Heat-inactivated Fetal Bovine Serum Research Articles

STAT3-Stathmin Interactions Control Microtubule Dynamics in Migrating T-cells

T-cell migration is a complex highly coordinated process that involves cell adhesion to the high endothelial venules or to the extracellular matrix by surface receptor/ligand interactions, cytoskeletal rearrangements, and phosphorylation-dependent signaling cascades. The mechanism(s) that regulates T-cell migration is of considerable relevance for understanding the pathogenesis of various diseases, such as chronic inflammatory diseases and cancer metastasis. This study was designed to identify potential involvement of STAT3, a latent transcription factor, in mediating integrin-induced T-cell migration. Using our previously characterized in vitro model for lymphocyte migration, we demonstrate that STAT3 is activated and translocated to the nucleus during the process of active motility of Hut78 T-lymphoma cells triggered via LFA-1. Blocking STAT3 signaling by multiple approaches inhibited LFA-1-induced T-cell locomotion via destabilization of microtubules and post-translational modification of tubulin. Here, we show that STAT3 physically interacts with stathmin to regulate microtubule dynamics in migrating T-cells. These observations strongly indicate that STAT3 is critically important for T-cell migration and associated signaling events.

Effect of Transient and Permanent Permeability Transition Pore Opening on NAD(P)H Localization in Intact Cells

To study the effect of mitochondrial permeability transition pore (PTP) opening on NAD(P)H localization, intact cells were exposed to the Ca(2+) ionophore A23187. PTP opening, mitochondrial membrane potential, mitochondrial volume, and NAD(P)H localization were assessed by time-lapse laser confocal microscopy using the calcein-cobalt technique, tetramethylrhodamine methyl ester, MitoTracker, and NAD(P)H autofluorescence, respectively. Concomitant with PTP opening, NAD(P)H fluorescence increased outside mitochondria. These events occurred in all cells and were prevented by cyclosporin A. Mitochondrial membrane potential was not systematically collapsed, whereas mitochondrial volume did not change, confirming that A23187 induced transient PTP opening in a subpopulation of cells and suggesting that mitochondrial swelling did not immediately occur after PTP opening in intact cells. NAD(P)H autofluorescence remained elevated after PTP opening, particularly after membrane potential had been collapsed by an uncoupler. Extraction of nucleotide for NAD(P)H quantification confirmed that PTP opening led to an increase in NAD(P)H content. Because the oxygen consumption rate decreased, whereas the lactate/pyruvate ratio increased after PTP opening in intact cells, we conclude that PTP opening inhibits respiration and dramatically affects the cytosolic redox potential in intact cells.

Activation-induced Degradation of FLIPL Is Mediated via the Phosphatidylinositol 3-Kinase/Akt Signaling Pathway in Macrophages

Cellular FLIP (Flice-like inhibitory protein) is critical for the protection against death receptor-mediated cell apoptosis. In macrophages, FLIP long (FLIP(L)) and FLIP short (FLIP(S)) mRNA was induced by tumor necrosis factor (TNF) alpha, mediated through NF-kappaB. However, we observed TNFalpha reduced the protein level of FLIP(L), but not FLIP(S), at 1 and 2 h. Similar results were observed with lipopolysaccharide. The reduction of FLIP(L) by TNFalpha was not mediated by caspase 8, or through JNK or Itch, but was suppressed by inhibition of the phosphatidylinositol 3-kinase/Akt pathway employing chemical inhibitors, a dominant negative Akt-1, or Akt-1 small interfering RNA. The reduction of FLIP(L) resulted in the short term induction of caspase 8-like activity, which augmented NF-kappaB activation. A co-immunoprecipitation assay demonstrated that Akt-1 physically interacts with FLIP(L). Moreover, TNFalpha enhanced FLIP(L) serine phosphorylation, which was increased by activated Akt-1. Serine 273, a putative Akt-1 phosphorylation site in FLIP(L), was critical for the activation-induced reduction of FLIP(L). Thus, these observations document a novel mechanism where by TNFalpha facilitates the reduction of FLIP(L) protein, which is dependent on the phosphatidylinositol 3-kinase/Akt signaling.

