Helicobacter Pylori Testing Research Articles

Pyloric Perforation with Gastro-duodenal Artery Pseudo Aneurysm Due to Peptic Ulcer Disease in a Toddler: Case Report with Review of Literature

Abstract Background: With increasing use of endoscopy in children, peptic ulcer disease (PUD) is being diagnosed more frequently and perforation of PUD is also being reported. However, most such cases are reported in older children and adolescents. We report a rare occurrence of perforated PUD in a young child associated with the rupture of pseudoaneurysm of gastroduodenal artery (GDA). Clinical Description: A 3-year-old boy presented with abdominal pain and nonbilious vomiting, exhibiting peritoneal signs upon examination. An X-ray erect abdomen confirmed pneumoperitoneum. During the hospital stay, the patient also developed melaena. Management and Outcome: Emergency laparotomy revealed a small perforation between the pylorus and the first part of the duodenum, which was successfully repaired. However, postoperatively, the patient continued to experience massive melaena, accompanied by a significant drop in hemoglobin. Angiography indicated an irregular GDA with a small pseudoaneurysm which was then angioembolized. The patient recovered and was discharged on proton-pump inhibitors. A gastroduodenoscopy after 2 weeks revealed Helicobacter pylori (HP) infection, which was treated as per guidelines. Conclusion: This case report underscores the importance of considering perforated PUD in a child with pneumoperitoneum, and HP testing in all children with PUD. Rupture of a pseudoaneurysm of GDA may be a complication of PUD, which if promptly treated, can be life-saving.

Helicobacter pylori infection is a risk factor for constipation in patients with Parkinson's disease: A multicenter prospective cohort study

Background and aimsConstipation is one of the most common nonmotor symptoms (NMSs) of Parkinson's disease (PD). The infection rate of Helicobacter pylori (HP) is greater in PD patients. This study was a multicenter prospective cohort study in which propensity score matching (PSM) was used to determine whether HP infection was a risk factor for constipation in patients with PD. MethodsA total of 932 PD patients with 13C‐urea breath test for HP were included in the study. The PSM was estimated with the use of a nonparsimonious multivariate logistic regression model, with HP infection as the dependent variable and all the baseline characteristics as covariates. A total of 697 patients composed the study cohort, including 252 (36.2 %) patients in the HP-positive (HPP) group and 445 (63.8 %) patients in the HP-negative (HPN) group. Before PSM, there were differences in several of the baseline variables between the two groups. After PSM, 250 HPP patients were matched with 250 HPN patients and the standardized differences were less than 0.1 for all variables. ResultsThe present results demonstrate that HP infection is a risk factor for constipation in patients with PD [RR (95 % CI) 1.412 (1.155–1.727), P < 0.001]. Subgroup analyses revealed that HP infection was both a risk factor for constipation in Hoehn-Yahr scale (1,1.5) group and Hoehn-Yahr scale (2–5) group [OR (95 % CI) 1.811 (1.079–3.038), P < 0.025; OR (95 % CI) 2.041 (1.177–3.541), P < 0.011]. ConclusionsThe results of our prospective cohort study suggest that Helicobacter pylori infection is a risk factor for constipation in patients with PD. Trial registrationChiCTR2300071631.

The intake of solid fat and cheese may be associated with a reduced risk of Helicobacter pylori infection status: a cross-sectional study based on NHANES 1999–2000

