Hengyang City Research Articles

Impact of Community Proactive Health Management Application on Electronic Health Literacy and Self-Management of Hypertensive Patients.

Investigating the impact of the Community Proactive Health Management Application on electronic health literacy, self-management level, and blood pressure in hypertensive patients within the community. Between September and November 2020, two communities in Hengyang City, Hunan Province, China were selected as the intervention and control groups using convenience sampling. Subsequently, 30 hypertensive patients from each of the two communities were randomly selected to participate as study subjects. The control group patients received foundational hypertension management, whereas the intervention group received additional care through the Community Proactive Health Management Application. Following a 3-month period, the intervention group exhibited significantly higher total scores (t=2.193, p=0.032) and application dimension scores (t=2.605, p=0.012) for electronic health literacy compared to the control group. The total scores of electronic health literacy scale for both the intervention (t=-5.671, p<0.001) and control (t=-3.613, p=0.001) groups were higher after the intervention compared to before. The total score of the self-management scale (t=3.872, p<0.001), as well as the scores for the treatment management (t=6.580, p<0.001) and habit management dimensions (t=2.315, p=0.024) of hypertensive patients in the intervention group, were significantly higher than those in the control group. The self-management scores of both groups of hypertensive patients showed a significant increase compared to preintervention levels (intervention group t=-14.391, p<0.001; control group t=-6.584, p<0.001). The intervention group exhibited a statistically significant decrease in systolic blood pressure compared to the control group (Z=-2.036, p=0.042). Following the intervention, both groups exhibited a significant reduction in systolic and diastolic blood pressure levels compared to preintervention levels (all p<0.001). The Community Proactive Health Management Application has the potential to enhance the electronic health literacy and self-management capabilities of hypertensive patients, enabling them to engage in better health management, reduce hypertension levels, and elevate their overall quality of life.

An improvement on the assessment of ecosystem services value of urban wetlands under consideration of water yield at regional scale.

Urban wetlands are gaining more attention and showing more important play in the sustainability. Surge findings are attached on the assessment of Wetland Ecosystem Service Value (WESV) in urban areas. While determining WESV in urban areas, it is still difficult to capture the nature of wetlands due to neglecting the impact of related impervious surfaces. It is necessary to improve the existing evaluating methods of WESV when seeking the truth. In order to narrow this issue, based on InVEST model, this study employed Equivalent Factors (EF) to determine WESV in urban areas with a case of Hengyang City, China. The main materials of this study included high-resolution images, DEM, precipitation, evapotranspiration, soil, vegetation, and statistical yearbook of the case. By comparing the uncorrected results with precipitation corrected and water yield corrected results of WESV, this study confirmed that: (1) the corrected results can reflect more real status than uncorrected; (2) in terms of EF, the water yield factor is more conducive to finding the truth than precipitation. Through this study, the water yield factor can effectively reduce the adverse effects of climate and improve the accuracy when determining WESV in urban areas.

The Impact of Aerobics on Chinese Women's Psychological Health and Well-Being

The researcher aimed to assess the impact of aerobics participation on the psychological health and well-being of Chinese female students, focusing on their mental health, quality of life, self-esteem, body image, mood states, sense of belonging, and coping strategies. The study examined the respondents' profiles, including age, length of engagement, and course, to determine if these factors influenced their assessments. Additionally, it explored challenges in maintaining a regular aerobic exercise routine, the long-term psychological benefits anticipated from continued participation, and proposed a Wellness Initiative Program based on the findings. The study utilized the Descriptive research design employing both quantitative and qualitative methods of research and utilized 332 Chinese college students who are enrolled in Hengyang Normal University in Hengyang City, Hunan Province, must be enrolled this SY 2023-2024, and must be a female student who participated or enrolled in aerobics. The study revealed that young adults, mainly from the Chinese Language and Literature department, benefited from aerobics in terms of mental health and self-esteem, with older participants and those engaged longer seeing greater effects. The study recommends a Wellness Initiative Program through aerobics to improve women’s psychological health and well-being.