CCR6 Regulation of the Actin Cytoskeleton Orchestrates Human Beta Defensin-2- and CCL20-mediated Restitution of Colonic Epithelial Cells

Intestinal inflammation is exacerbated by defects in the epithelial barrier and subsequent infiltration of microbes and toxins into the underlying mucosa. Production of chemokines and antimicrobial peptides by an intact epithelium provide the first line of defense against invading organisms. In addition to its antimicrobial actions, human beta defensin-2 (HBD2) may also stimulate the migration of dendritic cells through binding the chemokine receptor CCR6. As human colonic epithelium expresses CCR6, we investigated the potential of HBD2 to stimulate intestinal epithelial migration. Using polarized human intestinal Caco2 and T84 cells and non-transformed IEC6 cells, HBD2 was equipotent to CCL20 in stimulating migration. Neutralizing antibodies confirmed HBD2 and CCL20 engagement to CCR6 were sufficient to induce epithelial cell migration. Consistent with restitution, motogenic concentrations of HBD2 and CCL20 did not induce proliferation. Stimulation with those CCR6 ligands leads to calcium mobilization and elevated active RhoA, phosphorylated myosin light chain, and F-actin accumulation. HBD2 and CCL20 were unable to stimulate migration in the presence of either Rho-kinase or phosphoinositide 3-kinase inhibitors or an intracellular calcium chelator. Together, these data indicate that the canonical wound healing regulatory pathway, along with calcium mobilization, regulates CCR6-directed epithelial cell migration. These findings expand the mechanistic role for chemokines and HBD2 in mucosal inflammation to include immunocyte trafficking and killing of microbes with the concomitant activation of restitutive migration and barrier repair.

Cleavage of Bid by Executioner Caspases Mediates Feed Forward Amplification of Mitochondrial Outer Membrane Permeabilization during Genotoxic Stress-induced Apoptosis in Jurkat Cells

The extent to which the BH3-only protein Bid is important for intrinsic (mitochondria-mediated) apoptotic cell death induced by genotoxic stress remains controversial. In the present study, we examine this issue using a panel of gene-manipulated Bax-deficient Jurkat T-lymphocytes. Cells stably depleted of Bid were far less sensitive than control-transfected cells to etoposide-induced apoptosis. In particular, drug-induced Bak activation, cytochrome c release, loss of mitochondrial membrane potential, and caspase activation were all decreased in cells lacking Bid. Reconstitution experiments using recombinant proteins and permeabilized Bid-deficient cells demonstrated that truncated Bid (tBid), but not full-length Bid, potently induced Bak activation and the release of cytochrome c. Further, caspase-8-deficient Jurkat cells efficiently cleaved Bid and were sensitive to drug-induced apoptosis. By comparison, Apaf-1-deficient cells, as well as cells overexpressing full-length X-linked inhibitor of apoptosis protein (XIAP) or the BIR1/BIR2 domains of XIAP, failed to cleave Bid in response to genotoxic stress. These data suggest that tBid plays an important regulatory role in the execution of DNA damage-induced cytochrome c release and apoptosis. However, the fact that cleavage of Bid to tBid is mediated by executioner caspases suggests that a self-amplifying feed forward loop involving caspases, Bid, and mitochondria may help determine irreversible commitment to apoptosis.

HMGA2 Maintains Oncogenic RAS-Induced Epithelial-Mesenchymal Transition in Human Pancreatic Cancer Cells

Pancreatic cancer is a highly aggressive malignancy due to elevated mitotic activities and epithelial-mesenchymal transition (EMT). Oncogenic RAS and transforming growth factor-beta signaling are implicated in these malignant features. The mechanisms that underlie EMT need to be addressed since it promotes tissue invasion and metastasis. The high-mobility group A protein 2 (HMGA2) is a non-histone chromatin factor that is primarily expressed in undifferentiated tissues and tumors of mesenchymal origin. However, its role in EMT in pancreatic cancer is largely unknown. Here we report that HMGA2 is involved in EMT maintenance in human pancreatic cancer cells. Specific knockdown of HMGA2 inhibited cell proliferation, leading to an epithelial-state transition that restores cell-cell contact due to E-cadherin up-regulation. Consistently, an inverse correlation between HMGA2-positive cells and E-cadherin-positive cells was found in cancer tissues. Inhibition of the RAS/MEK pathway also induced an epithelial transition, together with HMGA2 down-regulation. Transcriptional repressors of the E-cadherin gene, such as SNAIL, decreased after HMGA2 knockdown since HMGA2 directly activated the SNAlL gene promoter. The decrease of SNAIL after RAS/MEK inhibition was suppressed by HMGA2 overexpression. Further, let-7 microRNA-mediated HMGA2 down-regulation had no effect on the prevention of the transformed phenotype in these cells. These data shed light on the importance of HMGA2 in reversibly maintaining EMT, suggesting that HMGA2 is a potential therapeutic target for the treatment of pancreatic cancer.