BackgroundDiet plays an important role in Helicobacter pylori (HP) infection, and our objective was to investigate potential connections between dietary patterns, specific food groups, and HP infection status in U.S. adults.MethodsThe data for this study was obtained from the NHANES (National Health and Nutrition Survey) database for the year 1999–2000. This cross-sectional study involved the selection of adults aged 20 years and older who had undergone dietary surveys and HP testing. Factor analysis was employed to identify dietary patterns, and logistic regression models were utilized to assess the association between these dietary patterns and specific food groups with HP infection status.ResultBased on the inclusion and exclusion criteria, our final analysis included 2,952 individuals. The median age of participants was 51.0 years, and 48.7% were male. In the study population, the overall prevalence of HP infection was 44.9%. Factor analysis revealed three distinct dietary patterns: High-fat and high-sugar pattern (including solid fats, refined grains, cheese, and added sugars); Vegetarian pattern (comprising fruits, juices, and whole grains); Healthy pattern (encompassing vegetables, nuts and seeds, and oils). Adjusted results showed that the high-fat and high-sugar pattern (OR = 0.689, 95% CI: 0.688–0.690), vegetarian pattern (OR = 0.802, 95% CI: 0.801–0.803), and healthy pattern (OR = 0.717, 95% CI: 0.716–0.718) were all linked to a lower likelihood of HP infection. Further analysis of the high-fat and high-sugar pattern revealed that solid fats (OR = 0.717, 95% CI: 0.716–0.718) and cheese (OR = 0.863, 95% CI: 0.862–0.864) were protective factors against HP infection, while refined grains (OR = 1.045, 95% CI: 1.044–1.046) and added sugars (OR = 1.014, 95% CI: 1.013–1.015) were identified as risk factors for HP infection.ConclusionBoth the Vegetarian pattern and the Healthy pattern are associated with a reduced risk of HP infection. Interestingly, the High-fat and High-sugar pattern, which is initially considered a risk factor for HP infection when the score is low, becomes a protective factor as the intake increases. Within this pattern, animal foods like solid fats and cheese play a protective role, while the consumption of refined grains and added sugars increases the likelihood of HP infection.

Risk of Ischemic Stroke in Relation to Helicobacter pylori Infection and Eradication Status: A Large-Scale Prospective Observational Cohort Study.

: A few studies have suggested the association between Helicobacter pylori (HP) infection and ischemic stroke. However, the impact of HP eradication on stroke risk has not been well evaluated. This study aimed to assess the influence of HP eradication on the incidence of ischemic stroke, considering the potential effect of sex. : This prospective observational cohort study was conducted at Seoul National University Bundang Hospital, from May 2003 to February 2023, and involved gastroscopy-based HP testing. Propensity score (PS) matching was employed to ensure balanced groups by matching patients in the HP eradicated group (n=2,803) in a 3:1 ratio with patients in the HP non-eradicated group (n=960). Cox proportional hazard regression analysis was used to evaluate the risk of ischemic stroke. : Among 6,664 patients, multivariate analysis after PS matching indicated that HP eradication did not significantly alter the risk of ischemic stroke (hazard ratio, 0.531; 95% confidence interval, 0.221 to 1.270; p=0.157). Sex-specific subgroup analyses, both univariate and multivariate, did not yield statistically significant differences. However, Kaplan-Meier analysis revealed a potential trend: the females in the HP eradicated group exhibited a lower incidence of ischemic stroke than those in the HP non-eradicated group, although this did not reach statistical significance (p=0.057). : This finding suggests that HP eradication might not impact the risk of ischemic stroke. However, there was a trend showing that females potentially had a lower risk of ischemic stroke following HP eradication, though further investigation is required to establish definitive evidence.

Improving Adherence to Clinical Practice Guidelines for Managing Gastric Intestinal Metaplasia Among Gastroenterologists at a US Academic Institution.

Clinical guidelines reserve endoscopic surveillance after a gastric intestinal metaplasia (GIM) diagnosis for high-risk patients. However, it is unclear how closely guidelines are followed in clinical practice. We examined the effectiveness of a standardized protocol for the management of GIM among gastroenterologists at a US hospital. This was a preintervention and postintervention study, which included developing a protocol and education of gastroenterologists on GIM management. For the preintervention study, 50 patients with GIM were randomly selected from a histopathology database at the Houston VA Hospital between January 2016 and December 2019. For the postintervention study, we assessed change in GIM management in a cohort of 50 patients with GIM between April 2020 and January 2021 and surveyed 10 gastroenterologists. The durability of the intervention was assessed in a cohort of 50 GIM patients diagnosed between April 2021 and July 2021. In the preintervention cohort, GIM location was specified (antrum and corpus separated) in 11 patients (22%), and Helicobacter pylori testing was recommended in 11 of 26 patients (42%) without previous testing. Gastric mapping biopsies were recommended in 14% and surveillance endoscopy in 2%. In the postintervention cohort, gastric biopsy location was specified in 45 patients (90%, P <0.001) and H. pylori testing was recommended in 26 of 27 patients without prior testing (96%, P <0.001). Because gastric biopsy location was known in 90% of patients ( P <0.001), gastric mapping was not necessary, and surveillance endoscopy was recommended in 42% ( P <0.001). One year after the intervention, all metrics remained elevated compared with the preintervention cohort. GIM management guidelines are not consistently followed. A protocol for GIM management and education of gastroenterologists increased adherence to H. pylori testing and GIM surveillance recommendations.

