Helicobacter Pylori-positive Patients Research Articles

Effect of concomitant use of esomeprazole on levodopa pharmacokinetics and clinical symptoms in patients with Parkinson's disease

BackgroundProton pump inhibitors (PPIs), which inhibit gastric acid secretion, are frequently prescribed to patients with Parkinson's disease (PD). Levodopa, the gold-standard treatment for PD, demonstrates enhanced solubility in acidic environments. Although PPIs increase gastric pH and may affect levodopa absorption, the effect of concomitant PPI use on levodopa pharmacokinetics in patients with PD remains unknown. This study aimed to investigate the effect of the concomitant use of esomeprazole, a PPI, on the pharmacokinetics of levodopa and carbidopa and clinical symptoms in patients with PD. MethodsWe prospectively enrolled 40 patients with PD and compared the pharmacokinetics of levodopa and carbidopa and clinical symptoms before and two weeks after the concomitant use of esomeprazole. ResultsThe plasma concentrations of levodopa 30 min after concomitant oral administration of levodopa and esomeprazole were significantly lower (4.92 ± 4.10 μmol/L) than those without concomitant esomeprazole use (6.26 ± 3.75 μmol/L; p = 0.027). The plasma concentrations of carbidopa showed no significant differences with respect to concomitant esomeprazole use. Significant elevation was recorded in all subscores of the Movement Disorder Society-sponsored revision of the Unified Parkinson's disease Rating Scale scores after concomitant use of esomeprazole. No significant differences were observed between Helicobacter pylori-negative and Helicobacter pylori-positive patients. Non-elderly patients (age ≤ 70 years) tended to be more susceptible to the effect of esomeprazole on levodopa pharmacokinetics and clinical symptoms. ConclusionsThe unnecessary use of PPIs should be avoided in patients with PD, especially in non-elderly patients, to improve absorption of levodopa.

Molecular Characterization of Antimicrobial Resistance and Virulence Genotyping among Helicobacter pylori-Positive Dyspeptic Patients in North Iran.

Iran has a relatively high prevalence of H. pylori, which correlates with high-risk areas for gastric cancer worldwide. Our study aimed to investigate the underlying genetic mechanisms associated with resistance to metronidazole (frxA, rdxA), clarithromycin (23S rRNA), tetracycline (16S rRNA), and fluoroquinolone (gyrA) in H. pylori-positive dyspeptic patients using PCR and sequencing. We further examined the potential correlation between resistance profiles and various virulence genotypes. The rates of genetic mutations associated with resistance to metronidazole, fluoroquinolone, clarithromycin, and tetracycline were found to be 68%, 32.1%, 28.4%, and 11.1%, respectively. Well-documented multiple antibiotic resistance mutations were detected, such as rdxA and frxA (with missense and frameshift alterations), gyrA (Asp91, Asn87), 23S rRNA (A2142G, A2143G), and 16S rRNA (triple-base-pair substitutions AGA926-928→TTC). The cagA+ and vacA s1/m1 types were the predominant genotypes in our study. With the exception of metronidazole and tetracycline, no significant correlation was observed between the cagA+ and cagL+ genotypes and resistance-associated mutations. The prevalence of antibiotic resistance-associated mutations in H. pylori was remarkably high in this region, particularly to metronidazole, ciprofloxacin, and clarithromycin. By conducting a simultaneous screening of virulence and resistance genotypes, clinicians can make informed decisions regarding the appropriate therapeutic regimen to prevent the escalation of antibiotic resistance against H. pylori infection in this specific geographical location.

Single-Arm, Prospective, Interventional Study of Helicobacter pylori Eradication Rescue Therapy with Rifabutin, Metronidazole, and Vonoprazan.

