Heavy Resins Research Articles

Hydrogenation of Furfural to Cyclopentanone in Tert–Butanol-Water Medium: A Study of the Reaction Intermediates Reactivity Using Cu/ZnO/Al2O3 as Catalyst

The catalytic transformation of furfural to cyclopentanone has been investigated using two different liquid phases as solvent: water and 30 wt.% tert–butanol in water. When using neat water at 160 °C, 40 bar of H2, and after 2 h of reaction time, furfural polymerizes, and the yield of cyclopentanone is just 42% with a low carbon balance, indicating that furfural is transformed to non-detected by-products, likely heavy resins. When using 30 wt.% tert–butanol in water, the yield of cyclopentanone is ca. 20%, and the major product is furfuryl alcohol with a 47% yield. We have studied the catalytic transformation of the most relevant reaction intermediates in the overall conversion of furfural to cyclopentanone. In the presence of tert–butanol, two steps are inhibited in the overall pathway: (i) the Piancatelli rearrangement of furfuryl alcohol and (ii) the transformation of cyclopentenone. This inhibition is attributed to the neutralization of protons from water dissociation by surface sites on the catalyst, preventing their participation in the overall reaction. To counteract these inhibitions when tert–butanol is present, higher H2 pressure (60 bar) and temperatures (200 °C) are required. We have been able to obtain productivities per gram of catalyst and mols of Cu basis of 411 gprod·h−1·gcat−1 and 14 gprod·s−1·molCu−1, respectively, which is substantially above that found for other copper-based catalysts.

Colloidal Stability of Bitumens Related to their Generic Composition

Three bitumens obtained from crude oils widely differing in chemical nature were analyzed for generic composition. Separation into group components was carried out by liquid chromatography, using a new procedure. With this method, five fractions were separated, i.e. saturates, cyclics, light resins, heavy resins and asphaltenes. The size distribution of the asphaltene particles in the bitumens and the Heithaus parameters characterizing the colloidal stability of bitumen were determined. The results suggest that the role of the light resins in bitumen differs from that of the heavy resins, as they are constituents of the dispersing and dispersed phase, respectively. The cyclic components and light resins form the dispersing medium of bitumen while the heavy resins and asphaltenes constitute the dispersed material. Saturates are the bitumen components that deteriorate the peptization of asphaltene particles.

Исследование компонентного состава органического вещества отложений Восточно-Предкавказской нефтегазоносной области по результатам литолого-петрофизических и геохимических исследований

This study introduces results of lithological, petrophysical and geochemical investigation of Lower Cretaceous (K1) and Middle Jurassic (J2a-b) rocks of East Pre-Caucasian basin. According to pyrolytic and bituminological studies method of separate determination of kerogen and bitumen concentration been developed. In accordance with this method differentiation of organic matter components in different lithotypes of rocks been described. Also relationship between bitumen and kerogen concentrations been revealed. The majority of samples have poor to fair organic richness and poor source potential. Kerogen type is commonly presented by type III and stages of maturity characterized by stages PC3 to MC3. Bitumen compounds have low concentrations of asphaltenes and aromatic hydrocarbons and mainly contains light and heavy resins. Based on petrophysical and geochemical studies a close relationship between the concentration of organic carbon and the weight concentration of potassium nuclides was obtained. This relationship indicates that kerogen in the sediments under consideration is associated with clay minerals, which is also confirmed by the mineral composition of the rocks.

Исследование зависимости температуры размягчения от содержания мезофазы в нефтяных пеках, полученных из тяжелой пиролизной смолы и декантойля

Samples of petroleum pitches were obtained from heavy pyrolysis resin and decantoil (heavy gas-oil of catalytic cracking) by thermal polycondensation at atmospheric pressure, temperatures of 380–400 and 410–440°С (for resin and decantoil, respectively) and isothermal holding time of 30–480 min. Analysis of the dependence of the softening point on the mesophase content for the obtained samples showed that at the same mesophase content, decantoil pitches exhibit a lower softening point compared to pyrolysis resin pitches, for which, even at 30 % mesophase, the softening point approaches 300°C. This suggests that it is impossible to obtain pitch from pyrolysis resin with high mesophase content without preliminary preparation (for example, by hydrogenation). On the other hand, it has been shown that for pitches from decantoil, it is possible to isolate the mesophase up to 65% or more with a softening point not higher than 250°C.