Knowledge, attitudes, and practices of adults in the Kingdom of Saudi Arabia regarding Helicobacter pylori-induced gastric ulcers, cancers, and treatment.

Helicobacter pylori (HP) infection presents a significant threat to global health with serious associated morbidities. This study aimed to assess awareness, attitudes, and practices related to HP in the Kingdom of Saudi Arabia (KSA) through a survey-based cross-sectional study involving 2,541 respondents. We used a structured online questionnaire to gather data on personal and sociodemographic characteristics, as well as HP-related knowledge, attitudes, and practices. The survey was distributed through various social media platforms. The results revealed that 59.4% of respondents demonstrated good knowledge about HP, with a mean knowledge score of 3.7 ± 1.0 out of 5. Knowledge gaps were particularly evident regarding the contagiousness and transmission modes of HP. The mean attitude score was 12.2 ± 2.2 out of a maximum score of 15. In total, 37.6% of respondents reported ever being tested for HP, with 54.2% testing positive. Among those treated for HP, only 79% received antibiotic therapy and 37.8% received acid-reducing medications. Knowledge levels were significantly higher among younger and highly educated respondents (P < 0.001), and respondents with higher knowledge scores also had higher attitude scores than those with lower knowledge scores (12.6 ± 2.0 vs. 11.6 ± 2.0, P < 0.001). Individuals who had undergone HP testing had significantly higher knowledge levels than those who did not (62.3 vs. 57.8, P = 0.024). These findings underscore the urgent need for raising the population's awareness regarding the risks, prevention, and management of HP infection through targeted educational strategies.

Barriers to Community-Based Eradication of Helicobacter pylori Infection

Helicobacter pylori (HP) is a causative agent in gastric cancer (GC).1 In the United States, HP is more prevalent in racial and ethnic minorities, including African Americans, Asian Americans, Latinos, and immigrants, the same groups that are more likely to develop and die from GC.2 Although screening for HP is not presently performed in the United States, there are plausible benefits to doing so, because HP is considered a group 1 carcinogen by the World Health Organization, and its link to GC parallels that of human papilloma virus and cervical cancer.1 HP eradication as a means of preventing GC also fulfils the Wilson and Jungner criteria for a successful screening program, and literature has consistently demonstrated that HP eradication reduces GC risk and death from GC.3 In fact, in countries with a high burden of GC, HP eradication is considered primary prevention for GC. As such, targeted HP testing in the United States may reduce GC burden in high-risk groups.4 We evaluate the results of community-based HP testing in an at-risk, underserved population.

Testing for Helicobacter pylori in an era of antimicrobial resistance.

Antimicrobial resistance in Helicobacter pylori has reached alarming levels and is compromising traditional empiric treatment of H. pylori. Antimicrobial susceptibility testing is routinely performed for infectious diseases when there is a risk of resistance and is now recommended to guide therapy for H. pylori. This mini-review overviews the current diagnostics for H. pylori with a focus on tests that enable susceptibility-guided treatment, including molecular tests performed directly on stool and endoscopically collected specimens.

A Study on the Glucose Breath Test Positivity Rate and Occurrence of Small Intestine Bacterial Overgrowth-Related Symptoms Caused by Long-Term Use of Proton Pump Inhibitor (PPI) Versus Potassium-Competitive Acid Blocker (P-CAB) in Elderly Patients: SIBO Between PPI and P-CAB.

Background/Aims: Long-term acid suppression with proton pump inhibitors (PPI) leads to hypochlorhydria and facilitates the growth of bacterial flora in the small intestine. Novel acid-suppressants called potassium-competitive acid blockers (P-CABs) seem to be superior to PPIs. However, data on the risk of small intestinal bacterial overgrowth (SIBO) in patients taking P-CABs are limited. Method: We retrospectively analyzed a consecutive series of patients with long-term acid-suppressant (PPIs or P-CABs) use for gastroesophageal reflux disease or nonsteroidal anti-inflammatory drug (NSAID)-induced gastropathy. All of them underwent endoscopic examinations and Helicobacter pylori testing and took PPIs or P-CABs for at least 3 months. Glucose hydrogen breath tests (GBT) were performed to check for SIBO, and newly developed SIBO-related symptoms including bloating, postprandial discomfort, diarrheas, and constipation, were evaluated. Results: A total of 142 patients were enrolled. Six patients were excluded due to equivocal Helicobacter pylori infection results. The frequency of positive GBTs was 31.7% (25/79) for PPI and 22.8% (13/57) for P-CAB use (p=0.15). Regarding GBT positivity, age-related factor was found to be significant in multivariate analysis (p=0.02). The results of multivariate analysis in cases of SIBO-related symptoms showed that GBT positivity and PPI use were significant (p < 0.01). Conclusion: Long-term use of gastric acid suppressants resulted in positive GBT in approximately 30% of patients, and the risk was particularly high in elderly patients. The occurrence of SIBO-related symptoms was significant in long-term use of PPIs and in patients with positive GBT.