Background and Objective: Rescue Helicobacter pylori eradication can be challenging. Rifabutin (RBT) demonstrates high activity against Helicobacter pylori and is incorporated into various rescue eradication regimens. This exploratory study was performed to evaluate the efficacy and safety of a rescue regimen comprising RBT, metronidazole (MNZ), and vonoprazan (VPZ). Methods: This prospective, single-center, single-arm, interventional study was performed in Japan. Eligible patients were those who underwent failed primary eradication treatment (7-day treatment with three drugs: VPZ or a proton pump inhibitor [PPI], amoxicillin [AMPC], and clarithromycin) and secondary eradication treatment (7-day treatment with three drugs: VPZ or a PPI, AMPC, and MNZ) and those who were unable to receive first- and second-line therapy because of penicillin allergy. Twenty Helicobacter pylori-positive patients were treated with RBT (150 mg twice daily), MNZ (250 mg twice daily), and VPZ (20 mg twice daily) for 10 days (RBT-MNZ-VPZ therapy). Eradication success was evaluated using the urea breath test. Drug susceptibility test results were available in 16 patients. This study is registered in the Japan Registry of Clinical Trials (jRCT031220504). Results: The intention-to-treat (ITT) and per-protocol (PP) eradication rates of RBT-MNZ-VPZ therapy were 70% (90% confidence interval [CI]: 49.2%-86.0%) and 72.2% (95% CI: 50.2%-88.4%), respectively. In the MNZ-susceptible subgroup, the ITT (n = 8) and PP (n = 7) eradication rates were 100% (90% CI: 68.8%-100%) and 100% (90% CI: 65.2%-100%). In the MNZ-resistant subgroup, the ITT (n = 8) and PP (n = 7) eradication rates were both 62.5% (90% CI: 28.9%-88.9%). All infections were RBT-susceptible. Conclusions: These findings suggest that RBT-MNZ-VPZ therapy may be a promising rescue regimen, especially in MNZ- and RBT-susceptible infections or patients with penicillin allergy.

Metabolic Factors Associated with Endoscopic Atrophy, Intestinal Metaplasia, and Gastric Neoplasms in Helicobacter pylori-Positive Patients.

Previous studies demonstrate an association between metabolic factors and Helicobacter pylori-related gastric cancer. However, the association of gastric atrophy or intestinal metaplasia (IM) with these factors remains unknown. Data on 1603 Helicobacter pylori-positive patients who underwent esophagogastroduodenoscopy between 2001 and 2021 were evaluated. The outcome measures were endoscopic atrophy, IM grade, and the incidence of endoscopically diagnosed and pathologically confirmed gastric neoplasms. Clinical factors associated with these findings were also determined. Advanced age; successful Helicobacter pylori eradication; and comorbidities including diabetes mellitus (DM), hypertension, dyslipidemia, and fib4 index were significantly associated with endoscopic gastric atrophy grade. Male sex; advanced age; and comorbidities including DM, hypertension, dyslipidemia, hyperuricemia, fatty liver, aortic calcification, and fib4 index were also significantly associated with endoscopic IM grade, whereas advanced age, successful Helicobacter pylori eradication, DM, fatty liver, and fib4 index were significantly associated with the incidence of gastric neoplasms. Several metabolic disorders, including DM, hypertension, dyslipidemia, hyperuricemia, and fatty liver disease, are risk factors for advanced-grade gastric atrophy, intestinal metaplasia, and gastric neoplasms. Risk stratification according to these factors, particularly those with metabolic disorders, would affect EGD surveillance for Helicobacter pylori-positive patients.

Helicobacter pylori in gastrointestinal manifestation of systemic sclerosis.

To study the prevalence of Helicobacter pylori in systemic sclerosis patients and its gastrointestinal manifestations in comparison with Helicobacter pylori-negative systemic sclerosis patients. Systemic sclerosis gastrointestinal outcome post Helicobacter pylori eradication was evaluated. In total, 70 systemic sclerosis patients and 70 age-, gender- and race-matched healthy controls had their urea breath test done. Gastrointestinal manifestations in systemic sclerosis were assessed using University of California at Los Angeles 2.0 and Leeds Dyspepsia Questionnaire questionnaires. Systemic sclerosis patients with confirmed Helicobacter pylori infection were given standard Helicobacter pylori eradication therapy. Urea breath test was repeated 6 weeks posteradication therapy with their gastrointestinal symptoms reassessed. The prevalence of Helicobacter pylori was low in both systemic sclerosis patients (10%) and healthy controls (2.9%). There was no significant difference in gastrointestinal symptoms between Helicobacter pylori-positive and Helicobacter pylori-negative systemic sclerosis patients. However, the Helicobacter pylori-positive patients reported higher median severity scores for the gastrointestinal symptoms of reflux (0.5 vs 0.35), abdominal distension (1.5 vs 0.75) and social functioning impairment score (0.5 vs 0.16) using the University of California at Los Angeles 2.0 score. The Helicobacter pylori-positive patients also indicated increased upper abdominal pain (3.0 vs 0.0), regurgitation (2.0 vs 0.0) and burping (3.0 vs 0.0), observed from the Leeds Dyspepsia Questionnaire scores. Gastrointestinal outcomes post-Helicobacter pylori eradication showed either an improvement or complete resolution of symptoms. Gastrointestinal symptoms in systemic sclerosis patients are unlikely to be caused by Helicobacter pylori in the recent years in our cohort of patients. No significant difference in gastrointestinal symptoms was seen between Helicobacter pylori-positive and Helicobacter pylori-negative systemic sclerosis patients. Helicobacter pylori can be readily tested by urea breath test to look for present infection.

