Heart Rot Research Articles

Evaluation of Selected Chemical Pesticides for Controlling Bacterial Heart Rot Disease in Pineapples Variety MD2

Bacterial heart rot (BHR) disease in pineapple variety MD2 is caused by Dickeya zeae syn. Erwinia chrysanthemi. The present study aims to screen the effectiveness of four systemic chemical pesticides in different dosages for controlling the BHR pathogen in vitro and to evaluate the effectiveness of delivery techniques of the selected chemical pesticides based on in vitro results to control the disease under rain shelter conditions. The pathogen was isolated from symptomatic pineapple leaves with the appearance of water-soaked and rotten basal tissues and confirmed via pathogenicity test. A poisoned food technique was used for in vitro assessment. The pathogen was tested with different pesticide concentrations of 250, 500, 750, 1000 and 1500 mg L−1. Two fungicides were selected based on in vitro study for further investigation under the rain shelter condition. This in vivo study was performed with arrangement of complete randomize design with five treatments and 10 replicates of pineapple plants per treatment. The treatments were difenoconazole with pathogen, mancozeb with pathogen, benomyl with pathogen (standard industry), positive control (pathogen only) and negative control (without pathogen). Data of disease incidence (DI) and disease severity index (DSI) were collected for six-weeks after the early symptoms of BHR were detected. Finding of in vitro study showed that mancozeb and difenoconazole were able to control the pathogen at the lowest concentration of 250 mg L−1 from the recommended rate. These two fungicides were consistently giving the similar results for the rain shelter study. The treatments with difenoconazole recorded the lowest value of DI and DSI with 4.60% and 0.00%, respectively. Then followed by mancozeb with DI of 5.62% and 63.71%. In contrast, besides positive control, the treatment of benomyl displayed the high values of DI (8.38%) and DSI (89.81%). Based on these findings, difenoconazole with combination method is the most effective control method for controlling BHR in pineapple. However, this research is highly recommended to be further investigated under the field conditions.

Review: Fruit collapse and heart rot disease in pineapple: Pathogen characterization, ultrastructure infections of plant and cell mechanism resistance

Abstract. Cano-Reinoso DM, Soesanto L, Kharisun, Wibowo C. 2021. Review: Fruit collapse and heart rot disease: Pathogen characterization, ultrastructure infections of plant and cell mechanism resistance. Biodiversitas 22: 2477-2488. Fruit collapse and bacterial heart rot are diseases in pineapple caused by Erwinia chrysanthemi (later classified as Dickeya zeae) which are increasingly prevalent in the last decade, causing devastating production loss in pineapple cultivation. Yet, comprehensive knowledge to tackle such diseases is limited, understandably due to the relatively new emerge of the diseases. Here, we review the causes of bacterial heart rot and fruit collapse, stages of infection, typical symptoms and the occurrence of resistance mechanisms in plants. In pineapple, the fruit collapse is noticeable by the release of juice and gas bubbles, also the shell of the fruit that turns into olive-green. Meanwhile, bacterial heart rot is characterized by water-soaked zones on the leaves, the formation of brown streaks on the lamina and in the mesophyll, and light-brown exudate in the blisters. The most common means of penetration into the host plant used by this type of pathogen is through plant natural openings, injuries and wounds, and entire surfaces. Concurrently, plants and fruits develop disease-resistant mechanisms to inhibit infection growth under this pathogenic attack. These mechanisms can be divided into hypersensitive reactions, locally acquired resistance, and systematic acquired resistance. In addition, pathological infections produce an interaction of the cell wall with pectolytic enzymes. Understanding the membrane breakdown process carried out by these enzymes has become critical to a pineapple protection plan. This review suggests that future research to tackle fruit collapse and bacterial heart rot can be focused on disease-resistant mechanisms, and their effects on the cell wall status with an enzymatic characterization.

