Helicobacter Pylori In Saliva Research Articles

RESEARCH ON THE DETECTION OF HELICOBACTER PYLORI IN SALIVA OF GASTRITIS AND DUODENITIS PATIENTS BY REAL-TIME PCR TECHNIQUE

Background: Helicobacter pylori plays an important role in the etiology and pathogenesis of gastritis and duodenitis. There are two groups of test methods to detect Helicobacter pylori infection: invasive methods and non-invasive methods. Testing for Helicobacter pylori in saliva by real-time PCR technique belongs to group of non-invasive test methods. Objectives: To determine the detection rate of Helicobacter pylori in saliva by real-time PCR technique in gastritis and duodenitis patients and to investigate some factors related to Helicobacter pylori infection detected in saliva using real-time PCR technique in gastritis and duodenitis. Materials and method: A cross-sectional descriptive study on 91 patients after convenient sampling was preliminarily diagnosed with gastritis and duodenitis with indications for endoscopy and biopsy. Biopsy specimens were used for urease and histopathology tests. Saliva is taken directly from the mouth after spitting into a dedicated bottle and conducting a real-time PCR test. Gene amplification will be performed with a PYLORI-PCR mix containing primers and for the expected target product of 203 base pairs length: 5' - AGCGCTCTCACTTCCATAGGC - 3' and 5' - TCTTCGGTTAAAAAAGCGAT - 3'. Install the program "Protocol" for the Real-time PCR machine to operate with the following cycles: 1 cycle: 950C for 5 minutes; 40 cycles: 950C for 15 seconds, 550C for 1 minute and 720C for 20 seconds. Results: The positive rate for Helicobacter pylori in saliva by realtime PCR technique, urease test and histopathology were 20.9%, 19.8% and 46.2% respectively. The detection rate of H. pylori by real-time PCR in saliva and the detection rate on urease test as well as histopathology had a statistically significant correlation. A few important factors related to Helicobacter pylori-positive patients in saliva as follows: personal history suffer from gastritis and duodenitis 40.7%, reflux esophagitis 67%, and congestive inflammation 75.8%. Conclusions: The rate of detecting Helicobacter pylori in saliva by real-time PCR technique in gastritis and duodenitis patients in Can Tho University of Medicine and Pharmacy Hospital is higher than urease test and lower than histopathology.

A visual detection assay for Helicobacter pylori in saliva based on recombinase-aided amplification and peptide nucleic acid-assisted split DNAzyme probes

Helicobacter pylori (H. pylori) infection can cause gastritis, gastric ulcer and even gastric cancer. It was therefore listed as a class Ⅰ carcinogen in 2007. H. pylori infection is also widespread in the world but is easy to be eradicated. Therefore, the timely diagnosis of H. pylori infection is significantly important. In this study, a visual detection assay for H. pylori in saliva based on recombinase-aided amplification (RAA) and peptide nucleic acid-assisted split DNAzyme probes was developed. The sampling was easy and the whole detection could be finished in 100 min with low dependence on incubation equipment. The detection results could be qualitatively identified by naked eyes and visual analysis based on ImageJ software, and quantitatively analyzed by spectrophotometry in the range of 0 – 10^5 CFU/mL H. pylori and the limit of detection is low to 0.105 CFU/mL. Thus, with the advantages of easy sampling, low equipment dependence and high sensitivity, the visual detection assay for H. pylori in saliva developed in this study could help control H. pylori infection.

A visual denaturation bubble-mediated strand exchange amplification and RGB visual analysis-based assay for quantitative detection of Helicobacter pylori in saliva.