A Conserved Hydrophobic Tetrad near the C Terminus of the Secretory Na+-K+-2Cl- Cotransporter (NKCC1) Is Required for Its Correct Intracellular Processing

Little is known about the intracellular folding and trafficking of integral membrane proteins. Here we identify a hydrophobic amino acid tetrad (ILLV) close to the C terminus of the secretory Na+-K+-2Cl- cotransporter (NKCC1) that is important for the proper intracellular processing of this protein. This tetrad appears in a C-terminal sequence pattern that is conserved across species in a number of members of the NKCC1 gene family (slc12) of electroneutral salt transporters. We studied the effects of various mutations of these amino acids on NKCC1 transiently transfected into HEK-293 cells. Our results show that mutation of two of these residues to alanine leads to a >50% reduction in expression and complex glycosylation levels and that multiple mutations to alanine have cumulative effects. By contrast, scrambling of these amino acids, or mutation of other nearby conserved C-terminal residues, has little effect on these parameters. Mutation of ILLV to AAAA reduces complex glycosylation of NKCC1 by approximately 90% and results in a protein that does not form stable dimers and is retained in the endoplasmic reticulum in a highly aggregated state. Our results are consistent with the hypothesis that mutation of the hydrophobic tetrad ILLV to AAAA leads to the ab initio misfolding and concomitant aggregation of this NKCC1 mutant, resulting in its retention in the endoplasmic reticulum.

Biochemical, Functional, and Pharmacological Characterization of AT-56, an Orally Active and Selective Inhibitor of Lipocalin-type Prostaglandin D Synthase

We report here that 4-dibenzo[a,d]cyclohepten-5-ylidene-1-[4-(2H-tetrazol-5-yl)-butyl]-piperidine (AT-56) is an orally active and selective inhibitor of lipocalin-type prostaglandin (PG) D synthase (L-PGDS). AT-56 inhibited human and mouse L-PGDSs in a concentration (3–250 μm)-dependent manner but did not affect the activities of hematopoietic PGD synthase (H-PGDS), cyclooxygenase-1 and -2, and microsomal PGE synthase-1. AT-56 inhibited the L-PGDS activity in a competitive manner against the substrate PGH2 (Km = 14 μm) with a Ki value of 75 μm but did not inhibit the binding of 13-cis-retinoic acid, a nonsubstrate lipophilic ligand, to L-PGDS. NMR titration analysis revealed that AT-56 occupied the catalytic pocket, but not the retinoid-binding pocket, of L-PGDS. AT-56 inhibited the production of PGD2 by L-PGDS-expressing human TE-671 cells after stimulation with Ca2+ ionophore (5 μm A23187) with an IC50 value of about 3 μm without affecting their production of PGE2 and PGF2α but had no effect on the PGD2 production by H-PGDS-expressing human megakaryocytes. Orally administered AT-56 (<30 mg/kg body weight) decreased the PGD2 production to 40% in the brain of H-PGDS-deficient mice after a stab wound injury in a dose-dependent manner without affecting the production of PGE2 and PGF2α and also suppressed the accumulation of eosinophils and monocytes in the bronco-alveolar lavage fluid from the antigen-induced lung inflammation model of human L-PGDS-transgenic mice.