Stability and efficiency of a CMOS sensor as detector of low energy β and γ particles

Radio Guided Surgery (RGS) is a nuclear medicine technique allowing the surgeon to identify tumor residuals in real time with a millimetric resolution, thanks to a radiopharmaceutical as tracer and a probe as detector. The use of β− emitters, instead of γ or β+, has been recently proposed with the aim to increase the technique sensitivity and reducing both the administered activity to the patient and the medical exposure. In this paper, the possibility to use the commercial CMOS Image Sensor MT9V115, originally designed for visible light imaging, as β− radiation detector RGS is discussed. Being crucial characteristics in a surgical environment, in particular its stability against time, operating temperature, integration time and gain has been studied on laboratory measurements. Moreover, a full Monte Carlo simulation of the detector has been developed. Its validation against experimental data allowed us to obtain efficiency curves for both β and γ particles, and also to evaluate the effect of the covering heavy resin protective layer that is present in the “off the shelf” detector. This study suggests that a dedicated CMOS Image Sensor (i.e. one produced without the covering protective layer) represents the ideal candidate detector for RGS, able to massively increase the amount of application cases and the efficacy of this technique.

Hydrocracking of C5-Isolated Asphaltene and Its Fractions in Batch and Semi-Batch Reactors

Non-catalytic and catalytic hydrocracking of C5-isolated asphaltene and its subfractions were performed in batch and semi-batch reactors at various temperatures. Catalyst and H2 played an important role in the hydrocracking of asphaltenes. In the batch system, the catalyst enhanced asphaltene conversion to light liquid products and suppressed coke formation. The coke formation was controlled at a low reaction temperature, but the reaction rate was too low. Light liquid products were also formed at the beginning of the reaction even at high temperatures, but the coke formation was predominant as the reaction time went on due to the decrease in H2 amount in the reactor. To solve these problems, H2 was continuously supplied during the reaction using the semi-batch system. Sufficient supply of H2 improved the conversion of asphaltenes to light liquid products while inhibiting the coke formation. The lightest asphaltene fraction was easily cracked into light products by inhibiting the coke formation, while the heaviest fraction tends to form coke. The lightest asphaltene fraction prolonged the coke induction period of the heaviest fraction during the catalytic hydrocracking because the lightest fraction contained a significant amount of heavy resin close to that which could prevent aggregation of the heaviest asphaltenes.

ВЛИЯНИЕ ТЕХНОЛОГИЧЕСКОГО РЕЖИМА УСТАНОВКИ ТЕРМИЧЕСКОГО ПИРОЛИЗА УГЛЕВОДОРОДОВ НА КАЧЕСТВЕННЫЙ СОСТАВ ТЯЖЁЛОЙ СМОЛЫ


 
 
 
 The dependence of the yield and composition of the heavy pyrolysis resin on the initial hydrocarbon feedstock and the process conditions is investigated. The variation of technological parameters within certain limits leads to a change in the content of low molecular weight olefins in the gaseous pyrolysis products, as well as the qualitative and quantitative composition of by-product liquid products. As a result of the research, the optimum process conditions for the pyrolysis of straight-run gasoline were determined, which, with the maximum conversion of hydrocarbons to low-molecular-weight olefins, significantly increases the yield of heavy resin containing a wide fraction of naphthalene, biphenyl, indene and their alkyl derivatives. It is shown that when treating by-products containing valuable hydrocarbons as target products and combining the technological mode of pyrolysis and their composition, it is possible to achieve along with the maximum yield of low molecular weight olefins, a significant yield of heavy pyrolysis resin and qualitative changes in its composition.
 
 
 

Peptizing Effect of the Native Heavy Resin Fraction on Asphaltenes

C7-asphaltenes and the heavy resin fraction (HRe, i.e., the fraction insoluble in n-pentane but soluble in n-heptane) were separated from two typical heavy residues. The role of HRe in asphaltene aggregation was mainly explored. First, the effect of HRe on the size of asphaltene aggregates in heptol solvents was studied by dynamic light scattering. The average aggregate size of asphaltenes upon the increase of the resin concentration shows that HRe could inhibit asphaltene aggregation more efficiently than the light resin fraction (LRe, i.e., the polar fraction from C5-maltenes by adsorption chromatography). However, an obvious size increase of asphaltene aggregates is observed when HRe exceeds some concentration. This can be tentatively attributed to the prior adsorption and penetration of resins in the less polar asphaltenes, followed by the reaggregation of the remaining asphaltenes due to their more aromatic and polar nature. Then the thermodynamics of the asphaltene phase behavior in solutions with t...