Helicobacter pylori (H. pylori) is a class I carcinogen causing gastric cancer. Almost 50% of people on earth have been infected and it is worse in developing countries. Early diagnosis of H. pylori infection is the most important strategy for preventing the spread and worse consequences. H. pylori can be isolated from human saliva, and the sampling of saliva is easy and convenient. Therefore, we developed a visual denaturation bubble-mediated strand exchange amplification and RGB visual analysis-based assay for quantitative detection of H. pylori in saliva in this study. Under the optimized reaction temperature and time, the SEA reaction could be finished in 30min with a simple reaction system and low dependency on equipment. The detection results could be qualitatively identified by the naked eye and quantitatively analyzed by a developed RGB visual analysis method. The limit of detection (LOD) of RGB visual analysis was 10.8CFU/mL. This assay had good specificity and anti-interference capacity. In the artificial contamination test, the recovery rate of our assay was between 99.3% and 111.5%, with RSD values ranging from 1.7% to 3.5%. These indicated our assay also had good reliability in the detection of saliva. We believe this assay showed good potential for better non-invasive diagnosis of H. pylori infection.

A time-resolved fluorescent microsphere-lateral flow immunoassay strip assay with image visual analysis for quantitative detection of Helicobacter pylori in saliva

Helicobacter pylori (H. pylori) is a kind of microaerobic and food-borne pathogen. More than 4.4 billion individuals have been infected by H. pylori and H. pylori was listed as Group I carcinogen by WHO in 1994. Considering the high infection rate of H. pylori and the limited medical resources, self-testing is helpful for diagnosis and timely treatment. Although the amount of H. pylori in human saliva is low, the sampling of saliva is simple and convenient compared with stomach, blood and stool samples. Therefore, H. pylori in human saliva can be an indicator for self-testing, and a sensitive and easy-to-use assay is necessary. In this study, we developed a time-resolved fluorescent microsphere-lateral flow immunoassay (TRFM-LFIA) strip assay with image visual analysis for detection of H. pylori in saliva. The detection of the TRFM-LFIA strip was easy to use and had a low dependency on equipment. With optimized preparation and detection parameters, the whole detection process could be finished in 8 min and the LOD by naked eyes was 102 CFU/mL. For quantitative analysis by image visual analysis, the LOD was as low as 1.05 CFU/mL in the linear range of 101–105 CFU/mL. Besides, the TRFM-LFIA strip also had good stability, reliability, repeatability and accuracy. All these advantages indicated that the TRFM-LFIA strips developed in this study had a good potential for self-testing for H. pylori infection.

Detection of Helicobacter Pylori in Saliva and Oral Swab Versus Biopsy Samples Using Urease Test, Culture, PCR Technique

The aim of this study was to compare between different methods in identifying Helicobacter pylori in saliva, oral swabs and biopsy specimens obtained from patients’ chronic gastritis and peptic ulcer disease. Methods: A total of 100 tissue biopsy, saliva and oral swab samples were collected and tested for identification of H. pylori using urease test, culture media and PCR for detection of 16sRNA and virulence CagA and VagA genes. Results: It was found that the biopsy results in all methods have high percentage 85% with the exception of CagA gene that gave a high percentage 71% in saliva samples, there were 82.05% urease positive using saliva sample and 43.59% using swab sample, 59.65% positive saliva culture and 38,60% positive swab culture, regarding 16sRNA, there were 70.59% saliva sample positive and 43,53% positive swab sample. H pylori detection by cag A gene of saliva in comparison with biopsy was 87.50% and of oral swab 41.67%, however by VagA gene the result of saliva was 31.25% and of oral swab was 16.67%. Conclusion: All detection method that done by using biopsy sample more accurate and give reliable result. Saliva sample using in detection H.pylori is attractive for use in population based prevalence surveys for H. pylori infection. Keywords: H. pylori, saliva, oral swab ,16SrRNA, VacA,GagA