Proteome-Wide Identification of Novel Binding Partners to the Oncogenic Fusion Gene Protein, NPM-ALK, using Tandem Affinity Purification and Mass Spectrometry

Nucleophosmin-anaplastic lymphoma kinase (NPM-ALK), an oncogenic fusion gene protein that is characteristically found in a subset of anaplastic large cell lymphomas, promotes tumorigenesis through its functional and physical interactions with various biologically important proteins. The identification of these interacting proteins has proven to be useful to further our understanding of NPM-ALK-mediated tumorigenesis. For the first time, we performed a proteome-wide identification of NPM-ALK-binding proteins using tandem affinity purification and a highly sensitive mass spectrometric technique. Tandem affinity purification is a recently developed method that carries a lower background and higher sensitivity compared with the conventional immunoprecipitation-based protein purification protocols. The NPM-ALK gene was cloned into an HB-tagged vector and expressed in GP293 cells. Three independent experiments were performed and the reproducibility of the data was 68%. The vast majority of the previously reported NPM-ALK-binding proteins were detected. We also identified proteins that are involved in various cellular processes that were not previously described in association with NPM-ALK, such as MCM6 and MSH2 (DNA repair), Nup98 and importin 8 (subcellular protein transport), Stim1 (calcium signaling), 82Fip (RNA regulation), and BAG2 (proteosome degradation). We believe that these data highlight the functional diversity of NPM-ALK and provide new research directions for the study of the biology of this oncoprotein.

Fn14-TRAIL, a Chimeric Intercellular Signal Exchanger, Attenuates Experimental Autoimmune Encephalomyelitis

Hallmarks of the pathogenesis of autoimmune encephalomyelitis include perivascular infiltration of inflammatory cells into the central nervous system, multifocal demyelination in the brain and spinal cord, and focal neuronal degeneration. Optimal treatment of this complex disease will ultimately call for agents that target the spectrum of underlying pathogenic processes. In the present study, Fn14-TRAIL is introduced as a unique immunotherapeutic fusion protein that is designed to exchange and redirect intercellular signals within inflammatory cell networks, and, in so doing, to impact multiple pathogenic events and yield a net anti-inflammatory effect. In this soluble protein product, a Fn14 receptor component (capable of blocking the pro-inflammatory TWEAK ligand) is fused to a TRAIL ligand (capable of inhibiting activated, pathogenic T cells). Sustained Fn14-TRAIL expression was obtained in vivo using a transposon-based eukaryotic expression vector. Fn14-TRAIL expression effectively prevented chronic, nonremitting, paralytic disease in myelin oligodendrocyte glycoprotein-challenged C57BL/6 mice. Disease suppression in this model was reflected by decreases in the clinical score, disease incidence, nervous tissue inflammation, and Th1, Th2, and Th17 cytokine responses. Significantly, the therapeutic efficacy of Fn14-TRAIL could not be recapitulated simply by administering its component parts (Fn14 and TRAIL) as soluble agents, either alone or in combination. Its functional pleiotropism was manifest in its additional ability to attenuate the enhanced permeability of the blood-brain barrier that typically accompanies autoimmune encephalomyelitis.

Parkin Protects Dopaminergic Neurons against Microtubule-depolymerizing Toxins by Attenuating Microtubule-associated Protein Kinase Activation

Mitogen-activated protein kinases, originally known as microtubule-associated protein (MAP) kinases, are activated in response to a variety of stimuli. Here we report that microtubule-depolymerizing agents such as colchicine or nocodazole induced strong activation of MAP kinases including JNK, ERK, and p38. This effect was markedly attenuated by parkin, whose mutations are linked to Parkinson disease (PD). Our previous study has shown that parkin stabilizes microtubules through strong interactions mediated by three independent domains. We found that each of the three microtubule-binding domains of parkin was sufficient to reduce MAP kinase activation induced by microtubule depolymerization. The ability to attenuate microtubule depolymerization and the ensuing MAP kinase activation was abrogated in B-lymphocytes and fibroblasts derived from PD patients with parkin mutations such as exon 4 deletion. Such mutations produced truncated parkin proteins lacking any microtubule binding domain and prevented parkin from protecting midbrain dopaminergic neurons against microtubule-depolymerizing toxins such as rotenone or colchicine. Consistent with these, blocking MAP kinase activation in midbrain dopaminergic neurons by knocking down MAP kinase kinases (MKK) significantly reduced the selective toxicity of rotenone or colchicine. Conversely, overexpression of MAP kinases caused marked toxicities that were significantly attenuated by parkin. Thus, the results suggest that parkin protects midbrain dopaminergic neurons against microtubule-depolymerizing PD toxins such as rotenone by stabilizing microtubules to attenuate MAP kinase activation.