Occurrence of the moth Cydia pactolana is associated with the spruce canker fungus Neonectria fuckeliana

ABSTRACTSeveral young damaged Norway spruce stands in eastern and central Finland were observed from 2013 to 2016. The damage included trees with heavy resin flow, necrotic foliage, stem and branch cankers and dead trees. Pest identification resulted in the tortricid moth Cydia pactolana whose occurrence was always associated with the presence of the ascomycete pathogen Neonectria fuckeliana. Both the insect and the disease contributed to the extent of the damage, but it is not possible to say in which order they had attacked the trees. Apparently, changed climate has affected the increased occurrence of both the fungus and the moth. However, the characteristics of the insect–fungus interaction and the factors contributing to the coincidences are unknown. Emerging coexistence or potential symbiosis of the two damaging agents is a serious threat for Norway spruce cultivation. Understanding the biology of this fungus–insect interaction is important for controlling them.

Synthesis of SO4 2−/Zr-silicalite-1 zeolite catalysts for upgrading and visbreaking of heavy oil

Catalyst is crucially important to reduce the viscosity of heavy oil during the catalytic aquathermolysis. SO4 2−-modified ZrO2-based nanoparticle catalyst is a commonly used catalyst. But less acid sites and poor hydrothermal stability limited further improving its catalytic performance and practical application. In this study, the Zr-doped silicalite zeolite catalysts with large surface area were prepared as a support matrix, and SO4 2−-modified Zr-doped silicalite zeolite (denoted as SO4 2−/Zr-silicalite-1 zeolite) was used as a solid superacid catalyst to crack the heavy oil. A reference catalyst of SO4 2−/Zr-SiO2 nanoparticles (NPs) was also prepared, which has the same composition with the SO4 2−/Zr-silicalite-1 zeolite catalyst. Compared with the SO4 2−/Zr-SiO2 NP catalyst, the amount of acid sites for the SO4 2−/Zr-silicalite-1 zeolite catalyst is significantly increased and the viscosity reduction efficiency is also enhanced by 40%. More importantly, the SO4 2−/Zr-silicalite-1 zeolite catalyst exhibits a high hydrothermal stability. After catalytic aquathermolysis, the quality of the heavy oil was also ameliorated. The heavy resins and asphaltenes reduced, while the light saturated and aromatic hydrocarbon increased. The results suggest metal element-doped silicalite zeolite catalyst is a potential useful way to solving the less acid sites and poor hydrothermal stability for the SO4 2−-modified nanoparticle catalyst.

Structure and Reactivity of Iranian Vacuum Residue and Its Eight Group-Fractions

Because of its complexity and inferior quality, it is difficult to understand the structure and reactivity of heavy oil. In this paper, we combined the eight group-fraction chromatographic separation method, the modified Brown–Ladner (B–L) method, and the pyrolysis gas chromatography mass spectrometry (Py-GC/MS) analytical method to offer a convenient and efficient method to systematically understanding the average structure, the alkyl side chain length distribution, and the reactivity of Iranian vacuum residue (VR). The results showed that VR can be divided into eight group-fractions (saturate, light aromatic, middle aromatic, heavy aromatic, light resin, middle resin, heavy resin, and asphaltene), which could well reflect the difference of their compositions and structures. Investigating the reactivity of eight group-fractions is valuable for understanding the reactivity of VR in depth. The coking tendency of eight group-fractions are significantly increased from saturate to asphaltene, which are in acc...

Решение экологической проблемы процесса пиролиза рациональным использованием тяжелой смолы пиролиза

Решение экологической проблемы процесса пиролиза рациональным использованием тяжелой смолы пиролиза

Study of Heavy Resins Hydrocarbon Composition for the Pyrolisis of Impulse Nuclea-Magnetic Spectroscopy