Systematic study of cluster radioactivity in trans-lead nuclei with various versions of proximity potential formalisms* *Supported in part by the National Natural Science Foundation of China (12175100, 11975132), the construct program of the key discipline in Hunan province, the Research Foundation of Education Bureau of Hunan Province, China (18A237, 22A0305), Hunan Provincial Department of Education Scientific Research Project (19A440), the

In this study, based on the framework of the Coulomb and proximity potential model (CPPM), we systematically investigate the cluster radioactivity half-lives of 26 trans-lead nuclei by considering the cluster preformation probability, which possesses a simple mass dependence on the emitted cluster according to R. Blendowske and H. Walliser [Phys. Rev. Lett. 61, 1930 (1988)]. Moreover, we investigate 28 different versions of the proximity potential formalisms, which are the most complete known proximity potential formalisms proposed to describe proton radioactivity, two-proton radioactivity, α decay, heavy-ion radioactivity, quasi-elastic scattering, fusion reactions, and other applications. The calculated results show that the modified forms of proximity potential 1977, denoted as Prox.77-12, and proximity potential 1981, denoted as Prox.81, are the most appropriate proximity potential formalisms for the study of cluster radioactivity, as the root-mean-square deviation between experimental data and relevant theoretical results obtained is the least; both values are 0.681. For comparison, the universal decay law (UDL) proposed by Qi et al. [Phys. Rev. C 80, 044326 (2009)], unified formula of half-lives for α decay and cluster radioactivity proposed by Ni et al. [Phys. Rev. C 78, 044310 (2008)], and scaling law (SL) in cluster radioactivity proposed by Horoi et al. [J. Phys. G 30, 945 (2004)] are also used. In addition, utilizing CPPM with Prox.77-12, Prox.77-1, Prox.77-2, and Prox.81, we predict the half-lives of 51 potential cluster radioactive candidates whose cluster radioactivity is energetically allowed or observed but not yet quantified in NUBASE2020. The predicted results are in the same order of magnitude as those obtained using the compared semi-empirical and/or empirical formulae. At the same time, the competition between α decay and cluster radioactivity of these predicted nuclei is discussed. By comparing the half-lives, this study reveals that α decay predominates.

Thermal comfort of students in naturally ventilated secondary schools in countryside of hot summer cold winter zone, China

People experience four seasons every year, and their thermal comfort usually changes with the season. However, a little is known about the dynamic characteristics of secondary students’ thermal comfort in the countryside under different seasons. This study aims to investigate thermal comfort of students in the countryside under various seasons and reveal the underlying mechanism. One year long-term field study was conducted in a countryside secondary school in Hengyang City, located in the hot summer and cold winter zone of China. A paper questionnaire was used to collect subjective thermal comfort. The surrounding physical environment was also measured. A total of 450 subjects voluntarily participated and returned 2349 valid datasets. The results indicated students had the lowest acceptance rate with temperature (71.9 %), humidity (74.9 %), and velocity (70 %) in summer season. Neutral temperature was 25.7 °C in summer, 19.2 °C in transition, and 14.9 °C in the winter. An inverted U relationship was found between perceived air quality and air temperature. Cold extremities (53.0 %), shivering (37.2 %), and stuffy nose (60.4 %) were prevalent in winter. Adaptive comfort model was only effective in the summer in naturally ventilated secondary school buildings. Estimated learning performance was the highest in transition and lowest in summer. Behavioral adaptation was determined by the relationship between air velocity clothing insulation and operative temperature. The findings of this study provide fundamental knowledge of thermal environment, subjective comfort, and health status in naturally ventilated educational buildings in countryside area. Engineers and designers can use professional comfort indicators to guide their future construction or renovation.

Spatiotemporal analysis of tuberculosis in the Hunan Province, China, 2014-2022.