MDia2 Shuttles between the Nucleus and the Cytoplasm through the Importin-α/β- and CRM1-mediated Nuclear Transport Mechanism

Mammalian homolog of Drosophila diaphanous (mDia) consisting of three isoforms, mDia1, mDia2, and mDia3, is an effector of Rho GTPases that catalyzes actin nucleation and polymerization. Although the mDia actions on actin dynamics in the cytoplasm have been well studied, whether mDia accumulates and functions in the nucleus remains largely unknown. Given the presence of actin and actin-associated proteins in the nucleus, we have examined nuclear localization of mDia isoforms. We expressed each of mDia isoforms as a green fluorescent protein fusion protein and examined their localization. Although all the mDia isoforms were localized predominantly in the cytoplasm under the steady-state conditions, mDia2 and not mDia1 or mDia3 accumulated extensively in the nucleus upon treatment with leptomycin B (LMB), an inhibitor of CRM1-dependent nuclear export. The LMB-induced nuclear accumulation was confirmed for endogenous mDia2 by using an antibody specific to mDia2. Studies using green fluorescent protein fusions of various truncation mDia2 mutants and point mutants of some of these proteins identified a functional nuclear localization signal in the N terminus of mDia2 and at least one functional nuclear export signal in the C terminus. The nuclear localization signal of mDia2 bound to importin-alpha and was imported into the nucleus by importin-alpha/beta complex in an in vitro transport assay. Consistently, depletion of importin-beta with RNA interference suppressed the LMB-induced nuclear localization of endogenous mDia2. These results suggest that mDia2 continuously shuttles between the nucleus and the cytoplasm using specific nuclear transport machinery composing of importin-alpha/beta and CRM1.

MCAF1/AM Is Involved in Sp1-mediated Maintenance of Cancer-associated Telomerase Activity

Telomerase maintains telomere length and is implicated in senescence and immortalization of mammalian cells. Two essential components for this enzyme are telomerase reverse transcriptase (TERT) and the telomerase RNA component (encoded by the TERC gene). These telomerase subunit genes are known to be mainly expressed by specificity protein 1 (Sp1). MBD1-containing chromatin-associated factor 1 (MCAF1), also known as ATFa-associated modulator (AM) and activating transcription factor 7-interacting protein (ATF7IP), mediates gene regulation, although the precise function of MCAF1 remains to be elucidated. Here, we report that MCAF1 is involved in Sp1-dependent maintenance of telomerase activity in cancer cells. Two evolutionarily conserved domains of MCAF1 directly interact with Sp1 and the general transcriptional apparatus. Selective depletion of MCAF1 or Sp1 down-regulates TERT and TERC genes in cultured cells, which results in decreased telomerase activity. The transcriptionally active form of RNA polymerase II and the general transcription factor ERCC3 decreased in the TERT promoter under the loss of MCAF1 or Sp1. Consistently, MCAF1 is found to be frequently overexpressed in naturally occurring cancers that originate in different tissues. Our data suggest that transcriptional function of MCAF1 facilitates telomerase expression by Sp1, which may be a common mechanism in proliferative cancer cells.

Characteristics of &lt;italic&gt;Leishmania spp.&lt;/italic&gt; isolated from a mixed focus of cutaneous and visceral Leishmaniasis in Himachal Pradesh (India)

Background: A mixed endemic focus of cutaneous and visceral leishmaniasis has emerged along the Sutluj river valley of Himachal Pradesh (India). Methods: The laboratory work up of 218 new consecutive cases of localized cutaneous leishmaniasis (LCL) and 14 patients of visceral leishmaniasis (VL) from this focus is analyzed. Results: Tissue smears were positive in 44.42% of LCL and 78.57% of VL patients. Positivity was higher (73.97%) in LCL lesions of 6months duration. Only modified NNN medium supplemented with RPMI 1640 and 10% heat inactivated fetal bovine serum was found to be the most suitable for primary isolation of the parasite while other seven media used did not yield significant growth. Culture for the organism was positive in 38 of 112 (33.92%) patients of LCL and 9 of 14 (64.28%) patients of VL. The cultured organisms from 4 each of LCL and VL samples were identified by PCR as Leishmania donovani. Although subculture/bulk cultivation of this Leishmania spp. was unsuccessful in the various media tried, the two of the primary cultures could be maintained for 50 days by just replenishing the liquid overlay. Conclusion: This new focus of leishmaniasis appears peculiar where cutaneous and visceral forms co-exist, and both Leishmania donovani and Leishmania tropica are producing LCL all the while L. donovani being the predominant pathogen. The difficulty in culturing the isolates is also reminiscent of LCL caused by Leishmania infantum suggesting that these isolates, both from LCL and VL patients, perhaps belong to Leishmania donovani-infantum complex.