Wood Loss Assessment in Forest of Sal (Shorea robusta) by Heart Rot of Central Terai of Nepal

A significant volume of wood was lost due to wood defects; however, few studies were done to quantify wood loss by wood defects. This study was focused on quantifying wood loss by heart rot, especially hollowness in Shorea robusta. The study was conducted in Tileswornath community forest of Rautahat district. The data were collected from the felling site of the regeneration felling block of Tileswornath community forest. 44 trees were selected randomly, and tree diameter, total height, and volume were measured. The destructive method was followed as heart rot cannot be visible from the surface. Felled trees were sanctioned into 285 logs and separated based on the hollowness. Hollow diameters at both thin end and mid and thick end, as well as length, were measured on the hollow log, and Smalian’s formula was used to calculate the volume of hollowed portion, and volume calculation formula for the cylinder was used to calculate total volume. For the solid logs, mid diameter and length of the log were measured and volume calculation formula for the cylinder was used to calculate total volume. Logistic regression was performed to identify the relation of total height and diameter with the probability of hollowness presence. The study showed that 59% of sampled trees and 34.39% of logs were found to be hollowed due to heart rot. 41.79% volume was occupied by hollow on the hollowed log. Logistic regression discards the relation of height to the hollowness but signified the relation of diameter to the probability of hollowness presence. Before implementation of scientific forest management modality, the timber retained in stump per tree was found as 0.18 cubic feet.

Comparison of Polysaccharides Extracted from Cultivated Mycelium of Inonotus obliquus with Polysaccharide Fractions Obtained from Sterile Conk (Chaga) and Birch Heart Rot.

The polysaccharides of the sterile conk of Inonotus obliquus (Chaga) have demonstrated multiple bioactivities. The mycelium of this basidiomycete, obtained after submerged cultivation, has been considered a feasible alternative to the sterile conk for the production of polysaccharides. However, previous research has paid little attention to the differences in the structures of polymers obtained from the different resources. Moreover, the birch wood colonized by I. obliquus has never been investigated as a source of bioactive polysaccharides. In the present study, polysaccharide fractions produced from cultivated mycelium, sterile conks of different geographical origins, and birch heart rot were investigated. High amounts of phenolic compounds, possibly lignans, were bound to the sterile conk polysaccharides. Mycelial polysaccharides were rich in α- and β-glucans and had high (105 Da) and low (104 Da) molecular weight populations. On the other hand, sterile conk polysaccharides were mainly β-glucan of lower and monodispersed molecular weight (103 Da). Heart rot polysaccharides were comprised mainly of low molecular weight (103 Da) hemicelluloses. Nevertheless, fungal polysaccharides were identified in the extracts. The differences in structure and molecular properties among the polysaccharide fractions of mycelium, heart rot, and sterile conk are likely associated with differences in bioactivities and, therefore, in nutraceutical potential.

First report of rhizome rot of banana caused by Klebsiella variicola in India.

Rhizome rot or soft rot disease is one of the major problems in banana (Musa spp.) cultivation, as it causes germination failure and death of early stage plants. A roving survey conducted during 2017 to 2019 in the major banana growing states of India indicated a 5-30% incidence of rhizome rot in commercial cultivars. The symptoms observed were yellowing of leaves, necrotic drying with or without heart rot, and yellow or brown water soaked spots with dark brown margins in the rhizomes. Decay of tissues, cavity formation and brown ooze with foul smell, and toppling were also observed. To isolate bacteria, dissected diseased tissues were surface sterilized and plated on Crystal Violet Pectate (CVP) medium. Of 60 samples plated on CVP medium, three samples collected from cvs. NeyPoovan-AB (Karur, Tamil Nadu, 10°56'36.8"N;78°24'12.5"E), Grand Naine-AAA (Tiruchirappalli, Tamil Nadu, 10°47'26.1"N;78°34'14.8"E) and Thellachakkarakeli-AAA (East-Godavari, Andhra Pradesh, 16°51'32.1"N;81°46'08.4"E), did not yield any bacteria; however, when plated on nutrient agar, they produced whitish to dull white, mucoid, raised, round and translucent colonies, and three isolates were named as NPK-3-48, GTC-5 and 1-1B-3, respectively. Because these colonies were distinct from colonies obtained on CVP medium (which were analyzed and confirmed separately as Pectobaterium sp.) (Gokul et al. 2019), they were further characterized. Amplification of 16S rDNA genes of NPK-3-48, GTC-5 and 1-1B-3 isolates using universal primers (27F 5' - AGAGTTTGATCCTGGCTCAG - 3'; 1492 R 5' - GGTTACCTTGTTACGACTT - 3') and rpoB gene (Rosenblueth et al. 2004) was carried; the amplicons were sequenced and deposited in NCBI (Accessions MW036529-MW036531; MW497572-MW497574). Phylogenetic analysis of rpoB clearly showed that the isolates NPK-3-48, GTC-5, 1-1B-3 are Klebsiella variicola (Rosenblueth et al. 2004) Besides, biochemical tests also indicated that all three isolates were Gram negative, catalase positive, oxidase negative and able to utilize glucose, maltose and citrate (Ajayasree and Borkar 2018). Therefore, the above said morphological, molecular and biochemical analyses carried out indicated that NPK-3-48, GTC-5, 1-1B-3 are of K. variicola. Earlier, K. variicola causing soft rot has been reported on banana in China (Fan et al. 2016), plantain soft rot in Haiti (Fulton et al. 2020) and carrot soft rot in India (Chandrashekar et al. 2018). For pathogenicity tests, these three isolates were grown in nutrient broth for 48 h at 37±1°C and the cells were harvested by centrifugation. Five milliliters of the culture suspension (2×108 CFUmL-1) taken in a syringe was injected into rhizomes of three month old tissue cultured Grand Naine plants. Each bacterial isolate was injected into eight banana plants at soil level. Appropriate controls were maintained. Inoculated plants were maintained in a glasshouse at 32±2°C and after 30-35 days, rhizome rot symptoms appeared in all the three bacterial isolates inoculated plants but in none of the control plants. The Koch's postulates were proved by re-isolation and identification.To the best of our knowledge, this is the first report of K. variicola causing rhizome rot disease of banana in India.