Pulmonary tuberculosis (PTB) is a major infectious disease that threatens human health. China is a high tuberculosis-burden country and the Hunan Province has a high tuberculosis notification rate. However, no comprehensive analysis has been conducted on the spatiotemporal distribution of PTB in the Hunan Province. Therefore, this study investigated the spatiotemporal distribution of PTB in the Hunan Province to enable targeted control policies for tuberculosis. We obtained data about cases of PTB in the Hunan Province notified from January 2014 to December 2022 from the China Information System for Disease Control and Prevention. Time-series analysis was conducted to analyze the trends in PTB case notifications. Spatial autocorrelation analysis was conducted to detect the spatial distribution characteristics of PTB at a county level in Hunan Province. Space-time scan analysis was conducted to confirm specific times and locations of PTB clustering. A total of 472,826 new cases of PTB were notified in the Hunan Province during the 9-year study period. The mean PTB notification rate showed a gradual, fluctuating downward trend over time. The number of PTB notifications per month showed significant seasonal variation, with an annual peak in notifications in January or March, followed by a fluctuating decline after March, reaching a trough in November or December. Moran's I index of spatial autocorrelation revealed that the notification rate of PTB by county ranged from 0.117 to 0.317 during the study period, indicating spatial clustering. The hotspot areas of PTB were mainly concentrated in the Xiangxi Autonomous Prefecture, Zhangjiajie City, and Hengyang City. The most likely clustering region was identified in the central-southern part of the province, and a secondary clustering region was identified in the northwest part of the province. This study identified the temporal trend and spatial distribution pattern of tuberculosis in the Hunan Province. PTB clustered mainly in the central-southern and northwestern regions of the province. Disease control programs should focus on strengthening tuberculosis control in these regions.

基于MSPA模型和电路理论的衡阳市主城区热环境空间网络构建

基于MSPA模型和电路理论的衡阳市主城区热环境空间网络构建

Development and Validation of Subsyndromal Delirium Prediction Model in Patients With Advanced Malignant Tumor: A Case-Control Study.

Subsyndromal delirium (SSD) is a clinical manifestation between delirium and nondelirium. There is no established guideline for diagnosing SSD, with a few different tools used for diagnosis. To construct and verify the risk prediction model for subdelirium syndrome in patients with advanced malignant tumors and explore its application value in risk prediction. A total of 455 patients admitted to the Oncology Department in a tertiary grade A hospital in Hengyang City were recruited from December 2020 to May 2021. They were selected as the modeling group. The model was constructed by logistic regression. A total of 195 patients with advanced malignant tumors from June 2021 to July 2021 were selected to validate the developed model. The predictors incorporated into the model were opioids (odds ratio [OR], 1.818), sleep disorders (OR, 1.783), daily living ability score (OR, 0.969), and pain (OR, 1.810). In the modeling group, the Hosmer-Lemeshow goodness-of-fit test was P = .113, the area under the receiver operating characteristic curve was 0.884, the sensitivity was 0.820, and the specificity was 0.893. In the validation group, the Hosmer-Lemeshow goodness-of-fit test P = .108, the area under the receiver operating characteristic curve was 0.843, the Yuden index was 0.670, the sensitivity was 0.804, and the specificity was 0.866. This model has excellent precision in the risk prediction of subdelirium in patients with advanced malignant tumors. The model we developed has a guiding significance for specialized tumor nurses to care for patients with advanced malignant tumors and improve their quality of life.

Exploration of ecological environment construction and development paths in towns and cities by applying time series data

Abstract This paper explores the interaction mechanism between urbanization and the ecological environment based on the unique correlation between urbanization and the ecological environment. BISE and Savizky-Golay algorithms are combined to establish the time series data, and for the characteristic curves of the EVI time response of the land cover, the spectral angle mapping method is combined with the minimum distance method to form the spectral angle-minimum distance classification method. The application of time series data involves calculating the time and spatial change of urban land cover and analyzing the evolution of urban ecological environment elements. Based on the temporal and spatial consistency test and land cover analysis of urban ecological environment construction, as well as the development of urbanization construction, relevant development paths are proposed. The comprehensive score of new urbanization in the four districts and one city of Hengyang City is concentrated towards 1.6, indicating that the level of economic development and the construction of new urbanization have reached coupling at different levels, respectively.