Serum high sensitive C-reactive protein level and its correlation with lipid profile among dyspeptic patients with or without Helicobacter pylori infection in East Gojjam zone, Ethiopia.

Dyspepsia is a group of symptoms located in the gastroduodenal area of the upper gastrointestinal tract characterized by epigastric pain, postprandial completeness, or early satiety and occasionally related to heartburn. Helicobacter pylori is the major causative agent of dyspepsia and gastric-related disorders; besides, it alters different metabolic processes in the human body, such as lipid metabolism and inflammatory processes. Even though dyslipidemia and inflammation are independent risk factors for cardiovascular disorders, we are assessing the interaction between serum lipids and highly sensitive C reactive protein levels among dyspeptic patients to predict potential cardiovascular disorders. To assess serum high sensitive C reactive protein levels and its correlation with lipid profile among dyspeptic patients. A hospital-based comparative cross-sectional study was conducted from May 2022 to March 2023 in East Gojjam, Ethiopia. One hundred Helicobacter pylori-positive and 100 Helicobacter pylori-negative dyspeptic patients were included. Data were checked for completeness and entered into SPSS version 26.0 software and analyzed. The association between variables was determined by Pearson correlation analysis. A p-value <0.05 was considered statistically significant. The mean serum high sensitive C reactive protein was 8.09 ± 7.84 mg/L, and serum high-density lipoprotein, low-density lipoprotein, total cholesterol, and triglyceride were (35.35 ± 7.5, 105.07 ± 87.63, 142.31 ± 71.31, 160.07 ± 43.06) mg/dl, respectively, for Helicobacter pylori positive dyspeptic patients. Among these values, high-density lipoprotein is negatively correlated with high sensitive C reactive and total cholesterol is positively correlated with high sensitive C reactive levels among Helicobacter pylori-infected dyspeptic patients with a p-value < 0.05, but in Helicobacter pylori negative dyspeptic patients, there is no significant correlation between lipid profile and high sensitive C reactive levels. Serum high sensitive C reactive levels had a negative correlation with high-density lipoprotein and a positive correlation with total cholesterol among Helicobacter pylori-positive dyspeptic patients. Therefore, the significant interaction between serum lipid levels and inflammation exacerbates the potential risk of cardiovascular disorders among Helicobacter pylori-positive dyspeptic patients.

RESEARCH ON THE DETECTION OF HELICOBACTER PYLORI IN SALIVA OF GASTRITIS AND DUODENITIS PATIENTS BY REAL-TIME PCR TECHNIQUE

Background: Helicobacter pylori plays an important role in the etiology and pathogenesis of gastritis and duodenitis. There are two groups of test methods to detect Helicobacter pylori infection: invasive methods and non-invasive methods. Testing for Helicobacter pylori in saliva by real-time PCR technique belongs to group of non-invasive test methods. Objectives: To determine the detection rate of Helicobacter pylori in saliva by real-time PCR technique in gastritis and duodenitis patients and to investigate some factors related to Helicobacter pylori infection detected in saliva using real-time PCR technique in gastritis and duodenitis. Materials and method: A cross-sectional descriptive study on 91 patients after convenient sampling was preliminarily diagnosed with gastritis and duodenitis with indications for endoscopy and biopsy. Biopsy specimens were used for urease and histopathology tests. Saliva is taken directly from the mouth after spitting into a dedicated bottle and conducting a real-time PCR test. Gene amplification will be performed with a PYLORI-PCR mix containing primers and for the expected target product of 203 base pairs length: 5' - AGCGCTCTCACTTCCATAGGC - 3' and 5' - TCTTCGGTTAAAAAAGCGAT - 3'. Install the program "Protocol" for the Real-time PCR machine to operate with the following cycles: 1 cycle: 950C for 5 minutes; 40 cycles: 950C for 15 seconds, 550C for 1 minute and 720C for 20 seconds. Results: The positive rate for Helicobacter pylori in saliva by realtime PCR technique, urease test and histopathology were 20.9%, 19.8% and 46.2% respectively. The detection rate of H. pylori by real-time PCR in saliva and the detection rate on urease test as well as histopathology had a statistically significant correlation. A few important factors related to Helicobacter pylori-positive patients in saliva as follows: personal history suffer from gastritis and duodenitis 40.7%, reflux esophagitis 67%, and congestive inflammation 75.8%. Conclusions: The rate of detecting Helicobacter pylori in saliva by real-time PCR technique in gastritis and duodenitis patients in Can Tho University of Medicine and Pharmacy Hospital is higher than urease test and lower than histopathology.