RESEARCH ON THE DETECTION OF HELICOBACTER PYLORI IN SALIVA OF GASTRITIS AND DUODENITIS PATIENTS BY REAL-TIME PCR TECHNIQUE

Background: Helicobacter pylori plays an important role in the etiology and pathogenesis of gastritis and duodenitis. There are two groups of test methods to detect Helicobacter pylori infection: invasive methods and non-invasive methods. Testing for Helicobacter pylori in saliva by real-time PCR technique belongs to group of non-invasive test methods. Objectives: To determine the detection rate of Helicobacter pylori in saliva by real-time PCR technique in gastritis and duodenitis patients and to investigate some factors related to Helicobacter pylori infection detected in saliva using real-time PCR technique in gastritis and duodenitis. Materials and method: A cross-sectional descriptive study on 91 patients after convenient sampling was preliminarily diagnosed with gastritis and duodenitis with indications for endoscopy and biopsy. Biopsy specimens were used for urease and histopathology tests. Saliva is taken directly from the mouth after spitting into a dedicated bottle and conducting a real-time PCR test. Gene amplification will be performed with a PYLORI-PCR mix containing primers and for the expected target product of 203 base pairs length: 5' - AGCGCTCTCACTTCCATAGGC - 3' and 5' - TCTTCGGTTAAAAAAGCGAT - 3'. Install the program "Protocol" for the Real-time PCR machine to operate with the following cycles: 1 cycle: 950C for 5 minutes; 40 cycles: 950C for 15 seconds, 550C for 1 minute and 720C for 20 seconds. Results: The positive rate for Helicobacter pylori in saliva by realtime PCR technique, urease test and histopathology were 20.9%, 19.8% and 46.2% respectively. The detection rate of H. pylori by real-time PCR in saliva and the detection rate on urease test as well as histopathology had a statistically significant correlation. A few important factors related to Helicobacter pylori-positive patients in saliva as follows: personal history suffer from gastritis and duodenitis 40.7%, reflux esophagitis 67%, and congestive inflammation 75.8%. Conclusions: The rate of detecting Helicobacter pylori in saliva by real-time PCR technique in gastritis and duodenitis patients in Can Tho University of Medicine and Pharmacy Hospital is higher than urease test and lower than histopathology.

Helicobacter pylori Exposure in Nausea and Vomiting of Pregnancy Increases Risk of Preterm Delivery.

Hyperemesis gravidarum (HG), a severe form of nausea and vomiting in pregnancy (NVP), is a leading indication for hospitalization in the first trimester. NVP and HG are associated with Helicobacter pylori (HP) infection in non-United States cohorts. How HP exposure and NVP interact to affect metabolic disturbance and pregnancy outcomes is not known. We designed a retrospective cohort study relating HP and NVP to serum electrolyte laboratory results, preterm delivery, and infant birth weight. Single academic institution discovery and independent multi-institutional validation cohorts included pregnant subjects with an HP test result. Associations of HP, NVP, and pregnancy outcomes were assessed with odds ratio calculations, Student's t-tests, and multivariate logistic regression. Among subjects with positive HP test results, the prevalence of hyperemesis gravidarum (HG) was 0.025 (66 of 2671) and NVP was 0.27 (710 of 2671). Subjects with negative HP had prevalence of HG 0.015 (165 of 10,960) and NVP 0.22 (2392 of 10,960). History of HP exposure increased risk of NVP, including HG (odds ratio 1.3, 95% CI 1.1-1.4). Patients with HP exposure had lower serum potassium (mean difference 0.1 mEq/L) and bicarbonate (mean difference 0.3 mEq/L) during pregnancy than HP-negative patients (p < 0.01). Serum potassium was lowest in subjects with both NVP and HP exposure (mean 3.5 mEq/L [3.4-3.6], p < 0.0001). HP exposure alone carried increased risk for preterm delivery (OR 1.3 [1.1-1.4]). NVP alone increased risk of preterm delivery (OR 2.8 [2.5-3.1]) including second trimester delivery (OR 2.2 [1.7-2.8]). In multivariate analysis, HP exposure in the setting of NVP further increased risk of preterm delivery (adjusted OR 1.4 [1.0-1.9], p = 0.03). H. pylori exposure and diagnosis of NVP are individually associated with metabolic disturbances and adverse pregnancy outcomes such as preterm labor and delivery, and their combination further increases risk in US populations.