Investigating the Identification and Spatial Distribution Characteristics of Camellia oleifera Plantations Using High-Resolution Imagery

Camellia oleifera is a vital economic crop of southern China. Accurate mapping and monitoring of Camellia oleifera plantations are essential for promoting sustainable operations within the Camellia oleifera industry. However, traditional remote sensing interpretation methods are no longer feasible for the large-scale extraction of plantation areas. This study proposes a novel deep learning-based method that utilizes GF-2 remote sensing imagery to achieve precise mapping and efficient monitoring of Camellia oleifera plantations. First, we conducted a comparative analysis of the performance of various semantic segmentation models using a self-compiled dataset of Camellia oleifera plantations. Subsequently, we proceeded to validate the prediction results obtained from the most effective deep-learning network model for Camellia oleifera plantations in Hengyang City. Finally, we incorporated DEM data to analyze the spatial distribution patterns. The findings indicate that the U-Net++ network model outperforms other semantic segmentation methods when applied to our self-generated dataset of Camellia oleifera plantations. It achieves a recall rate of 0.89, a precision rate of 0.92, and an mIOU of 0.83, demonstrating the effectiveness of the proposed method in identifying and monitoring Camellia oleifera plantations. By combining the predicted results with the data from DEM, we discovered that these plantations are typically situated at elevations ranging from 50 to 200 m, with slopes below 25°, and facing south or southeast. Moreover, a significant positive spatial correlation and clustering phenomenon are observed among the townships in Hengyang City. The method proposed in this study facilitates rapid and precise identification and monitoring of Camellia oleifera plantations, offering significant theoretical support and a scientific foundation for the management and ecological conservation of Camellia oleifera plantations.

Association between dietary intake and symptoms of depression and anxiety in pregnant women: Evidence from a community-based observational study.

Dietary intake is considered as a crucial factor affecting mental health symptoms, particularly depression and anxiety symptoms, especially in the case of pregnant women. This study explored the role of dietary intake in depression and anxiety symptoms of pregnant women and provided evidence for primary care interventions. We enrolled 806 pregnant women in their third trimester from 14 communities in Hengyang City, Hunan Province, China, from July 2019 to September 2019. The Chinese version of the Patient Health Questionnaire-9 (PHQ-9) and the Generalized Anxiety Disorder questionnaire-7 (GAD-7) were used to assess depression and anxiety symptoms. Dietary intake, demographic characteristics, BMI, and pregnancy characteristics were collected using a self-designed, structural questionnaire. A covariate-adjusted logistic regression was conducted to examine the relationship between mental health symptoms and dietary intake. The prevalence of anxiety and depression symptoms in our population were 7.7% (95% CI: 5.9%-9.5%) and 9.2% (95% CI: 7.2%-11.2%), respectively. Women consuming eggs and egg products once a week (OR: 3.688, 95% CI: 1.476-9.215) were more likely to have depression symptom than consumed eggs and egg products once or more per day. Consuming green leafy vegetable <2-3 times per month had a significantly greater risk for depression symptoms than consuming the same once or more per day (OR: 3.450, 95% CI: 1.145-10.393). Women who consumed eggs and egg products 2-3 times a week had an increased likelihood of experiencing anxiety symptoms (OR: 2.253, 95% CI: 1.049-4.837). Anxiety symptoms in women consuming green leafy vegetables <2-3 times per month probably increased by 3.988 times (95% CI: 1.327-11.985) compared with women consuming the same once or more per day. Consuming salted and smoked food <2-3 times per month was protective against anxiety symptoms (OR: 0.181, 95% CI: 0.040-0.828) than consuming the same every day. Implementing interventions to promote healthy dietary among pregnant women is crucial due to its association with mental health. However, future researches are warranted to confirm the reliability and causal association obtained in this study.