First report of Fusarium subglutinans causing heart rot on Cymbidium hybridum in China

Cymbidium is an ornamental plant and widely cultivated in China. During 2017–2019, a disease with heart rot symptoms was observed on the young plants of Cymbidium hybridum in Hangzhou City, Zhejiang Province, China. Disease symptoms were observed in two interior leaves at the center of the plant with brown lesions. The whole plant turned brown and necrotic gradually. The pathogen isolated from infected plants was identified as Fusarium subglutinans based on morphological characteristics and molecular identification. To our knowledge, this is the first report of F. subglutinans causing heart rot on C. hybridum in China.

Phenolics content and antioxidant activity of wood extractives from three clones of Acacia hybrid (Acacia mangium × Acacia auriculiformis)

The objective of this study was to investigate the extractive content of three fast growing Acacia hybrid clones (Clone 16, 25, and 44) wood in three radial directions (SW = sapwood; OHW = outer heartwood; IHW = inner heartwood); total phenolic, flavonoid, flavanol contents (colorimetric assay); and antioxidant activity (1,1-diphenyl-2-picryl-hydrazyl (DPPH) radical scavenging assay). Extractions were done with three different solvents in successive (n-hexane = H; methanol = M; hot water = W), yielded 0,69 % – 1,70 %; 1,51 % – 10,86 %; and 0,51 % – 1,16 % of extractive contents, respectively. The total phenolic content (TPC) from TPC-H, TPC-M, and TPC-W ranged between 3,68 mg of gallic acid equivalent (GAE)/g – 10,41 mg GAE/g; 76,83 mg GAE/g – 448,35 mg GAE/g; and 43,28 mg GAE/g – 198,92 mg GAE/g, respectively; the total flavonoid content (TFC) from TFC-H, TFC-M, and TFC-W between 4,23 mg of quercetin equivalent (QE)/g – 41,51 mg QE/g; 29,55 mg QE/g – 133,71 mg QE/g; and 7,70 mg QE/g – 29,37 mg QE/g, respectively; total flavanol content (TVC) from TVC-H, TVC-M, and TVC-W ranged between 28,74 mg of catechin equivalent (CE)/g – 66,90 mg CE/g; 83,39 mg CE/g – 247,18 mg CE/g; and 7,08 mg CE/g – 29,21 mg CE/g, respectively. Furthermore, the antioxidant activity was found to be significantly affected by the radial factor with the strongest activity exhibited by inner heartwood extract with an IC50 value of 255,77 μg/ml (gallic acid IC50 showed a value of 39,00 μg/ml). Among clones, clone 16 was determined to have the highest extractive, total flavonoid as well as flavanol contents. Thus, clone 16 was hypothesized to be more resistance against heart rot disease

Characterization of Alternaria Species Associated with Heart Rot of Pomegranate Fruit.