Efficacy of a standardised herbal formulation in Helicobacter pylori positive patients with gastritis or peptic ulcer: a triple-blind randomised clinical trial

IntroductionPistacia atlantica subsp. kurdica and Quercus brantii are traditionally used for various gastrointestinal disorders. This study aimed to evaluate the effects of herbal formulation from these two herbs on Helicobacter pylori infection, as well as undertake phytochemical analysis. MethodsA total of 78 H pylori-infected patients were enroled in this triple-blind randomised clinical trial and divided into two equal groups. The intervention and control groups received herbal formulation and placebo capsules once a day besides conventional therapy for 2 weeks, respectively. Patients were asked regarding their clinical symptoms at baseline, 2 weeks, and 3 months after the start of treatment. Also, the urea breath test was applied to assess the effects of herbal formulation 3 months after the start of treatment, which showed a significantly higher rate of H pylori eradication in the intervention group. ResultsWe found that the frequency of clinical symptoms was significantly lower in the intervention group 2 weeks after the start of the study. As well, the standardisation of the herbal formulation was performed according to volatile and nonvolatile compounds by GCMS/FID (gas chromatography mass spectrometry/flame ionization detector) and HPLC-PDA (high pressure liquid chromatography/photodiode array). ConclusionsGenerally, our results confirm the beneficial effects of herbal formulation on H pylori infection in line with its local application. Trial registrationIRCT20120215009014N233.

The relationship between colorectal polyps and colon cancer with Helicobacter pylori infection

Background: Our aim in this study is to determine the relationship among Helicobacter pylori (HP) with colon cancer and colorectal polyps. Thus, colorectal cancers (CRC) can be diagnosed at an early stage, the progression of the disease can be prevented and a contribution can be made to prolonging the life span of the patients. Methods: The 75 patients as the case group and 150 patients as the control group were included in the study. Patients with family history of CRC and clinical symptoms who had total colonoscopy in a tertiary hospital between 31/09/2021 and 31/03/2022 and underwent gastroscopic gastric biopsy and evaluated for HP were included. The patients were divided into three groups as patients with colorectal polyps, CRC and normal patients. Results: HP positivity was more common in patients with cancer history than those without cancer history (p&lt;0.001). In the analyzes performed, HP positivity was more common in patients with cancer than in patients without cancer (p&lt;0.001). Concordantly, more polyps were detected in HP positive patients than in non-HP patients (p=0.001). In the analyzes performed, HP infection was significantly higher in patients with CRC and colorectal polyps compared to normal controls. Conclusions: HP positive patients can be evaluated in terms of CRC and colorectal polyp.

Is Helicobacter pylori infection associated with osteoporosis? a systematic review and meta-analysis.

This study used systematic review and meta-analysis to evaluate the association between Helicobacter pylori infection and osteoporosis. PubMed, Ovid and Web of Science were searched to include observational studies published in English comparing bone mineral density changes between Helicobacter pylori-positive and -negative participants. The quality of the included literature was assessed using the Newcastle-Ottawa Quality Assessment Scale (NOS). R software was used for meta-analysis, and odds ratio (OR) and 95% confidence interval (CI) were calculated to evaluate the relationship between Helicobacter pylori infection and osteoporosis. Twenty-two studies involving 24,176 participants were included in the study. Our meta-analysis showed that Helicobacter pylori infection was significantly associated with the risk of osteoporosis (OR: 1.12, 95%CI: 1.03, 1.22). Participants infected with the CagA-positive Helicobacter pylori strain were more likely to develop osteoporosis (OR = 1.42, 95%CI: 1.09; 1.85). Infection with Helicobacter pylori, particularly the CagA-positive strain, has been associated with an increased risk of osteoporosis. The bone health of Helicobacter pylori-positive patients deserves more attention.