Analysis of spatial characteristics and influence mechanism of human settlement suitability in traditional villages based on multi-scale geographically weighted regression model: A case study of Hunan province

Traditional villages are invaluable cultural heritage sites in China, reflecting a rich historical and cultural legacy. However, rapid urbanization has led to the destruction and loss of numerous traditional villages. The remaining traditional villages also face challenges in preserving their original living environment. In order to assess human settlement suitability and identify potential factors, this paper proposes a village-scale model for assessing human settlement suitability. This paper used an eight-factor evaluation system, multi-criteria decision analysis and spatial visualization methods to evaluate the scores and spatial characteristics of human settlement suitability of 688 traditional villages in Hunan Province. This paper also examines the factors affecting cluster suitability using geographic detectors and multi-scale geographically weighted regression (MGWR) models. This study found that the quality of human settlement suitability varied widely. The overall quality is low and very few areas achieve medium or higher scores. Among them, the traditional villages in Huaihua city, Zhangjiajie junction, southern Hengyang city, northwestern Yongzhou city, central Chenzhou city and Changsha city exhibit higher scores. Secondly, the commercial facility density and normalized difference vegetation index (NDVI) are important factors driving the spatial changes. And there is a significant interaction effect between them. Additional factors impacting spatial variation include annual average temperature, per capita disposable income, and average house price. This comprehensive assessment reveals spatial characteristics and potential influencing factors. The results of the study provide an empirical basis and decision-making foundation for the protection and development of traditional villages, which will ultimately contribute to the sustainable development of China's rural areas.

Evaluating the Spatial Quality of Urban Living Streets: A Case Study of Hengyang City in Central South China

Evaluating the spatial quality of a living street entails identifying and assessing the outdoor space that influences residents’ leisure and recreation, which may contribute to urban renewal. The application of multi-source data and deep learning technology enables an objective evaluation of large-scale spatial quality as opposed to the traditional questionnaire survey or experts’ subjective evaluation. Based on street view images, points of interest, and road network data, this study developed subjective and objective evaluation indicators for the central city of Hengyang using semantic segmentation and ArcGIS spatial analysis. This study then assigned weights to each indicator and calculated the spatial quality score for living streets. In addition, the subjective evaluations of the street view images were compared to test and verify the validation of the objective evaluation model. Finally, the study analyzed the accessibility within 500 m of the study area using Spatial Syntax and ArcGIS to overlay the low spatial quality score with the highest accessibility to identify the streets with the highest priority in the subsequent urban plan. The results indicate that the spatial quality of living in the west of Hengyang is higher than that in its northeast region. In addition, Xiao Xia Street, Guanghui Street, and Hengqi Road comprised the majority of the areas that required a priority update. Correspondingly, our research is expected to be a useful management tool for identifying urban street space issues and guiding urban renewal.

First Report of Meloidogyne graminicola Naturally Infecting Cyperus difformis in China.