BG12 A case of severe gastrointestinal bleeding while on vismodegib therapy

Abstract We report the case of a 50-year-old woman, with a history of Gorlin syndrome on vismodegib therapy, who presented with two episodes of upper gastrointestinal bleeding (UGIB) in the absence of other risk factors. Gorlin syndrome is a rare disorder characterized by multiple basal cell carcinomas (BCCs) secondary to a mutation in PTCH1. Mutations in PTCH1 lead to dysregulation of the hedgehog signalling pathway and subsequent abnormal proliferation. Vismodegib is a systemic hedgehog inhibitor that has been shown to be effective in treating advanced BCCs and Gorlin syndrome. Our patient acquired multiple BCCs which excision, photodynamic therapy and topical chemotherapy agents failed to control. Therefore, a decision to commence vismodegib was made. During treatment with vismodegib, she had a perforated gastrointestinal ulcer and required an emergency laparotomy. Vismodegib was stopped, but over the next few years, her BCCs progressed again to an excess of 50 BCCs, including large plaques of carcinoma measuring up to 12 cm in diameter. Vismodegib was restarted with a high-dose proton–pump inhibitor cover, as recommended by the gastroenterology team, and her BCCs were largely resolved. However, a second bleed occurred approximately 1 year after restarting treatment. Gastroscopies undertaken following these episodes were largely normal, showing mild, nonerosive duodenitis only, and Helicobacter pylori testing was negative. Given the lack of pre-existing risk factors and temporal relation to vismodegib therapy, the decision was made to suspend the drug. To our knowledge, this is the first case reported in the literature of UGIB associated with vismodegib. A separate case has reported colonic mucosal changes in a patient with chronic diarrhoea on vismodegib. The hedgehog protein and RNA expression have been found to be present in the gastrointestinal endothelium and mesenchyme. Evidence suggests the hedgehog pathway activation in gastrointestinal lining is involved in the wound-healing response, endothelial turnover and activation of mesenchymal immune responses. Therefore, inhibition of the hedgehog pathway via vismodegib could potentially impair the essential maintenance of the gastrointestinal endothelium. We postulate that this mechanism could have led to the presentation in our patient, through endothelial damage exposure of vessels leading to gastrointestinal bleeding. Treatment options for BCC in our patient are now limited. Vismodegib is one of the few therapies that has been shown to induce remission of symptoms and reduce disease burden. We present this case to raise awareness of this potential adverse event.

Clinical Usefulness of Linked Color Imaging for Detection and Characterization of UndifferentiatedType Early Gastric Cancer.

Linked color imaging is based on the bioluminescent imaging technique, which enhances differences in mucosal color allowing for contrast-based detection of lesions. There have been reports which have investigated the usefulness of linked color imaging for assessing color values in endoscopy for early gastric cancer cases. However, these primarily focused on differentiated early gastric cancer. This study aimed to assess the efficacy of linked color imaging in analyzing the color differences between cancerous and noncancerous areas in undifferentiated-type early gastric cancer patients compared with conventional white light imaging. Forty-six patients were prospectively enrolled with undifferentiated-type early gastric cancer from 3 academic hospitals. All lesions were observed first by white light imaging followed by linked color imaging. An additional biopsy was taken from the surrounding mucosa to check for intestinal metaplasia, and test for Helicobacter pylori was performed. Color difference was measured in accordance with the International Commission on Illumination details. The color difference value with linked color imaging was significantly higher, being more than twice that of white light imaging (26.82 ± 14.18 and 12.60 ± 6.42, P < .001), and this difference appeared to be similar in cases of accompanying Helicobacter pylori infection or intestinal metaplasia. In the subgroup analysis, color difference of poorly differentiated adenocarcinoma was notable in linked color imaging compared to white light imaging. Conversely, no statistically significant finding was present in signet ring cell carcinoma or mixed-type histology. Linked color imaging provides a significantly greater color difference between cancerous lesions and background noncancerous mucosa in undifferentiated-type early gastric cancer. Moreover, linked color imaging may differentiate between pathologic subgroups of undifferentiated-type early gastric cancer possibly due to characteristic cellular growth pattern.