Characteristics of basal gastric juice in Helicobacter pylori-associated gastritis before and after eradication therapy

Purpose: To evaluate the characteristics of basal gastric juice in Helicobacter pylori-positive patients before and after Helicobacter pylori eradication therapy. &#x0D; Methods: This was a cross-sectional descriptive study on 150 gastritis patients admitted at the Hospital of Can Tho University of Medicine and Pharmacy. The patients were divided into 2 groups: study group (Helicobacter pylori gastritis patients) and control group (non-Helicobacter pylori gastritis patients). The pH, HCO3- concentration, and activities and concentrations of pepsin, lipase, and amylase were determined before and after treatment in study group. &#x0D; Results: Patients with abnormal gastric juice comprised 76 % of the study population. Mean gastric potential of hydrogen (pH) was 2.31 (range: 1.64 - 7.68), while median concentration of HCO3- was 4.06 mmol/L (range: 0 - 73.04 mmol/L). The concentrations of pepsin, lipase, and amylase were 8.93, 0.93 and 1.38 ppm, respectively. Activities of pepsin, lipase, and amylase were 2.23, 0.28 and 0.04 U/mL, respectively. After the successful eradication of Helicobacter pylori, pH and HCO3- levels decreased, and there were significant differences in activities of pepsin and lipase before and after treatment (p &lt; 0.05). Moreover, the levels of these parameters differed between patients in whom successful eradication was achieved and those in whom eradication failed (p &lt; 0.05). The concentrations and activities of pepsin and lipase were statistically different between pre-treatment and post-treatment stages in both successful and failed Helicobacter pylori eradication categories (p &lt; 0.05). &#x0D; Conclusion: Basal gastric juice differs significantly between Helicobacter pylori-positive and Helicobacter pylori-negative patients. Intragastric ammonia produced by H. pylori may have a role in the increased pH of gastric juice.

Analysis of oral microbiota alterations induced by Helicobacter pylori infection and vonoprazan-amoxicillin dual therapy for Helicobacter pylori eradication.

The oral cavity is considered a potential reservoir of Helicobacter pylori (H.pylori), and the imbalance of oral microbiota directly reflects the health of the host. We aimed to explore the relationship among oral microbiota, H.pylori infection, and vonoprazan-amoxicillin (VA) dual therapy for H.pylori eradication. Helicobacter pylori-positive patients were randomized into low- or high-dose VA dual therapy (i.e., amoxicillin 1g b.i.d. or t.i.d. and vonoprazan 20 mg b.i.d) for 7 or 10 days. H.pylori-negative patients served as normal controls. Saliva samples were collected from 41 H.pylori-positive patients and 13 H.pylori-negative patients. The oral microbiota was analyzed by 16S rRNA gene sequencing, followed by bioinformatics analysis. Helicobacter pylori-positive patients had higher richness and diversity and better evenness of oral microbiota than normal controls. Beta diversity analysis estimated by Bray-Curtis or weighted UniFrac showed distinct clustering between H.pylori-positive patients and normal controls. The number of bacterial interactions was reduced in H.pylori-positive patients compared with that in negative patients. Forty-one patients evaluated before and after successful H.pylori eradication were divided into low (L-VA) and high dose (H-VA) amoxicillin dose groups. The alpha and beta diversity of the oral microbiota between L-VA and H-VA patients exhibited no differences at the three time points (before eradication, after eradication, and at confirmation of H.pylori infection cure). Helicobacter pylori infection could alter the diversity, composition, and bacterial interactions of the oral microbiota. Both L-VA and H-VA dual therapy showed minimal influence on the oral microbiota.

Prevalence and Relationship between Helicobacter pylori infection and Obesity in the Kurdish population