Cyperus difformis is a problematic annual weed in rice fields and is widely distributed throughout tropical to warm temperate regions of the world. In June 2019, many galls were observed on the roots of C. difformis growing in rice fields in Heshan District, Hengyang City, Hunan Province, China. The infected plants did not exhibit obvious aboveground symptoms. Females, males, eggs, and second-stage juveniles (J2s) of Meloidogyne spp. were found within galls after dissection. The perineal patterns of females were dorsoventrally oval shape with low and round dorsal archs, smooth striae, and lacking distinct lateral lines. Morphological measurements of females (n = 20) included body length (L) = 589.4 ± 64.7 (482.1 to 693.8) μm, body width (BW) = 362.2 ± 84.6 (267.6 to 505.9) μm, stylet = 11.7 ± 1.5 (9.7 to 14.4) μm, dorsal pharyngeal gland orifice to stylet base (DGO) = 3.8 ± 0.6 (3.3 to 5.0) μm, vulval slit length = 23.7 ± 4.4 (15.5 to 28.9) μm, vulval slit to anus distance = 16.8 ± 2.7 (13.1 to 19.4) μm. The J2s were vermiform and had a long and slender tail with tapering hyaline tail terminus. Measurements of J2s (n = 20) were L = 464.4 ± 31.7 (415.0 to 508.3) μm, BW = 16.9 ±1.7 (14.1 to 19.7) μm, stylet = 13.2 ± 0.6 (12.5 to 14.9) μm, DGO = 3.3 ± 0.5 (2.6 to 4.4) μm, tail = 71.6 ± 5.5 (65.1 to 82.0) μm, hyaline tail length = 19.4 ± 2.6 (15.3 to 23.9) μm. These morphological characteristics were similar to those previously described for M. graminicola (Golden and Birchfield 1965). Genomic DNA extracted from a single J2 was used for molecular identification. The ITS rRNA gene and the mtDNA COII-16S rRNA region were amplified using primers 18s/26s (TTGATTACGT CCCTGCCCTTT/TTTCACTCGCCGTTACTAAGG) and C2F3/1108 (GGTCAATGT TCAGAAATTTGTGG/TACCTTTGACCAATCACGCT), respectively (Powers and Harris 1993; Vrain et al. 1992). Both the ITS rRNA gene sequence (790 bp, GenBank accession no. MZ656127) and the mtDNA COII-16S rRNA region sequence (531 bp, OM161973) showed 100% identity with sequences of M. graminicola (e.g., MN647593, MG773553, MF320126; MG356945, MH332687, JN241939). Furthermore, species identification was also further validated using the M. graminicola-specific primers SCAR-MgFW/SCAR-MgRev (GGGGAAGACATTTAATTGATGATCAAC/GGTACCGAAACTTAGGGAAAG) (Bellafiore et al. 2015). The PCR products yielded the expected fragment size of 640 bp, which was identical to that previously reported for M. graminicola (Bellafiore et al. 2015). To verify the pathogenicity of this nematode, 15 30-day-old C. difformis seedlings planted in pots with sterilized soil were inoculated with 400 freshly hatched J2s from the original population of M. graminicola per plant, and five non-inoculated seedlings were used as controls. All plants were grown in a greenhouse at 26 to 28 °C with a 16 h light/8 h dark photoperiod. At 30 days after inoculation, all inoculated plants showed gall symptoms on the roots identical to those observed in the fields. The nematode reproduction factor (final population/initial population) was 12.6. No symptoms were observed on non-inoculated plants. These results confirmed the pathogenicity of M. graminicola on C. difformis. To our knowledge, this is the first report of M. graminicola naturally infecting C. difformis in China. C. difformis is an alternative host of M. graminicola and could serve as a potential reservoir for M. graminicola in field. Therefore, weed management could be an effective way to reduce the disease by eliminating source of infection of M. graminicola.

On English Courses and Teaching Strategies in Compound Application-Oriented Talents Training Based on the Education Ideas of CDIO in the Construction of Smart Cities

To improve the level of English education in China and promote the cultivation of compound application-oriented talents in colleges and universities, this research integrates the concept of conceive design implement operate (CDIO) into college English education. First, the CDIO educational concept is introduced in detail. Second, the moth-flame optimization (MFO) algorithm and the support vector machine (SVM) model by the MFO algorithm are presented, and they are applied to teaching evaluation, and then the teaching plan is proposed by the CDIO concept. The teaching evaluation model is applied to the English teaching of students in class A with ordinary learning levels in a university in Hengyang City. The implementation method of the teaching plan is explained in detail by taking “Unit 2 Charlie Chaplin” in the textbook “New Horizons College English” as an example. Finally, the accuracy of the MFO-SVM model for teaching evaluation is verified by simulation analysis, and the corresponding teaching strategies are summarized through teaching evaluation and customization of teaching plans. The experimental results reveal that the MFO-SVM model has an accuracy of 96.43% in teaching evaluation, while the extreme learning machine (ELM), SVM, and back propagation neural network (BPNN) models have an accuracy of 92.27%, 90.45%, and 86.36%, respectively in the evaluation results of the teaching quality. The summarized teaching strategies are mainly divided into four parts, namely, autonomous learning, project-based teaching, dynamic generation and information feedback, and production teaching. This research has a certain reference for the current reform of English education in China and the cultivation of compound application-oriented talents.