One of the areas for an efficient use of large-tonnage and yet scarce binder as bitumen is a broad introduction of bitumen emulsions in water for road and civil construction. The technology of emulsified bitumen preparation, compared with traditional hot technologies and the introduction of petroleum solvents has a number of significant advantages. First of all, it is a power-saving technology that does not require heating of the components to high temperatures, which is directly related to the reduction of such combustion products as flue gas and solvent vapor emissions into the atmosphere. Bituminous Emulsion (BE) can be used with some wet mineral material at a reduced temperature that reduces the dependence of work production from weather conditions, thereby prolonging a construction season. The low viscosity of BE allows to distribute the binder material throughout the surface of the mineral materials, which leads to improved accuracy of dosing and the decrease of its flow rate. A high adhesiveness of BE, a layer formation rate and the ability to mechanize many processes as much as possible make Water-Bitumen Emulsions (WBE) the most technologically advanced type of an organic binding material. Petrochemicals are used during the solution of WBE production technology issues satisfying modern requirements. In this aspect, heavy resins of hydrocarbon pyrolisis which are a byproduct and need their rational use are interesting in some extent. The composition and physico-chemical properties of heavy resins of gasoline, ethane and propane-butane fractions pyrolisis produced as the multi tonnage waste at OJSC Kazanorgsintez (OTPS) and OJSC Nizhnekamskneftekhim (NTPS). Preliminary the samples were obtained at different sampling depth of light fractions by atmospheric distillation original TPS and, respectively, with different initial boiling point. Group hydrocarbon composition of the samples was determined by pulsed NMR1.

Study on the molecular dynamics mechanism of extra-heavy oil by catalytic aquathermolysis

ABSTRACTThe extra-heavy oil of before and after catalytic aquathermolysis was separated; the properties of resin and asphaltene both before and after the reaction were studied by using molecular weight analysis, elemental analysis, and nuclear magnetic resonance, associated with the chemical molecule simulate dynamics software, Hyperchem 7.5, which studied the molecular dynamics of extra-heavy oil by catalytic aquathermolysis. After the catalytic aquathermolysis, it was found that the viscosity of heavy oil reduced largely, and the H/C rate of heavy oil, resin, and asphaltene increased, the aromaticity decreased, and the average molecular reduced, especially the asphaltene which decreased largely. The molecular energy of asphaltene increased and resin decreased, which showed that the asphaltene central aromatic framework was broken. The size of the resin and asphaltene decreased, and more aggregation of heavy components dispersed in heavy oil, which contributed to the viscosity reduction of extra-heavy oil.

Study on Colloidal Model of Petroleum Residues through the Attraction Potential between Colloids.

The samples of DaGang atmospheric residue (DG-AR), Middle East atmospheric residue (ME-AR), TaHe atmospheric residue (TH-AR), and their thermal reaction samples were chosen for study. All the samples were fractioned into six components separately, including saturates plus light aromatics, heavy aromatics, light resins, middle resins, heavy resins, and asphaltenes. The dielectric permittivity of the solutions of these components was measured, and the dielectric permittivity values of the components can be determined by extrapolation, which increased steadily from saturates plus light aromatics to asphaltenes. Moreover, the Hamaker constants of the components were calculated from their dielectric permittivity values. The Van der Waals attractive potential energy between colloids corresponding to various models could be calculated from the fractional composition and the Hamaker constants of every component. It was assumed that the cores of colloidal particles were formed by asphaltenes and heavy resins mainly; the other fractions acted as dispersion medium. For the three serials of thermal reaction samples, the Van der Waals attraction potential energy between colloids for this kind of model was calculated. For TH-AR thermal reaction samples, the Van der Waals attraction potential energy presented the maximum as thermal reaction is going on, which was near to the end of coke induction period.

Methods of obtaining bitumen from heavy oil processing residues

The article describes several methods for solving urgent problems: obtaining the qualitative bituminous materials from unsuitable for recycling heavy oil processing residues. The work was carried out in three directions. The results of the study of the basic laws of oxidation of heavy oils processing residues showed that this method for obtaining the bitumen is failed. The basic laws of joint oxidation of tar from heavy Orkhovitsk oil with heavy pyrolysis resin and neutralized acid tar. It was shown that the method of co-oxidation of Orkhovitsk oil residue and 11-13 % masses of heavy pyrolysis resin at the temperature of 250 °С, air supply 2,5 h-1 during 6 hours allows obtaining the road bitumen of the grade BND 60/90 according to DSTU 4044-2001. The process of modification of residual bitumen derived from heavy Orkhovitsk oil by the Butonal latex and rubber crumb is described. It is established that the use of these modifiers makes it possible to improve the properties of bitumen obtained from heavy oils. The results, presented in this article, can be used in the development of industrial technology for obtaining the bitumen from heavy oil processing residues.

Використання важкої смоли піролізу у виробництві нафтових бітумів

Наведено результати досліджень процесів сумісного окиснення гудрону і важкої смоли піролізу, а також модифікування товарного бітуму важкою смолою піролізу. Встановлено принципову можливість використання важкої смоли піролізу в процесах виробництва нафтових бітумів.