Background: Globally obesity is a commonly health condition. A great number of investigators have been studying the association between Helicobacter pylori (H. pylori) infection and obesity. It’s also known that H. pylori causes inflammation within the mucosa of the stomach which is known as gastritis. However, due to the arguable data in the literature, the relationship between H. Pylori and obesity remains debatable and there is no comprehensive proof for the association.&#x0D; Objective: To study the Prevalence and Relationship between Helicobacter pylori infection and Obesity.&#x0D; Methods: In this study 200 subjects were contributed, including 100 patients positive tested with H.pylori and 100 healthy participants with negative serological test for H. pylori infection. The data were collected in different places in the Kurdistan region of Iraq including Rizgary Hospital in Erbil and Alaa laboratory in Soran city and other places around Erbil Provence. The body mass index was calculated by measuring the weight in kg and length of participants in cm. Furthermore, all subjects filled in a self-administered questionnaire to collect more detailed data about the subjects. Descriptive and inferential statistics were obtained using statistical analysis programs including SPSS and GraphPad prism.&#x0D; Results: The prevalence of obesity is significantly higher in Helicobacter pylori-positive patients compared to the control in young age persons, and the result showed also that H. pylori positive group are consuming significantly more fast food and have a higher BMI compared to control group.&#x0D; Conclusion: Our result significantly indicates an association between H. Pylori infection and overweight/obesity examined in the case-control study in the Kurdish population.

Eradication rate and safety of a "simplified rescue therapy": 14-day vonoprazan and amoxicillin dual regimen as rescue therapy on treatment of Helicobacter pylori infection previously failed in eradication: A real-world, retrospective clinical study in China.

BackgroundThe currently recommended quadruple regimens as rescue therapy on Helicobacter pylori infection were not as effective as being supposed, especially in those who had failed two or more times. Dual regimen composed of vonoprazan (a potassium‐competitive acid blocker) and amoxicillin might be an option since it's effective in eradication therapy as first‐line treatment.ObjectiveAs a real‐world retrospective study, data were collected to evaluate the efficacy and safety of vonoprazan and amoxicillin dual regimen as rescue therapy in Helicobacter pylori positive patients who had failed one or more times in their previous treatment.MethodsFrom May 2020 to June 2021, the clinical data of patients who had failed in Helicobacter pylori infection treatment were collected in GI department of Peking University First Hospital, Beijing, China. Patients were given vonoprazan 20 mg or 40 mg per day and amoxicillin 3000 mg per day (VA dual therapy) for 14 days as rescue treatment. Helicobacter pylori status was evaluated by 13C‐urease breath test 6 weeks after treatment. All adverse effects during treatment were recorded.ResultsA total of 186 patients were enrolled, including 67 males and 119 females. All of them had failed for 1 ~ 7 times in their previous treatment. Successful eradication was achieved in 172 patients (92.5%, 172/186). The adverse effects (referring to skin rash, abdominal pain, diarrhea, and headache), mainly mild and did not cause quit of treatment, occurred in 14 patients (7.5%, 14/186) and all symptoms relieved spontaneously.ConclusionsDual regimen composed of vonoprazan and amoxicillin for 14 days was effective and safe as rescue therapy in Helicobacter pylori infection treatment. It could be chosen as a “simplified rescue therapy” with relatively high eradication rate no matter how many times the patients had failed and what regimens they had used previously.

A multi-center, randomized controlled study on the effect of Saccharomyces boulardii combined with triple therapy for the initial eradication of Helicobacter pylori infection

Objective: To assess the efficacy and safety of Saccharomyces boulardii (S. boulardii) in combination with triple therapy as a first-line regimen for the eradication of Helicobacter pylori (H. pylori) in non-ulcer dyspepsia (NUD) patients. Methods: A total of 497 Helicobacter pylori-positive patients who underwent gastroscopy and diagnosed with NUD were enrolled from June 2018 to January 2020 in 9 medical centers across China. Participants were segmentedly randomly divided into 3 groups. Patients in group A received S. boulardii for 14 days and triple therapy for 10 days, while patients in group B received bismuth quadruple group for 10 days, and patients in group C received triple therapy for 10 days. The H. pylori status was determined by the 13C-urea breath test on the 44th day of the treatment. Symptom improvement and adverse reactions were assessed on the 14th and 44th day. Results: There were 229 males and 268 females in all 497 patients enrolled. They were aged 18-69 (46.1±11.8) years and 472 of them (158 cases in group A, 159 cases in group B, and 155 cases in group C) completed the trial. The intention-to-treat (ITT) eradication rates in patients in patients A, B and C were 77.8% (126/162), 80.1% (137/171) and 65.2% (107/164) respectively, and per protocol-based (PP) eradication rates were 79.7% (126/158), 86.2% (137/159) and 69.0% (107/155) respectively. The differences were statistically significant in ITT and PP analysis among 3 groups (ITT: χ²=11.14, P<0.01; PP: χ²=13.86, P<0.01). There was no significant difference between eradication rates of two quadruple therapys(all P>0.05), but both of them were significantly higher than that of standard triple therapy (both P<0.05). Statistics revealed that both quadruple therapys led to significantly higher symptom improvement of belching compared with that of standard triple therapy in day 14 (P<0.05). The relief of abdominal distension and belching symptom scores of group A were significantly higher than those of group C in day 44(all P<0.05). There was no serious adverse event reported. The incidence of diarrhea in group A was significantly lower than those in the other two groups (both P<0.05). Conclusions: The combination of S. boulardii and triple therapy can achieve a better eradication effect on H. pylori infection with NUD, and has advantages in symptom relief and safety.