Study on the Current Status and Influencing Factors of Workplace Violence to Medical Staff in Intensive Care Units.

Objective To explore the current status and influencing factors of workplace violence to medical staff in intensive care unit (ICU). Methods A total of 230 medical staff in the ICU of Hengyang city were enrolled as the research subjects between October 2021 and January 2022. The situations and characteristics of workplace violence were collected with questionnaires. The influencing factors of workplace violence were analyzed by univariate and multivariate logistic regression analyses. Results The incidence of workplace violence to ICU medical staff was 40.43%. There were 18.70% of them threatened, 13.48% with verbal violence, 10.00% with physical violence, and 7.39% with sexual harassment. Of the 114 workplace violence incidents, there were 69 (59.65%) during the day, 101 (88.60%) only with medical staff on the spot, and 91 (79.82%) with male perpetrators (mainly on patients and their families). The main reasons for violence were verbal miscommunication (15.79%), too long waiting time for treatment (27.19%), and unsatisfactory treatment effect (38.60%). The main coping style of medical staff after suffering violence was patient explanation (64.04%). Multivariate regression analysis showed that working years ≤5 years (OR = 2.093, P=0.009) and weekly working time >45 h (OR = 2.127, P=0.022) were independent risk factors of workplace violence to ICU medical staff. Conclusion The working years ≤5 years and weekly working time >45 h are high-risk factors of workplace violence to ICU medical staff. The hospital can prevent and control workplace violence based on the high-risk factors to reduce the incidence of workplace violence.

Spectral response feature bands extracted from near standard soil samples for estimating soil Pb in a mining area

Heavy metal contamination has been a critical environmental issue in mining areas, while accurate environmental remediation still faces a great challenge because of the complex feature of historical left-over soil pollution and its unclear spatial distribution patterns. Hyperspectral-based remote sensing techniques became a hot issue in interdisciplinary research on remote sensing and soil contamination, for it enables economical and efficient contamination detection. However, the unclear spectral response feature of soil heavy metal challenges the widespread of its application. In this study, near standard soil samples (NSS) were employed to extract spectral response feature bands of soil Pb. First, NSS was produced by artificially adding heavy metal ion solution in the background soil. Next, based on the proximal hyperspectral data of NSS, the spectral response feature bands were precisely identified by the Monte Carlo Uninformative Variables Elimination (MC-UVE) method as it achieved the highest predicting accuracy of the Partial Least Squares Regression (PLSR) model. Finally, to verify the reliability of the above extracted spectral response feature bands, 46 naturally contaminated soil samples (NCS) were collected synchronously with field and laboratory spectra in a mining area of Hengyang city, China. Enhanced by the corresponding feature bands of NSS, the NCS predicted models for soil Pb achieved the highest accuracy both for laboratory spectra ( and RPD were improved from 0.45 and 1.36 to 0.71 and 1.87, respectively) and Direct standardization (DS)-converted field spectra ( and RPD were improved from 0.38 and 1.28 to 0.62 and 1.64, respectively). In conclusion, NSS could provide an effective way to clarify the spectral response feature bands from hyperspectral data. And when combined with MC-UVE, it could serve as a promising approach to inverse the concentration of regional soil heavy metal Pb. HIGHLIGHTS Near standard soil samples were used to extract Pb spectral response feature band. Spectral response feature bands of NSS were effective for the modeling of NCS. Spectral response feature bands of soil Pb are 570-760nm, 1710-2100 nm et al. MC-UVE was a relatively optimal method to extract spectral response feature bands.