This study was aimed at identifying Alternaria species associated with heart rot disease of pomegranate fruit in southern Italy and characterizing their mycotoxigenic profile. A total of 42 Alternaria isolates were characterized. They were obtained from pomegranate fruits with symptoms of heart rot sampled in Apulia and Sicily and grouped into six distinct morphotypes based on macro- and microscopic features. According to multigene phylogenetic analysis, including internal transcribed spacer (ITS), translation elongation factor 1-α (EF-1α), glyceraldehyde-3-phosphate dehydrogenase (GAPDH) and a SCAR marker (OPA10-2), 38 isolates of morphotypes 1 to 5 were identified as Alternaria alternata, while isolates of morphotype 6, all from Sicily, clustered within the Alternaria arborescens species complex. In particular, isolates of morphotype 1, the most numerous, clustered with the ex-type isolate of A. alternata, proving to belong to A. alternata. No difference in pathogenicity on pomegranate fruits was found between isolates of A. alternata and A. arborescens and among A. alternata isolates of different morphotypes. The toxigenic profile of isolates varied greatly: in vitro, all 42 isolates produced tenuazonic acid and most of them other mycotoxins, including alternariol, alternariol monomethyl ether, altenuene and tentoxin.

Performance and Phytochemical Content of 22 Pomegranate (Punica granatum) Varieties

Pomegranate is a drought-tolerant and salt-tolerant crop. Its fruits contain high levels of phytochemicals that have many health benefits. Pomegranate has the potential to be an alternative crop in areas where water availability is limited, such as west Texas. However, more than 500 pomegranate varieties are estimated to exist worldwide, and little is known about which varieties are suitable for growing in the west Texas region. Therefore, the objective of this study was to evaluate the field performance of 22 pomegranate varieties, specifically based on phenology, resistance to sunburn, fruit split, fruit rot (resistance was calculated by subtracting the percent incidence by 100), yield, fruit phytochemicals, and Brix over the course of 3 years from 2016 to 2018. Cold damage, caused by below-freezing temperatures encountered from Nov. 2018 to Feb. 2019, was also evaluated in Apr. 2019. Our results showed significant varietal differences in nearly all response variables measured, indicating that varietal selection is important for pomegranate production for specific regions, such as west Texas. Leaf budding ranged from 47 to 62 days in 2016, 41 to 54 days in 2017, and 49 to 60 days in 2018. Anthesis ranged from 87 to 119 days in 2016, 80 to 94 days in 2017, and 92 to 114 days in 2018. Fruit resistance to split was broad and ranged from 7.3% to 79.1% in 2017 and from 14.2% to 99.7% in 2018. Fruit sunburn resistance ranged from 14.0% to 64.6% in 2017 and from 28.3% to 90.0% in 2018. Fruit heart rot incidence was nominal for all varieties. Total phenolic compound contents of the pomegranate fruit juice ranged from 0.81 to 1.52 mg GAE/mL, and the total antioxidant capacity ranged from 3.44 to 6.81 mg TE/mL. The yield per tree ranged from 1.00 to 7.96 kg in 2017 and from 0.81 to 10.26 kg in 2018. Brix ranged from 12.5% to 17.4% in 2017 and from 13.9% to 18.4% in 2018. Early winter below-freezing temperatures caused different degrees of cold damage; however, 5 of 22 varieties that originated from Russia did not show any cold damage. Results of a hierarchical cluster analysis based on the means of the key response variables of yield and Brix indicated that four varieties (Al-Sirin-Nar, Russian 8, Ben Ivey, and Salavatski) were notable for having both high yield and high Brix.

