic alterations. Chromosome 17 status was detected by fluorescence in situ hybridization (FISH). Thirty-one of the 48 neuroblastomas (65%) showed 17q gain, and this was significantly associated with poor prognosis. As previously reported, 17q gain was significantly associated with metastatic stage 4 neuroblastoma and more frequently detected than both deletion of chromosome arm 1p and MYCN amplification in tumours of all stages. 17q gain also showed a strong correlation to survival probability (P = 0.0009). However, the most significant correlation between 17q gain and survival probability was observed in children with low-stage tumours (stage 1, 2, 3 and 4S), with a survival probability of 100% at 5 years from diagnosis for children with tumours showing no 17q gain compared to 52.5% for those showing 17q gain (P = 0.0021). This suggests that 17q gain as a prognostic factor plays a more crucial role in low-stage tumours. Expression of the somatostatin receptor 2 (SSTR2), localized in chromosome region 17q24, has in previous studies been shown to be positively related to survival in neuroblastoma. A point mutation in the SSTR2 gene has earlier been reported in a human small-cell lung cancer. In this study, mutation screening of the SSTR2 gene in 43 neuroblastoma tumours was carried out with polymerase chain reaction-based single-stranded conformation polymorphism/heteroduplex (SSCP/HD) and DNA sequencing, and none of the tumours showed any aberrations in the SSTR2 gene. These data suggest that mutations in the SSTR2 gene are uncommon in neuroblastoma tumours and do not correlate with either the 17q gain often seen or the reason some tumours do not express SSTR2 receptors. Overall, this study indicates that gain of chromosome arm 17q is the most frequently occurring genetic alteration, and that it is associated with established prognostic factors. © 1999 Cancer Research Campaign

A single strand conformation polymorphism/heteroduplex (SSCP/HD) method for detection of mutations in 15 exons of the KVLQT1 gene, associated with long QT syndrome

Congenital long QT syndrome (LQTS) is characterised by prolongation of the QT interval on ECG and cardiac arrhythmias, syncopes and sudden death. A rapid and reliable genetic diagnosis of the disease may be of great importance for diagnosis and treatment of LQTS. Mutations in the KVLQT1 gene, encoding a potassium-channel subunit of importance for the depolarisation of cardiac myocytes, is believed to be associated with 50% of all LQTS cases. Our data confirms that KvLQT1 isoform 1 is encoded by 16 exons, and not 15, as reported previously. We have used genomic DNA sequences to design intronic PCR primers for amplification of 15 exons of KVLQT1 and optimised a non-radioactive single stranded conformation polymorphism/heteroduplex (SSCP/HD) method for detection of mutations in KVLQT1. The sensitivity of the method was 100% when it was tested on 15 in vitro constructed mutants. By multiplexing the PCR amplification of KVLQT1, it is possible to cover all 15 exons in four PCR reactions.

Molecular analysis reveals a high mutation frequency in the first untranslated exon of the PPOX gene and largely excludes variegate porphyria in a subset of clinically affected Afrikaner families

A subset of probands from 11 South African families with clinical and/or biochemical features of variegate porphyria (VP), but without the known protoporphyrinogen oxidase (PPOX) gene defects identified previously in the South African population, were subjected to mutation analysis. Disease-related mutation(s) could not be identified after screening virtually the entire PPOX gene by heteroduplex single-strand conformation polymorphism analysis (HEX-SSCP), although three new sequence variants were detected in exon 1 of the gene in three normal controls. The presence of these single base changes at nucleotide positions 22 (C/G), 27 (C/A) and 127 (C/A), in addition to the known exon 1 polymorphisms I-26 and I-150, indicates that this untranslated region of the PPOX gene is particularly mutation-prone. Furthermore, microsatellite markers flanking the PPOX and alpha-1 antitrypsin (PI) gene, on chromosomes 1 and 14, respectively, were used to assess the probability of involvement of these loci in disease presentation. Common alleles transmitted from affected parent to affected child were determined where possible in the mutation-negative index cases. Allelic frequencies of these «disease-associated» alleles were compared to findings in the normal population, but no predominant disease-associated allele could be identified. Co-segregation of a specific haplotype with the disease phenotype could also not be demonstrated in a large Afrikaner family. It is concluded that further studies are warranted to determine the genetic factor(s) underlying the autosomal dominant pattern of inheritance in molecularly uncharacterized cases showing clinical symptoms of an acute porphyria.

Mutation analysis in familial hypercholesterolemia patients of different ancestries: identification of three novel LDLR gene mutations

Twelve familial hypercholesterolemia (FH) patients of different ancestries living in South Africa were subjected to mutation analysis of the low-density lipoprotein receptor (LDLR) gene. Nine different mutations were identified in 10 patients. Six of these, including the founder-related mutation C660X identified in two Lebanese patients, have previously been described in other FH patients with compatible genetic backgrounds, and/or in patients originating from countries where admixture is not uncommon. Characterization of an abnormal electrophoresis pattern detected in exon 4 of the LDLR gene by heteroduplex single-strand conformation polymorphism (HEX-SSCP) analysis, revealed a novel G deletion at codon 185 (617delG) which resulted in a downstream stop codon. Two of the new mutations identified resulted in amino acid substitutions and were designated R57C and Q357P.

Novel stop mutation causing familial hypercholesterolemia in a Costa Rican family

Combined heteroduplex single-strand conformation polymorphism (HEX-SSCP) analysis of the promoter and coding region of the low density lipoprotein receptor (LDLR) gene revealed a novel C to T mutation at nucleotide position 2056 in a Costa Rican patient with heterozygous familial hypercholesterolemia (FH). This nonsense mutation, Q665X, results in a termination codon in the epidermal growth factor (EGF) precursor homology domain of the mature LDLR.