Screening behaviors and related factors among the first-degree relatives of Chinese patients with gastric cancer

ObjectiveThis study was aimed at investigating the screening behaviors of the first-degree relatives (FDRs) of Chinese patients with gastric cancer as well as the factors influencing screening behaviors. MethodsIn a cross-sectional design, 197 FDRs of patients with gastric cancer were enrolled at the Peking University Cancer Hospital. Four questionnaires were used: a demographic questionnaire, a knowledge questionnaire of risk factors and warning symptoms for gastric cancer, the Gastric Cancer Health Belief Scale, and a questionnaire screening for behavioral motivators and barriers. Logistic regression analysis was performed to determine the factors influencing screening behaviors. ResultsAmong the 197 FDRs of patients with gastric cancer, 30.96% (61/197) of patients had undergone gastric cancer screening. Among those who participated in gastric cancer screening, the most common screening methods were gastroscopy and the Helicobacter pylori testing, both of which were applied in 63.93% (39/61) of participants, followed by serum tumor marker testing (55.74%, 34/61) and barium meal examination of the upper digestive tract (29.51%, 18/61). The gastric cancer risk factor knowledge score was 9.02 ​± ​3.95, and the gastric cancer warning symptom knowledge score was 4.39 ​± ​1.85. The participants’ knowledge score was moderate, at 13.41 ​± ​5.16. The total health beliefs score was low, at 88.91 ​± ​12.66. Factors independently associated with the screening behaviors of FDRs included educational background, knowledge of gastric cancer risk factors, and health motivation (P ​< ​0.05). ConclusionsThe participation rate in gastric cancer screening of FDRs of patients with gastric cancer was relatively low and was affected by multiple factors. Our results highlighted the urgent need for educational campaigns and precision interventions to raise gastric cancer awareness.

Diagnosis and treatment patterns among patients with newly diagnosed Helicobacter pylori infection in the United States 2016–2019

Approximately 36% of the United States (US) population is infected with Helicobacter pylori (HP), a known major risk factor for peptic ulcer disease and gastric cancer. HP eradication reduces the rate of complications; however, the benefits are undermined by rising rates of HP eradication treatment failure. This real-world observational cohort analysis aims to describe HP diagnostic and treatment patterns among insured patients in the US. Using diagnoses, lab results, and treatment patterns, we identified adults (18+) with new diagnoses of HP in the Veradigm Health Insights EHR Database linked to Komodo claims data (1/1/2016–12/31/2019). Patients were required to have ≥ 12 months of data pre-/post-index. We captured patient characteristics, HP-related diagnostic testing, and the use of US guideline-recommended HP eradication regimens. HP eradication rates following first-line eradication treatment were measured among patients with available lab results. Overall, 31.8% of the 60,593 included patients did not receive guideline-recommended treatment. Among the 68.2% (41,340) with first-line treatment, 80.2% received clarithromycin-based triple therapy, and 6.6% received bismuth quadruple therapy. Of the 4569 patients with a repeated course of eradication therapy, 53.4% received the same regimen as their first-line, the majority (90.7%) of whom received two rounds of clarithromycin-based triple therapy. Among the 2455 patients with results of HP non-serology testing following first-line treatment, the 180-day eradication rate was 80.2% overall, with differences based on treatments and demographics. This study highlights gaps between guideline-recommended HP management and real-world patterns, underscoring the need to improve HP testing, treatment, and follow-up practices.