Quantitative Proteomics Analysis of Macrophage Rafts Reveals Compartmentalized Activation of the Proteasome and of Proteasome-mediated ERK Activation in Response to Lipopolysaccharide

Lipopolysaccharide (LPS), a glycolipid component of the outer membrane of Gram-negative bacteria, is a potent initiator of the innate immune response of the macrophage. LPS triggers downstream signaling by selectively recruiting and activating proteins in cholesterol-rich membrane microdomains called lipid rafts. We applied proteomics analysis to macrophage detergent-resistant membranes (DRMs) during an LPS exposure time course in an effort to identify and validate novel events occurring in macrophage rafts. Following metabolic incorporation in cell culture of heavy isotopes of amino acids arginine and lysine ([(13)C(6)]Arg and [(13)C(6)]Lys) or their light counterparts, a SILAC (stable isotope labeling with amino acids in cell culture)-based quantitative, liquid chromatography-tandem mass spectrometry proteomics approach was used to profile LPS-induced changes in the lipid raft proteome of RAW 264.7 macrophages. Unsupervised network analysis of the proteomics data set revealed a marked representation of the ubiquitin-proteasome system as well as changes in proteasome subunit composition following LPS challenge. Functional analysis of DRMs confirmed that LPS causes selective activation of the proteasome in macrophage rafts and proteasome inactivation outside of rafts. Given previous reports of an essential role for proteasomal degradation of IkappaB kinase-phosphorylated p105 in LPS activation of ERK mitogen-activated protein kinase, we tested for a role of rafts in compartmentalization of these events. Immunoblotting of DRMs revealed proteasome-dependent activation of MEK and ERK specifically occurring in lipid rafts as well as proteasomal activity upon raft-localized p105 that was enhanced by LPS. Cholesterol extraction from the intact macrophage with methyl-beta-cyclodextrin was sufficient to activate ERK, recapitulating the LPS-IkappaB kinase-p105-MEK-ERK cascade, whereas both it and the alternate raft-disrupting agent nystatin blocked subsequent LPS activation of the ERK cascade. Taken together, our findings indicate a critical, selective role for raft compartmentalization and regulation of proteasome activity in activation of the MEK-ERK pathway.

Protein Kinase A-mediated Gating of Neuregulin-dependent ErbB2-ErbB3 Activation Underlies the Synergistic Action of cAMP on Schwann Cell Proliferation

In Schwann cells (SCs), cyclic adenosine monophosphate (cAMP) enhances the action of neuregulin, the most potent known mitogen for SCs, by synergistically increasing the activation of two crucial signaling pathways: ERK and Akt. However, the underlying mechanism of cross-talk between neuregulin and cAMP signaling remains mostly undefined. Here, we report that the activation of protein kinase A (PKA), but not that of exchange protein activated by cAMP (EPAC), enhances S-phase entry of SCs by synergistically enhancing the ligand-dependent tyrosine phosphorylation/activation of the neuregulin co-receptor, ErbB2-ErbB3. The role of PKA in neuregulin-ErbB signaling was confirmed using PKA inhibitors, pathway-selective cAMP analogs, and natural ligands stimulating PKA activity in SCs, such as adenosine and epinephrine. Two basic observations defined the synergistic action of PKA as "gating" for neuregulin-ErbB signaling: 1) the activation of PKA was not sufficient to induce S-phase entry or the activation of either ErbB2 or ErbB3; and 2) the presence of neuregulin was strictly required to ignite ErbB activation and thereby ERK and Akt signaling. However, PKA directly phosphorylated ErbB2 on Thr-686, a highly conserved intracellular regulatory site that was required for the PKA-mediated synergistic enhancement of neuregulin-induced ErbB2-ErbB3 activation and proliferation in SCs. The gating action of PKA on neuregulin-induced ErbB2-ErbB3 activation has important biological significance, because it insures signal amplification into the ERK and Akt pathways without compromising either the neuregulin dependence or the high specificity of ErbB signaling pathways.