Dynamics of Oxidative Stress in Helicobacter pylori-Positive Patients with Atrophic Body Gastritis and Various Stages of Gastric Cancer.

Gastric cancer is a global health problem. The pathogenesis of this disease remains unclear. This study included 198 H. pylori (+) men aged 45 to 60 years old. Group A included 63 practically healthy men, group B included 45 men with severe atrophic body gastritis, group C included 37 men with epithelial gastric cancer stages I–II according to TNM, and group D included 54 men with epithelial gastric cancer stages III–IV according to the TNM scale. The content of malondialdehyde (MDA), diene conjugates (DCs), superoxide dismutase (SOD), catalase (CAT), glutathione S-transferase (GST), and glutathione peroxidase (GPO) was detected using an enzyme immunoassay (ELISA) or spectrophotometric methods in the blood plasma. The concentrations of MDA and DC were increased in the patients of group B compared with group A, and in patients of groups C and D compared with groups A and B. The ratio of MDA/SOD and MDA/CAT was decreased in the patients in group D compared with the patients in group C, and was significantly higher compared with group A. The ratios of MDA/GPO and MDA/GST increased linearly and were at a maximum in groups C and D. Our work determined that indicators of oxidative stress may be the biochemical substrate, which brings together the various stages of the Correa cascade, and may explain disease progression. The dynamics of changes in the content of SOD and CAT in the plasma in patients with gastric cancer may be a target of future investigations.

Serum Levels of Interleukin-2 and Interleukin-6 among Helicobacter Pylori Positive Patients in Relation to Prognosis of Gastro-duodenal Disease

Background: Helicobacter pylori is the most widespread pathogenic associated with gastro-duodenal Disease. Interleukin 2 and interleukin 6 are the main cytokines involved in host immune response to H.pylori infection. The aim of the present study are to assess the serum level of IL-6 and IL–2 in H.pylori infected patients and to study their association with gastric endoscopy findings. Methods: One hundred and seven suspected patients and 19 healthy were recruited. The confirmed positivity of H.pylori detection was based on a rapid urease test (R.U.T) and stool antigen test. Serum concentrations of IL-2 and IL-6 were measuring by ELISA. Results: Seventy-five (70%) patients were positive for H.pylori. Both interleukins were found at higher levels in patients than in healthy (p- value &lt;0.05). Interestingly, the level of IL-2 was lower in patients infected with H.pylori (43.40 pg/ml) than those who were not infected (85.2 pg/ml), while the level of IL-6 was higher in patients infected with H.pylori (117 pg/ml) than those not infected (40 pg/ml), p-value &lt;0.05. Furthermore, the increasing levels of both interleukins were correlated with disease progress.

High prevalence of esophagitis in patients with severe ineffective esophageal motility: need for a new diagnostic cutoff.

BackgroundA new classification criterion for diagnosing ineffective esophageal motility (IEM) was proposed at the 2018 Stanford symposium, but limited data exists about the utility of this criterion.MethodsWe conducted a cross-sectional study among 3826 patients treated at the Institute of Gastroenterology and Hepatology, Hanoi, Vietnam, between March 2018 and May 2020. Patients were classified as having normal motility, mild IEM, severe IEM, or absent contractility based on the Chicago classification version 3.0 and the new IEM criterion (severe IEM was defined as having >70% ineffective swallows). We examined the association between these 4 motility subgroups and the presence of erosive esophagitis and Barrett’s esophagus, using multivariate logistic regression analysis.ResultsThe mean age of the study sample was 44.7 years and 66.3% were women. The prevalence of symptoms, hiatal hernia, and Helicobacter pylori-positive patients was similar in the 4 study groups. The 4-second integrated relaxation pressures and lower esophageal sphincter resting pressures were lower in patients with severe IEM and absent contractility. Severe IEM and absent contractility, but not mild IEM, were significantly associated with Los Angeles (LA) grade B-D esophagitis (relative risk ratio [RRR] for severe IEM 1.81, 95% confidence interval [CI] 1.17-2.80; and RRR for absent contractility 2.37, 95%CI 1.12-5.04). None of the hypomotility subgroups were associated with LA grade A esophagitis and Barrett’s esophagus.ConclusionsPatients with severe IEM have a high prevalence of severe erosive esophagitis. These findings suggest the need for a more meaningful classification criterion for IEM.