Up-Front Endoscopy Maximizes Cost-Effectiveness and Cost-Satisfaction in Uninvestigated Dyspepsia

Practice guidelines promote a routine noninvasive, non-endoscopic initial approach to investigating dyspepsia without alarm features in young patients, yet many patients undergo prompt upper endoscopy. We aimed to assess tradeoffs among costs, patient satisfaction, and clinical outcomes to inform discrepancy between guidelines and practice. We constructed a decision-analytic model and performed cost-effectiveness/cost-satisfaction analysis over a 1-year time horizon on patients with uninvestigated dyspepsia without alarm features referred to gastroenterology. A RAND/UCLA expert panel informed model design. Four competing diagnostic/management strategies were evaluated: prompt endoscopy, testing for Helicobacter pylori and eradicating if present (test-and-treat), testing for H pylori and performing endoscopy if present (test-and-scope), and empiric acid suppression. Outcomes were derived from systematic reviews of clinical trials. Costs were informed by prospective observational cohort studies and national commercial/federal cost databases. Health gains were represented using quality-adjusted life years. From the patient perspective, costs and outcomes were similar for all strategies (maximum out-of-pocket difference of $30 and <0.01 quality-adjusted life years gained/year regardless of strategy). Prompt endoscopy maximized cost-satisfaction and health system reimbursement. Test-and-scope maximized cost-effectiveness from insurer and patient perspectives. Results remained robust on multiple one-way sensitivity analyses on model inputs and across most willingness-to-pay thresholds. Noninvasive management strategies appear to result in inferior cost-effectiveness and patient satisfaction outcomes compared with strategies promoting up-front endoscopy. Therefore, additional studies are needed to evaluate the drivers of patient satisfaction to facilitate inclusion in value-based healthcare transformation efforts.

Dispepsija u primarnoj zdravstvenoj zaštiti - prikaz slučaja

Dyspepsia is a term originated from the Greek prefix dys-(bad) and the word pepsis (digestion) and it means indigestion. Dyspepsia is a symptom which indicates occasional or constant pain in the region of the upper abdomen or discomfort which is described in the form of early satiety or a feeling of fullness in the stomach. Sometimes it can be accompanied by nausea, vomiting and heartburn. The symptoms of dyspepsia are not specific enough to indicate a particular disease. And if indicated, additional diagnostics are performed in order to prove or rule out a physical disorder. Dyspepsia is a frequent reason for visiting the doctor. About 40% of the world's population has symptoms of dyspepsia, most often the working population aged between 20-40 years, equally in both sexes. About 25% of patients seek doctor's help, while the rest seek help for their problems at a pharmacy. Dyspepsia is the reason for 40% of performed gastroenterology consultations. This article presents the clinical picture, therapeutic and diagnostic course, as well as the outcome of the treatment of a 53-year-old patient who came to the doctor with symptoms of dyspepsia. The symptoms of dyspepsia had lasted for several years before coming to the doctor. During the first examination, an anamnesis was taken, the review of systems was performed, and a basic blood test done in the local Health center. Given that there was no data on the existence of alarming symptoms in this patient, symptomatic therapy and advised change of habits were included, as well as a planned checkup in one month. At the checkup, the patient reported a decrease in frequency and intensity of abdominal pain, so it was decided to perform additional diagnostics: test for Helicobacter pylori, fecal occult blood test, and ultrasound examination of the abdomen. Requested result of FOBT was negative, but the test for Helicobacter pylori was positive. Ultrasound examination revealed the presence of small calculi in the gallbladder, but there were no other significant clinical findings. Eradication therapy for helicobacter infection was included, and an examination by a gastroenterologist for further diagnostics (esophagogastroduodenoscopy) was planned. Gastroscopy findings were described as chronic non-atrophic gastritis, predominantly antral. A follow-up gastroscopy was planned in five-year interval, the patient was given the proton pump inhibitors therapy, as well as dietary instructions. Given that dyspepsia often occurs in clinical practice, it was necessary to make a proper assessment regarding further diagnostics, on the one hand for economic reasons and on the other hand for medical reasons. Here, the decision was made to carry out further diagnostics considering the duration of the health problems, the presence of the problems during symptomatic therapy, the age of the patient and his concerns. Given the absence of alarming symptoms, appointments were scheduled for all examinations, so a complete diagnosis of organic dyspepsia was reached after 13 months.