Methanolic Extract of Cynara Cardunculus L. Inhibits Cell Proliferation and Bcr/Abl Expression in K562 Cell Line

Introduction: Chronic myeloid leukaemia (CML) is a myeloid neoplasm defined by the Bcr/Abl oncoprotein that is considered essential for leukaemogenesis and accumulation of neoplastic cells. Evidence exists showing that extracts of antichoke Cynara cardunculus L. (CCE) are able to inhibit cancer cell growth in vitro (1). In the present study we have investigated the antiproliferative effect of methanolic extract of CEE on K562 Bcr-Abl positive leukemia cell line. In addition we evaluated whether the extract of CEE also affects the mRNA levels of Bcr-Abl and p210 expression in this cell line.Materials and Methods:Preparation of methanolic extract of CEE. The aerial parts of CEE were air dried until dryness at room temperature, cut into small pieces and then extracted with methanol through maceration (48 h for 3 times). The resultant total extracts were dried under reduced pressure and their weight was determined.Cell culture. The K562 cells were grown in RPMI 1640 with L-glutamine supplemented with 10% (v/v) heat-inactivated FBS, 1% penicillin/streptomycin in humidified atmosphere of 5% CO2 at 37°C. In all experiments growing cells at optimal concentration were placed in 24 or 96 well plate and then treated with vehicle or 5–100–200 μg/ml methanolic extract of CEE. 48h after the treatment cultures were tested for proliferative activity, mRNA level of Bcr-Abl by RT-PCR and p210 protein expression by western blotting analysis.Proliferative activity. Proliferative activity was determined using the MTT technique according to the method described by Tubaro et al. (1996). The assay was performed in triplicate and absorbance values at 550 nm were measured using a microplate reader.RT-PCR Analysis. The total cellular mRNA was isolated from treated and control cells using an silica coloumns. Using equal amounts of the RNA from each sample, the cDNA was synthesized by Superscript VILO™ cDNA kit. PCR was performed using Platinum® Taq DNA polymerase and specific primers for t(9;22) p210 transcripts (b3a2): GAAGTGTTTCAGAAGCTTTCC (sense) and GTTTGGGCT-TCACACCATTCC (antisense). 35 amplification cycles were performed at 94°C for 30s, 55°C for 30s and 72°C for 1min. Gel electrophoresis and ethidium bromide staining was used to visualize the PCR products.Western Blot Analysis. Cell pellets from control and treated cultures were lysed using lysis buffer with protease and phosphatase inhibitors. The proteins were then quantified and equal amounts (30 ug) were separated by SDS-PAGE and electro-blotted to nitrocellulose. After blocking procedure the blots were incubated with specific primary antibody against p210 protein and then challenged with specific horseradish peroxidase-conjugated secondary antibody. The reactive protein was visualized using an enhanced chemiluminescence detection system.Results: The results have shown that treatment of K562 cell line with methanolic extract of CEE reduced cell viability in a dose-dependent fashion (IC50=41.7 μg/ml) as demonstrated by MTT assay. PCR and Western blot analysis revealed that the cell growth inhibition was associated to a dramatic decrease of mRNA levels of Bcr-Abl and to a significant reduction of p210 protein expression suggesting that the antiproliferative effect of methanolic extract of CEE likely due to the inhibition at transcriptional level of Bcr-Abl oncoprotein. Further studies are needed to better elucidate this mechanisms and to identify the compound of crude extract which is responsible of cancer growth suppression.