The Relationship Between Arterial Stiffness and Helicobacter Pylori Infection

Abstract&#x0D; Aim:Studies have found the association of Helicobacter Pylori (Hp) seropositivity with cardiovascular diseases and it has been shown that chronic inflammation with Hp may be related to early atherosclerosis. The aim of this study is to evaluate the relationship between Hp positivity detected by endoscopic gastric biopsy and arterial stiffness.&#x0D; Material and Method: In this cross-sectional study, patients were divided into 2 groups as Hp positive (n=48) and Hp negative (n=61) according to endoscopic gastric biopsy findings. Augmentation index, arterial stiffness and central blood pressure were measured using Pulse wave velocity analysis/Ambulatory blood pressure monitoring in all patients.&#x0D; Results: Augmentation index was significantly higher in the Hp positive group (p=0.020). There was no correlation between central blood pressure and augmentation index and the intensity of Hp colonization (p=0.070, r=0.263). However, logistic regression analysis revealed that positive Hp (OR: 3.593, 95%CI: 1.341-9,629, p=0.011) was the only variable predictive for an augmentation index &gt; 24.9 among variables including, age, BMI, systolic and diastolic blood pressure, central blood pressure, glucose, creatinine, total cholesterol, C-reactive protein, and positive Hp. &#x0D; Conclusion: Helicobacter Pylori positive patients with confirmed biopsy have an increased arterial stiffness. Moreover, presence of Hp infection is predictive for an increased arterial stiffness. Regarding the diversity and frequency of Hp worldwide long term follow up studies with larger sample size are needed to elaborate the mechanism of this relationship.

S1197 Diagnostic Accuracy of Neutrophils to Lymphocytes Ratio in Predicting Non Alcoholic Fatty Liver Disease in Helicobacter pylori Positive Patients

Introduction: Non-alcoholic fatty liver disease (NAFLD) is a multifactorial disorder and most frequently associated to obesity, diabetes mellitus, dyslipidemia and metabolic syndrome. Recently, there has been a special focus on role of Helicobacter Pylori (HP) in development of NAFLD, non-alcoholic steatohepatitis (NASH) and liver cirrhosis. Moreover, the pathogenesis of HP with NAFLD is not clearly defined. We aimed to determine the diagnostic accuracy of Neutrophils to Lymphocytes ratio (NLR) in predicting NAFLD in helicobacter pylori infected patients. Methods: All patients with H.pylori infection were enrolled in the study. A fasting percutaneous abdominal ultrasound was performed in all the patients. Baseline neutrophil and lymphocyte count per microliter were evaluated from complete blood count and ratio was calculated. All the data was entered and analyzed by Statistical Package for the Social Sciences (SPSS) version 20.0. Area under the curve (AUC), sensitivity, specificity, positive predictive value, negative predictive value for the cut-offs of NLR were calculated. Results: In 98 patients; 52 (53.1%) are females with mean age of 38.3 ± 11.7 years. At presentation, 63(64.2%) patients had dyspeptic symptoms for more than 2 months. Comorbidities like diabetes was seen in 14 (14.2 %) and hypertension in 8 (8.16%) patients respectively. On ultrasound, fatty liver was seen in 76 (77.6%) patients. Mean neutrophil count was statistically significantly higher (59.9 vs 54, p = 0.09) while mean lymphocyte was lower in fatty liver group as compared to without (27.3 vs 32.8, p = 0.02). NLR was statistically significantly raised in patients with fatty liver disease (3.2 vs 1.9, p = 0.04). AUC of NLR score was 0.70. At a cut off of 1.69, the sensitivity, specificity, NPV and PPV were 82.89%, 40.91%, 82.89% and 40.91% respectively for NLR with diagnostic accuracy of 73.47% in predicting fatty liver disease in H. Pylori positive patients. Conclusion: Neutrophil to lymphocyte ratio is a sensitive in predicting fatty liver disease in patients with helicobacter pylori infection.