Atypically Gastric Tumor with Unexpected Evolution: A Case Report

We present the case of a 62 year old male with no relevant medical history, who for the last two months had been complaining of dysphagia for solids and liquids, marked physical fatigue, oliguria. Clinical examination revealed palor and dehydrated skin, as well as a tumoral mass of 10/10 cm palpable in the upper abdomen. Upper digestive endoscopy was performed, showing a vegetant lesion of 6 cm on the gastric angle, with a central ulcer of 4 cm. The oesophagus and duodenum were normal, and Helicobacter pylori test was negative. Histological exam from the gastric lesion revealed diffuse large-cell malignant lymphoid tumoral proliferation, with tumoral cells infiltrating the mucosa between the glands. Immunohistochemical analysis diagnosed B cell lymphoma. CT scan of the thorax, abdomen and pelvis was performed, revealing multiple tumors involving the gastric walls, the posterior parietal peritoneum, the intra-peritoneal fat, the pancreatic tissues and the right antero-inferior mediastinum, as well as multiple adenopathies on both sides of the diaphragm and ascites. We performed paracentesis, and malignant cells were detected in the peritoneal fluid. Bone marrow biopsy was normal. The patient was referred to the hematology department for treatment. He received chemotherapy including CHOP followed by RICE with the disappearance of the gastric tumor on upper endoscopy and the disappearance of peritoneal, mediastinal and pancreatic region tumors with the persistence of a circumferential thickening of the horizontal gastric region walls on CT reevaluation.

Impact of Lactobacillus Reuteri and Three Other Probiotics in Helicobacter Pylori Eradication

Background/Objectives: To assess the effectiveness and safeness of Lactobacillus reuteri and additionally three other probiotics to conventional triple therapy against the Heliobacter pylori.Materials and Methods: We randomly selected 115 H. pylori positive dyspeptic patients, to be treated for 14 days with conventional triple therapy, without and with probiotics. Our first group of 62 patients received conventional triple therapy, while the second group of 53 patients were treated with Lactobacillus reuteri, and Lactobacillus casei, Lactobacillus acidophilus, Bifidobacterium lactis, all encapsulated in PharmaS Helicobalans capsules alongside the triple conventional therapy. One month after completion of treatment, Helicobacter pylori presence was evaluated. If the Helicobacter pylori test would turn out negative, it would prove the success of the eradication.Results: 38 patients of the first group (61,3%) were treated successfully. In the second group, where probiotics were added, the success of eradication was observed in 37 of them (69.8%).Despite the fact that eradication was higher in the second group, the difference between the two sides in terms of statistics was non-significant (p=0.199). As for the side effects of the ordered treatment, 27 patients of the first group (43.5%) had complaints, while the secondary group had 17(32%). Again, there was seen no difference statistically important between two sides.Conclusion: Including probiotics additionally to conventional Helicobacter pylori treatment may decrease the side effects of the therapy, and increase the Helicobacter pylori eradication success. Randomized prospective work on a larger scale is needed.

Statins Enhance the Potency of First Line Anti-Helicobacter Regimens to that of Second Line Regimens

Background: Infection-related to Helicobacter pylori (HP) is one of the most common human bacterial infections, affecting about 50% of the human population. This bacterium causes chronic inflammation and eventually mucosal gastric metaplasia. Antibiotics are commonly used to eradicate Helicobacter pylori infection. Presumably, statins could increase the effectiveness of anti-HP regimens because of some anti-inflammatory and antibacterial properties attributed to these anti-lipidemic agents. Methods: Two hundred patients with both gastrointestinal symptoms and positive urease test were included. Patients were randomly divided into two equal groups with 100 cases. One group received pantoprazole 40 mg, twice per day (BD) + atorvastatin 40 mg, daily + bismuth subcitrate 240 mg, BD + Amoxicillin 1 g, BD + Levofloxacin 500 mg, daily and the other one received pantoprazole 40 mg BD + atorvastatin 40 mg, daily + bismuth subcitrate 240 mg, BD + Amoxicillin 1 g, BD + Clarithromycin (Fromilid) 500 mg, BD for two weeks. A stool antigen test for HP was performed one month after drug treatment ended, and the results were compared. Results: According to our findings, eradication of HP infection in both groups was 87%, and there was no statistically significant difference between the two groups (p-value = 1). Conclusion: The current study highlighted that adding atorvastatin to the first line anti-HP infection regimen could increase the potency and efficacy of the regimen to that of second-line regimen. Moreover, the addition of atorvastatin to the second line regimen did not bear any beneficial effect. Trial registration number: The Ethics Committee of Qom University of Medical Sciences approved the study protocol (ethical code: IR.MUQ.REC.1399.082); the study was also registered in the Iranian Registry of Clinical Trials (No. IRCT20200929048884N1). This study adheres to CONSORT guidelines.