Does the Presence of Anxiety and Depression Symptoms Mediate the Association Between Family Functions and Self-Efficacy in Pregnant Women in the Third Trimester?: A Community-Based Cross-Sectional Survey

Objectives: Pregnant women in the third trimester can be more vulnerable to adverse mental health outcomes, but there is limited research on the association between family function and self-efficacy and potential mediation by symptoms of anxiety and depression.Methods: The cross-sectional study enrolled 813 pregnant women in the third trimester from 14 communities of Hengyang city, Hunan province of China. All of the participants completed a battery of self-report measures of family function (Family Adaptation Partnership Growth and Resolve Index, APGAR-family), self-efficacy (General Self-Efficacy Scale, GSES), anxiety (measured by Generalized Anxiety Disorder scale with seven items, GAD-7), and depression symptoms (Patient Health Questionnaire with nine items, PHQ-9). The correlation analysis was performed using Spearman's correlation coefficient. Baron and Kenny's method and multiple mediation models with bootstrapping were used to determine whether the symptoms of anxiety and depression mediated the association between family functions and self-efficacy.Results: There were 22.6% pregnant women in the low level of self-efficacy, with 60.9% in the moderate level and 16.5% of respondents in the high level. Self-efficacy had significant correlations with both anxiety symptoms (r = −0.19, p < 0.05), depression symptoms (r = −0.22, p < 0.05), and family function (r = 0.31, p < 0.05). Anxiety symptoms were significantly associated with self-efficacy (β = −0.016, p < 0.05). Depression symptoms were significantly associated with self-efficacy (β = −0.024, p < 0.05). Anxiety and depression symptoms partly mediated the association between family function and self-efficacy, accounting for 11.4 and 16.4% of total effect, respectively. It was indicated that pregnant women with a high degree of family function are less likely to have emotional symptoms and predicted to have higher levels of self-efficacy.Conclusions: Anxiety and depression show mediating effects in the association between family function and self-efficacy. Improved family function can have a positive impact on pregnant women in the third trimester.

Spatial Pattern Simulation of Land Use Based on FLUS Model under Ecological Protection: A Case Study of Hengyang City

With rapid economic development in China, the excessive expansion of cities has led to the imbalance of land use structure, and then the ecological regulation function of the land ecosystem experiences problems, which has become an obstacle to sustainable development. Therefore, in order to protect the ecological environment, regulate urban development and pursue the maximization of ecological benefits, it is necessary to analyze, simulate and predict land use change. In this study, Hengyang City was taken as the study area, and based on the current land use data of Hengyang City in 2010, 2015, and 2018, the land use type transfer during 2010–2015 and 2015–2018 was analyzed. Then, starting from 2010, the FLUS model was used to simulate the spatial distribution of land use in 2015 and 2018, and then the spatial distribution of land use in Hengyang City in 2025 was predicted with the Markov prediction method under the premise of ecological protection priority. The results show that the change in ecological land in Hengyang City is mainly distributed in the surrounding and marginal areas, because the topography of Hengyang City is a basin. Changes in land type in Hengyang City in 2015 were subtle and difficult to observe. However, in 2018, the transformation of non-ecological land into ecological land was obvious, and the distribution area of ecological land expanded significantly. The Kappa index of the results simulated by the FLUS model based on neural network is above 0.72, and overall accuracy is above 0.9, which is highly consistent with the actual situation. It is reasonable and convincing to predict the spatial distribution of land use in the context of ecological protection. The predicted results can be useful for urban planning and land use distribution and provide a reference for relevant decision-makers.

Public Space Humanized Transformation of Community Based on Depthmap

With the rapid development of urban modernization in China, residents are paying more and more attention to the quality of outdoor public space. Aiming at insufficient aspects of modern community public space design, this paper investigates mingshihuafu community in Hengyang City by means of questionnaire and field interview and summarizes the relevant factors that affect human activities. From the perspective of spatial fabric, this paper will use the space syntax software Depthmap to analysis the humanization demand of the community public space quantitatively and put forward the humanized transformation design strategy of modern community public space, hopping to enhance the vitality of modern community, improve the living environment, and provide reference of the transformation design for the existing community public space in China.