Effect of Fungus Meripilus giganteus (Pers.) P. Karst. on Occurrence and Development of False Heartwood and Rot in Fagus sylvatica L. Round Wood

Common beech is one of the most widespread and important European tree species, widely used in timber industry and for energy production. Under specific set of complex factors, it facutatetivly develops false heartwood, which considerably decreases market demand and value of processed logs. Due to its properties, false heartwood is more susceptible to attack of wood decay fungi, which leads to further loss of wood quality and value. One of the most common fungi able to cause heart rot in beech is Meripilus giganteus, known for its spread in the basal parts of the tree, where it can affect most valuable sections of round wood. The aims of this study were to monitor the distribution of fungus and appearance of its fruiting bodies in research area, and to analyze the extent of fungus impact on shape and size of false heartwood and occurrence and length of rot in infected trees, while taking into account the observed stem damage as a possible influential factor. Fruiting bodies occurrence, life span and position on a tree were monitored during a six-year period. For trees with confirmed infection, stem damage was evaluated and appointed to one of four size classes. False heartwood shape and share in associated stem cross-section were observed and measured on 1–4 cross-sections per tree at different heights, and compared between infected and uninfected trees. If present, length of wood decay extent on butt-log was measured. The obtained results confirmed increased susceptibility of mature trees to infection, which seemed to occur mostly via roots from where mycelium spread into stem base. It was found that Meripilus giganteus has a significant impact on enlargement and change of FH shape from cloud- to star-like, up to approximately 5 m of the stem height, thus causing devaluation of the first assortments. The presence of rot was confirmed on the majority of infected trees, extending averagely 0.5 m into the first processed log, causing the loss of utilizable volume and thus the value of round wood. Stem damage category showed no significant effect on false heartwood or rot, supporting the prevailing impact of the fungus.

Impact of Heart Rot of <i>Pericopsis elata</i> (Harms) Van Meeuwen on Yield at Harvest in Production Forests in South-Eastern Cameroon

This study of the impact of heart rot of Pericopsis elata on logging yield was conducted in Libongo, in three logging concessions of the Société d'Exploitation Forestière et Agricole du Cameroun (SEFAC). An inventory of 92 P. elata stumps in four Annual Cutting Areas (AACs) divided among three Forest Management Units (FMUs) distinguished by Minimum Operating Diameter (MOD) revealed that 22 stumps were rotten. Decay was visible on stumps with a diameter of more than 100 cm with a frequency of occurrence of 23.91%, a percentage of abandonment of 55.20% and a yield of 44.79%. The most important economic loss was revealed on 9 abandoned whole logs that cumulated a volume of 145.547 m3. The correlation between the diameter of the stumps and that of the decay gives a coefficient or correlation rate r = 0.31. The MOD for P. elata could be 80 cm and covers the biological risk class. The results indicate that P. elata shows an increasing gradient of decay rate with increasing tree diameter, resulting in a loss of material for larger diameter trees, and consequently a decrease in material yield at processing.

Cavity construction by reintroduced populations of Red‐cockaded Woodpeckers (Dryobates borealis)

Although species reintroduction attempts are now common, monitoring of reintroduction attempts rarely extends beyond initial population establishment. This short timespan likely fails to document long‐term population stability, subtle changes in behavior, and the potentially larger effects that some reintroduced species may have on other species. The Red‐cockaded Woodpecker (RCW; Dryobates borealis) is an important habitat specialist and ecosystem engineer that excavates cavities in living trees. Excavation of natural RCW cavities can take years to complete, but they also persist for many years and are used by many other species. We quantified characteristics of cavity trees excavated by RCWs (n = 44) in two populations that were reintroduced to unoccupied areas more than 10 years earlier. We measured features associated with heartwood rot and used generalized linear mixed effects regression to determine whether these features differed for trees selected for cavity excavation compared with random neighboring trees. We also assessed population trends for cavity‐nesting species that commonly used RCW cavities on one of the sites. Height of first live limb was the only factor distinguishing natural RCW cavity trees from control trees. Four of six cavity‐nesting species monitored increased significantly following RCW establishment. The increases may relate to the many natural and artificial cavities created during the reintroduction effort. Future reintroductions of the RCW should lead to successful natural cavity excavation if sufficiently large trees with smaller live crowns are present. Future efforts may also benefit the broader community of cavity‐nesting birds.