DNA detection of Helicobacter pylori in saliva of patients with low salivary pH

Background and objective: One of the well-organized diagnostic methods of Helicobacter pylori (H. pylori) infection is bacterial DNA detection in saliva using polymerase chain reaction (PCR). However, a wide range of factors is present in human saliva that could hinder detection efficiency. One of these factors seems to be the pH of saliva, which is investigated in this study as to whether its variation could have any effects on H. pylori DNA presence in the saliva of infected patients. Methods: Saliva samples of 89 H. pylori-infected Patients were collected and measured for pH levels. The DNA of H. pylori was extracted from the saliva of patients and then quantified directly by Real-time PCR. One Way ANOVA and Linear Regression tests were performed to determine the effect of pH on the detection of H. pylori DNA in the saliva. Results: 58% of samples were PCR positive (17% high, 19% medium, and 22% low titer), and no DNA was detected in 42% samples. There was no significant association between the age of patients and the detection of DNA (P = 0.98). A statistically significant difference in pH level was found between negative and positive PCR samples. Calculation of linear regression of DNA copy numbers and independently increasing pH showed R2 = 0.041. Conclusion: The ability to detect H. Pylori DNA was generally confined to pH of 5.5 to 7.5 with an apparently reduced detectability at above neutral pH of saliva. However, pH variation from 5.5 to 7.5 did not determine the levels of detected DNA of H. pylori in saliva.

Identification of Helicobacter pylori in Saliva of Patients with and without Gastritis by Polymerase Chain Reaction.

Aims and Objective:The aim of this study was to identify the presence of Helicobacter pylori in saliva of patients with and without gastritis by polymerase chain reaction (PCR) method.Materials and Methods:The study comprised 20 patients in Group I presenting with various symptoms of gastritis and 10 asymptomatic subjects in Group II. The intestinal endoscopy antral biopsies were collected from 20 symptomatic patients with gastroduodenal disorders. The saliva specimens were taken from all patients before endoscopy. PCR was performed using genomic DNA, isolated from the saliva and the biopsies of the patients as the template to detect the presence of the 16S ribosomal RNA gene in H. pylori.Results:In Group I, 10 (50%) cases of clinical gastritis were positive for H. pylori by endoscopy biopsy and 10 (50%) were negative. Of the 10 endoscopy biopsy positive cases for H. pylori, eight were PCR positive in saliva and two were negative. Of the 10 endoscopy biopsy negative cases, three were PCR positive for H. pylori in saliva and seven were negative. In Groups II, four were symptomatic for gastritis and six were negative. Of the six gastritis negative cases, three were PCR positive, four were gastritis positive, and three were PCR positive. Sensitivity and specificity of PCR were found to be 80% and 70%, respectively. The positive predictive and negative predictive values of PCR in saliva were 72.7% and 77.7%, respectively.Conclusion:PCR analysis of saliva may be handy in identification of H. pylori and serves as a noninvasive technique to diagnose and monitor the prognosis.

Detection and genotyping of Helicobacter pylori in saliva versus stool samples from asymptomatic individuals in Northeastern Thailand reveals intra-host tissue-specific H. pylori subtypes

BackgroundTwo-thirds of the world’s population is thought to be infected by Helicobacter pylori. Although most people infected with H. pylori are asymptomatic, this pathogen is associated with several gastric pathologies including cancer. The risk factors for colonization are still unclear and the genetic diversity within individual hosts has never been clearly investigated.ResultThis study determined the prevalence of, and explored risk factors for, H. pylori infection directly from paired saliva (n = 110) and stool (n = 110) samples from asymptomatic persons in Northeast Thailand. Samples were subjected to indirect immunofluorescence assay (IFA), 16S rRNA-based real-time PCR and vacA-based semi-nested PCR. Partial vacA gene sequences of H. pylori were compared between saliva and stool samples.The overall prevalence of H. pylori infection in our asymptomatic study population was 64%. Age, gender, occupation and frequency of brushing teeth were not found to be associated with H. pylori colonization. The vacA gene was successfully sequenced from both saliva and stool samples of 12 individuals. For seven of these individuals, saliva and stool sequences fell into different clusters on a phylogenetic tree, indicating intra-host genetic variation of H. pylori.ConclusionThis study reports a high prevalence of H. pylori infection in asymptomatic persons in this region of Thailand and demonstrates that genotypes (vacA gene sequences) of H. pylori may differ between the oral cavity and intestinal tract.