NADPH Oxidase-dependent Generation of Lysophosphatidylserine Enhances Clearance of Activated and Dying Neutrophils via G2A

Exofacial phosphatidylserine (PS) is an important ligand mediating apoptotic cell clearance by phagocytes. Oxidation of PS fatty acyl groups (oxPS) during apoptosis reportedly mediates recognition through scavenger receptors. Given the oxidative capacity of the neutrophil NADPH oxidase, we sought to identify oxPS signaling species in stimulated neutrophils. Using mass spectrometry analysis, only trace amounts of previously characterized oxPS species were found. Conversely, 18:1 and 18:0 lysophosphatidylserine (lyso-PS), known bioactive signaling phospholipids, were identified as abundant modified PS species following activation of the neutrophil oxidase. NADPH oxidase inhibitors blocked the production of lyso-PS in vitro, and accordingly, its generation in vivo by activated, murine neutrophils during zymosan-induced peritonitis was absent in mice lacking a functional NADPH oxidase (gp91phox-/-). Treatment of macrophages with lyso-PS enhanced the uptake of apoptotic cells in vitro, an effect that was dependent on signaling via the macrophage G2A receptor. Similarly, endogenously produced lyso-PS also enhanced the G2A-mediated uptake of activated PS-exposing (but non-apoptotic) neutrophils, raising the possibility of non-apoptotic mechanisms for removal of inflammatory cells during resolution. Finally, antibody blockade of G2A signaling in vivo prolonged zymosan-induced neutrophilia in wild-type mice, whereas having no effect in gp91phox-/- mice where lyso-PS are not generated. Taken together, we show that lyso-PS are modified PS species generated following activation of the NADPH oxidase and lyso-PS signaling through the macrophage G2A functions to enhance existing receptor/ligand systems for optimal resolution of neutrophilic inflammation.

Nonsteroidal Anti-inflammatory Drug-activated Gene (NAG-1/GDF15) Expression Is Increased by the Histone Deacetylase Inhibitor Trichostatin A

Nonsteroidal anti-inflammatory drug-activated gene (NAG-1) is a putative tumor suppressor whose expression can be increased by drug treatment. Glioblastoma is the most common central nervous system tumor, is associated with high morbidity and mortality, and responds poorly to surgical, chemical, and radiation therapy. The histone deacetylase inhibitors are under current consideration as therapeutic agents in treating glioblastoma. We investigated whether trichostatin A (TSA) would alter the expression of NAG-1 in glioblastoma cells. The DNA demethylating agent 5-aza-dC did not increase NAG-1 expression, but TSA up-regulated NAG-1 expression and acted synergistically with 5-aza-dC to induce NAG-1 expression. TSA indirectly increases NAG-1 promoter activity and increases NAG-1 mRNA and protein expression in the T98G human glioblastoma cell line. TSA also increases the expression of transcription factors Sp-1 and Egr-1. Small interfering RNA experiments link NAG-1 expression to apoptosis induced by TSA. Reporter gene assays, specific inhibition by small interfering RNA transfections, and chromatin immunoprecipitation assays indicate that Egr-1 and Sp-1 mediate TSA-induced NAG-1 expression. TSA also increases the stability of NAG-1 mRNA. TSA-induced NAG-1 expression involves multiple mechanisms at the transcriptional and post-transcriptional levels.

Gene-specific Requirement of a Nuclear Protein, IκB-ζ, for Promoter Association of Inflammatory Transcription Regulators

Expression of many inflammatory genes is induced through activation of the transcription factor NF-kappaB. In contrast to the advanced understanding of cytoplasmic control of NF-kappaB activation, its regulation in the nucleus has not been fully understood despite its importance in selective gene expression. We previously identified an inducible nuclear protein, IkappaB-zeta, and demonstrated that this molecule is indispensable for the expression of a group of NF-kappaB-regulated genes. In this study, we established a unique gene induction system, in which IkappaB-zeta is expressed independently of inflammatory stimuli, to specifically investigate the molecular basis underlying IkappaB-zeta-mediated gene activation. We show that in the presence of IkappaB-zeta other primary response genes are dispensable for the expression of the target secondary response genes. ChIP analyses revealed that IkappaB-zeta is required for stimulus-induced recruitment of NF-kappaB onto the target promoter in a gene-specific manner. Surprisingly, IkappaB-zeta is also necessary for the gene-selective promoter recruitment of another inflammatory transcription factor, C/EBPbeta, and the chromatin remodeling factor Brg1. We propose a new gene regulatory mechanism underlying the selective expression of inflammatory genes.