Diseases of Eucalypts in Paraguay and First Report of Teratosphaeria zuluensis from South America

Background and objectives: The global forest economy is threatened by eucalypt pathogens which are often latent or cryptic species that escape common quarantine and detection methods. Plantation forestry using eucalypts is of considerable importance to Paraguay, but knowledge regarding the pests and diseases affecting these plantations is limited. This study identified fungal diseases present in these plantations. Materials and Methods: We surveyed eucalypt plantations in four provinces in Paraguay and collected material from diseased trees for identification of the causal agents. The samples were analyzed using a combination of morphological and molecular methods. Results: Diseases encountered included Botryosphaeria stem canker, Calonectria leaf blight, Chrysoporthe stem canker, myrtle/eucalypt rust, Coniella leaf spot, heartwood rot and Teratosphaeria stem canker. Contrary to expectations, the causal agent of Teratosphaeria stem canker was identified as Teratosphaeria zuluensis (M.J. Wingf., Crous & T.A. Cout.) M.J. Wingf. & Crous and not Teratosphaeria gauchensis (M.-N. Cortinas, Crous & M.J. Wingf.) M.J. Wingf. & Crous, that is commonly documented for the South American region. Conclusions: This study updates the knowledge on forest fungal pathogens in Paraguayan eucalypt plantations and is the first report of T. zuluensis in Paraguay and in South America.

In vitro antifungal activities of endophytic bacterial isolates against postharvest heart rot disease agentAlternaria alternatain pomegranate fruits

In vitro antifungal activities of endophytic bacterial isolates against postharvest heart rot disease agent<i>Alternaria alternata</i>in pomegranate fruits

Identification of Three Monofunctional Diterpene Synthases with Specific Enzyme Activities Expressed during Heartwood Formation in Western Redcedar (Thuja plicata) Trees.

Upon harvest, Western redcedar (WRC; Thuja plicata) trees have a high incidence and extent of heartwood rot. While monoterpenoids and lignans have been linked to rot resistance in this species, other specialized metabolites, such as diterpenes, are likely to contribute to rot resistance. Here we report the cloning and functional assessment of three putative diterpene synthase (TpdiTPS) genes expressed during heartwood formation in WRC. The predicted proteins of the three genes lack either of the two catalytically independent active sites typical of most diTPS, indicating monofunctional rather than bifunctional activity. To identify potential catalytic activities of these proteins, we expressed them in genetically engineered Escherichia coli strains that produce four potential substrates, geranylgeranyl diphosphate (GGDP), ent, syn, and normal stereoisomers of copalyl diphosphate (CDP). We found that TpdiTPS3 used GGDP to produce CDP. TpdiTPS2 used normal CDP to produce levopimaradiene. TpdiTPS1 showed stereoselectivity as it used normal CDP to produce sandaracopimaradiene and syn-CDP to produce syn-stemod-13(17)-ene. These genes and protein enzymatic activities have not been previously reported in WRC and provide an opportunity to assess their potential roles in heartwood rot resistance in this economically important species.

Production of wooden I-beams from angular elements for low-rise housing

Due to the deterioration of the environmental situation, an increasing number of coniferous trees are affected by butt heart rot. For a more sustainable use of resources, one needs to use round assortments with the presence of sound rot for the manufacture of sawn products. I-beams are widely used in low-rise wooden housing construction. High installation speed without the use of heavy equipment and ease of assembly increase the speed and adaptability of building construction. A method for manufacturing I-beams from corner elements obtained as a result of cutting round timber with heart rot is proposed. The elements of the angular cross section are glued together to obtain an I-beam. The strength characteristics of an I-beam glued from angular cross-sectional elements are determined. It was established that the design characteristics of I-beams obtained by the proposed technology withstand operational loads. Values of normative and shear stresses arising upon application of loads do not exceed 50% of the permissible values. The beam deflection does not exceed 80% of the permissible deflection value. The use of round timber with core rot increases wood resources for low-rise housing.

Navisporus floccosus causing heart rot in tropical trees

Navisporus floccosus causing heart rot in tropical trees (Dalbergia sissoo, D. latifolia, Ficus bengalensis, Pongamia pinnata and Shorea robusta) is reported from Chhattisgarh, Madhya Pradesh and Odisha. Worldwide distribution of eight other species of the genus is also discussed.