First Report of Pitch Canker Disease Caused by Rhizosphaera kalkhoffii on Pinus sylvestris in China.

In November 2010, pitch canker disease was first discovered on Pinus sylvestris var. mongolica Litv. from Daxinganling region in Inner Mongolia Province, China, resulting in severe dieback and bark cracking on the host, accompanied by resin flowing profusely from cankers on the infected branches, cones, and trunks (2). The early stage symptoms consisted of sunken cankers, reddish-brown needles on infected twigs followed by heavy resin soaking of the wood as the disease progressed. Pieces of pitch-soaked wood (3 × 3 mm2) cut from cankerous tissue on branches were surface-sterilized with 0.4% NaOCl for 2 min and then rinsed twice in sterile distilled water. The fragments were placed on potato dextrose agar and incubated at 28°C in the dark. After 7 to 8 days, this process consistently yielded cultures with whitish, dense, aerial mycelium that later darkened to gray. Microconidia were single, oblong to cylindrical, aseptate, and 4 to 10 × 2 to 4 μm. Macroconidia were hyaline, 1- to 2-septate, oblong to cylindrical, with tiny papillae at both ends, and 10 to 13 × 2 to 5 μm, fitting the description of Rhizosphaera kalkhoffii (1). To verify the identification based on morphological features, the internal transcribed spacer (ITS) region of the ribosomal RNA genes was amplified using primers ITS1 (TCCGTAGGTGAACCTGCGG) and ITS4 (TCCTCCGCTTATTGATATGC) according to the published protocol (3), and then sequenced and compared to the GenBank database through BLAST search. Comparison of the sequences revealed 98% homology to R. kalkhoffii (EU700375.1 and EU700376.1). Representative sequences of R. kalkhoffii (JQ353721 and JQ353722) were deposited in GenBank. The pathogenicity of two representative isolates of R. kalkhoffii was also confirmed by spraying 40 μl of conidial suspension (4.6 × 106 conidia/ml) on the bark surface of 20 2-year-old healthy pine seedlings, wounded by scratching with a sterilized knife. Sterile distilled water sprays were used for the controls. Within 4 to 8 weeks after inoculation, 90% of inoculated P. sylvestris exhibited symptoms of pitch cankers around the inoculation site similar to those on the original infection. R. kalkhoffii was consistently reisolated from all inoculated plants but not from water-treated controls, fulfilling Koch's postulates. R. kalkhoffii have previously been documented as pathogens of needle blight of Picea pungens (1). To our knowledge, this is the first report of R. kalkhoffii as a pathogen on Pinus sylvestris in China, and furthermore, pitch canker disease is currently listed as a quarantine disease in China, increasing the significance of this report.

The role of superheated steam in the thermopolycondensation of heavy gasoline-pyrolysis resins

A study is made of the influence of superheated steam flow rate on the group-components accumulation kinetics, softening point and yield of pitches obtained by the thermopolycondensation of heavy pyrolysis resins. The injection of steam with a continuous increase in temperature helps accelerate the removal of volatile and low-temperature components from the pitch and reduce the time of formation of pitch having a fixed softening point while also reducing the carbene content of the pitch. It is shown that steam acts as a turbulator. The unit steam injection rate and the quality of dispersion and distribution of the steam in the liquid phase are more important factors than steam temperature. In order to produce fiberforming pitches, the isothermal stage of the thermopolycondensation of heavy pyrolysis resins should be carried out for 8–10 h with temperatures between 340 and 380°C, pressures up to 1 MPa, and an hourly consumption of 0.02-0.04 kg of superheated steam per kilogram of feedstock.

The Effect of Waxes Addition on Rheological Properties of O/W Concentrated Model Emulsions

As heavy oil contains different impurities that increase the viscosity, pipeline transportation becomes economically disadvantageous. Oil-in-water emulsification, adopted as a cost reduction transportation technique, may take advantage of the presence of natural components of heavy crudes, asphaltenes, and resins as emulsifiers and waxes as stabilizers, decreasing the viscosity with respect to the pure-oil one. This article aims at investigating the effect of waxes addition on the viscosity of model oil-in-water emulsions produced in bench-scale, using two different emulsification techniques. Results showed that paraffin accelerates the emulsification completion during an in-flow test and also emulsion viscosity was lowered by waxes addition.