Occurrence of Helicobacter pylori in saliva from preschool-age Children

Occurrence of Helicobacter pylori in saliva from preschool-age Children

Occurrence of Helicobacter pylori in saliva from preschool-age children

IntroductionIt is known that initial infection with Helicobacter pylori can occur in children aged 5 years or less, but there have been no studies investigating the period of initial infection. Here, 418 children attending preschool, and their parents, were tested for H. pylori DNA by real-time PCR using saliva samples in order to infer the period of initial infection of H. pylori. MethodsSubjects took samples of their saliva by chewing on a sterile absorbent cotton roll for 2 minutes, and samples were stored at −80̊C until they were examined. DNA was extracted from 100μl of saliva and was tested for H. pylori DNA using the TaqMan method. ResultThe H. pylori DNA detection rate among children was: 4.1% among 3-year-olds, 4.9% among 4-year-olds, 10.0% among 5-year-olds, and 13.3% among 6-year-olds. The detection rate thus increased with age, showing a sharp increase from age 4 to 5 years. The rate of H. pylori detection among mothers of H. pylori-positive children was 56.2%, which was significantly greater than the rate among mothers of H. pylori-negative children (17.2%). ConclusionThese results suggest that initial infection occurs even in children aged under 3 years, and the rise in detection rate between age 4 and 5 years suggests that there is a high risk of H. pylori infection during this period. Furthermore, the finding that the positivity rate was significantly higher among mothers of H. pylori-positive children than mothers of H. pylori-negative children indicates that mother-child infection is the most important route.

Saliva samples not a reliable tool for diagnosis of Helicobacter pylori infection.

Helicobacter pylori is now recognized worldwide as a common gastric pathogen. The human gastric mucosa is considered the primary site of infection, but the way the bacterium is transmitted from person to person is still unclear. Some studies have suggested that dental plaque or saliva could be a source of infection or constitute a reservoir for Helicobacter pylori [1]. Detection of Helicobacter pylori DNA in the mouth may be useful, but polymerase chain reaction (PCR) testing of specimens from the oral cavity has shown wide variation in positive rates [2, 3]. A plausible explanation for these discrepancies is difficult to find, although differences in methods, patient selection, collection and storage of samples may account in part for the variation in results. It is still not clear whether negative PCR reactions are due to the absence of the bacterium or to the presence of an inhibitor (e.g., polysaccharides) in a highly contaminated environment such as the oral cavity. In addition, little is known about whether Helicobacter pylori is constantly or intermittently present in the oral cavity. This aspect probably affects the detection rates of Helicobacter pylori in saliva.

High prevalence of Helicobacter pylori in saliva demonstrated by a novel PCR assay.

To investigate the prevalence of Helicobacter pylori in the saliva of patients infected with this bacterium. A novel polymerase chain reaction (PCR) assay was developed to detect H pylori in saliva and gastric biopsy specimens from patients undergoing endoscopy. Our PCR assay amplified a 417 base pair fragment of DNA from all 21 DNAs derived from H pylori clinical isolates but did not amplify DNA from 23 non-H pylori strains. Sixty three frozen gastric biopsy and 56 saliva specimens were tested. H pylori specific DNA was detected by PCR in all 39 culture positive biopsy specimens and was also identified from another seven biopsy specimens which were negative by culture but positive by histology. H pylori specific DNA was identified by PCR in saliva specimens from 30 (75%) of 40 patients with H pylori infection demonstrated by culture or histological examination, or both, and in three patients without H pylori infection in the stomach. The results indicate that the oral cavity harbours H pylori and may be the source of infection and transmission.