The Antibacterial Effect of the Extract of Eupatorium indica Leaves on Two Main Postharvest Diseases of Pineapple

Phytophthora nicotianae var. Parasitica and Thielaviopsis paradoxa, often occur in pineapple production. In order to explore the bacteriostatic effect of the extract on the pathogen of pineapple disease, and to provide theoretical basis for the application of the extract on the prevention and control of pineapple fungal disease, the antibacterial activity of three extracts of Eupatorium adenophorum against two pathogenic bacteria of pineapple was studied. Two components with antibacterial activity extracted from the leaves of Eupatorium indica leaves were used as “fungicide”. The antibacterial effects of the three extracts on the pathogens of pineapple heart rot and black rot were studied. The results showed that the crude extracts of H, B, and C components at a concentration of 2 mg / ml against pineapple heart rot and black rot pathogens reached 76.14%, 77.94%, 80.40% and 40.15%, 60.50%. The EC90 values of the crude extracts H, B, and C for pineapple heart rot were 4.48, 2.67, and 4.45 mg / ml, respectively. Respectively, the EC90 values for pineapple black rot pathogens were 10.60, 7.17, and 3.27 mg / ml. Relatively speaking, the three kinds of extracts have better antibacterial effects on pineapple heart rot pathogens than pineapple black rot pathogens; B and C two component substances have great potential to prevent and cure pineapple heart rot and black rot.

Revision and Compilation of Health Management Plan of Khair (Acacia catechu)

Acacia catechu (Khair) is one of the significant tree species evolved together with Nepali communities. The tree is widely used for medicinal purposes, feeding the livestock, fulfilling the structural needs, and satisfying religious and spiritual needs. Despite the wide use and importance of this tree, the available publications have failed to address the risks the tree is vulnerable to, and develop a management design to overcome these threats. Due to these reasons, the people are growing the Khair trees without any robust health management plan. The abundance and overall importance of this tree in the South Asian region strongly demands an interpretative and comprehensive way of its cultivation. This study is aimed towards bringing together the available information on Khair and finally coming up with an advantageous management plan that can deal with all the hazards the tree is prone to, and help in the production of healthy and of economically high-value timber. This study only deals with two of the several prevalent fungal stresses-Ganoderma lucidum and Fomes badius, causing root rot and heart rot, respectively, putting the tree under risk. The heart rot and root rot are capable of destroying the whole site rendering the trees useless for consumption. The findings from this study can help cultivators know the nature of the diseases and their occurrences and improve the way of cultivating the tree and take prompt actions on the syndromes.

Fusarium Heart Rot: First Report on Pineapple in South Cotabato and Davao City, Philippines

Pineapple is among the major export commodities in the Philippines. A species of Fusarium was found for the first time to be consistently associated with diseased leaves collected from MD2 ‘Super Sweet’ pineapple plantations in South Cotabato and Davao City. Test of proof of pathogenicity of the fungus following Koch’s postulates and bioassay test of FosetylAl products against the fungus were conducted. For the bioassay, the treatments used were the following: 1) untreated; 2) Fosetyl-Al, Brand X at 2.25 and 5g/L water; 3) Fosetyl-Al, Brand Y at 2.25 and 5g/L water; and 4) Fosetyl-Al, Brand Z at 2.25 and 5g/L water. The experiment was laid out in Completely Randomized Design with three replications at three plates per replicate. The data was analyzed using Analysis of Variance and treatment means were compared using Tukey’s Honest Significant Difference. Symptoms of the disease included lesions, which later turned into brown, necrotic tissues at the base of infected pineapple leaves, while advanced symptoms showed infected tissues with dark brown to black margins, later dried up and became soft-rotted. The fungus produced cottony white aerial mycelia on the cut surface of the tissues planted on Potato Sugar Agar (PSA) medium. Mycelia were hyaline and septated. Macro-conidia were single-celled, slightly curved, and sickle-shaped with three or more septates. Pure cultures turned light purple after eight days of incubation in full strength PSA. Chlamydospores formed after two months of incubation. Based on cultural and morphological characteristics, the fungus was identified as Fusarium sp. Bioassay results showed that Fosetyl-Al Brand X and Z at 5.0 g/L water significantly inhibited the growth of Fusarium sp. infecting pineapple leaves from 97.9 to 100%, respectively, after 9 days of incubation.