Number Of Haplotypes Research Articles

Variability of Chalcone Synthase in Chamomile Accessions (Matricaria chamomilla)

AbstractChamomile (Matricaria chamomilla) is an important medicinal plant whose beneficial activities partly rely on certain flavonoids. The first dedicated step in flavonoid biosynthesis is chalcone synthase (CHS, EC 2.3.1.74). The genomic DNA of CHS was studied in six chamomile specimens from different genotypes to describe interspecimen, as well as interspecific, variability. One specimen of M. discoidea was included as an outgroup. The two exons of CHS of M. chamomilla (McCHS) and M. discoidea (MdCHS) were 188 bp and 1,011 bp long, separated by an intron of variable length between 192 and 199 bp in McCHS and 201 bp in MdCHS, respectively. The two exons with 5.3 and 6.2 mutations per 100 bp, respectively, were more conserved than the intron with 11.5 mutations per 100 bp. In total, 96 SNPs were detected in both species, of which 12 SNPs were only present in MdCHS and 80 SNPs only in McCHS. Overall, 70 haplotypes (multilocus genotypes, MLGs) were detected. The samples could be classified into two groups, a ʼcompactʼ group of a low number and diversity of haplotypes and a ʼvariableʼ group of a high number and diversity of haplotypes. Of the 74 SNPs in McCHS, only six SNPs were non-synonymous. However, the amino acid changes did not affect critical areas of the enzyme. The combination of the six SNPs resulted in nine translated amino acid MLGs. The CHS network located MdCHS, due to the crossing barrier, quite distant from chamomile. MdCHS docked to McCHS at a position from where McCHS divergently evolved into two directions.

Genetic diversity of Rhombomys opimus and Meriones meridianus with potential divergence of plague resistance in the Junggar Basin plague focus based on RT1-Db1*exon1

In the Junggar Basin plague focus, Rhombomys opimus and Meriones meridianus live together, and their parasitic fleas have a similar community structure. However, R. opimus has significantly higher positive rates of Yersinia pestis and anti-F1 antibody compared with M. meridianus. In this study, Y. pestis- and antiF1 antibody-negative R. opimus and M. penicilliger were collected in Qitai county, Fukang city and Mulei county of the eastern part of the Junggar Basin. The genomic DNA was extracted from their spleen tissues, and RT1-Db1*exon1 was amplified through PCR procedure and then sequenced. Sequence analysis was performed and molecular diversity parameters were calculated and compared. The results showed that there were significant differences in nucleotide composition, amino acid composition, number and distribution of single nucleotide polymorphism (SNP) sites and number of haplotypes between R. opimus and M. penicilliger. The nucleotide diversity (π) for R. opimus was 0.00420 ± 0.00139, the haplotype diversity (h) was 0.833 ± 0.086, and the average number of nucleotide differences (K) was 2.02564. The π for M. penicilliger was 0.06569 ± 0.02524, and the h was 1.000 ± 0.045, and the K was 10.4444. The fixation index (FST) value between R. opimus and M. penicilliger was 0.9207. Furthermore, the FST value within R. opimus (0.0275) was significantly lower than that within M. penicilliger (0.2106), indicating a greater genetic variation of M. penicilliger compared with R. opimus. In conclusion, the genetic diversity analysis based on RT1-Db1*exon1 showed that M. penicilliger had higher gene polymorphism and greater genetic differentiation compared with R. opimus in the Junggar Basin plague focus, which might be associated with the low infection rate of Y. pestis.

Mitochondrial DNA evidence reflects high genetic divergence of Amynthas aspergillum (Oligochaeta: Megascolecidae) in southern China.

Amynthas aspergillum (Perrier, 1872), a natural resource used in traditional Chinese medicine (Guang-dilong) with high economic value, is widely distributed in forests and farmland habitats in the hilly areas of southern China. To investigate the extent of genetic differentiation and diversity in A. aspergillum, a population genetic structure study was performed on 157 samples from 75 locations in southern China using the mitochondrial genes COI, COII, 12S rRNA, 16S rRNA, and NDI. The results indicated that A. aspergillum had a high level of genetic diversity, and variation within populations was the main source of the total variation. Six deeply divergent mitochondrial clades (I-VI) were detected using both phylogenetic tree and haplotype network analyses. This finding was supported by the high Kimura two-parameter genetic distance and the pairwise fixation index value obtained based on the COI gene. No significant phylogeographic structures were observed. The widespread geographic distribution of clades II, IV, and VI suggested a recent demographic expansion based on multiple analysis results. These results include a high level of Hd and low π, star-shaped haplotype network structures with a high number of less frequent haplotypes, significantly negative neutrality test values, and a unimodal mismatch distribution pattern. The divergence time estimates and reconstruction of the ancestral area revealed that A. aspergillum originated in Guangxi Province and underwent initial intraspecific diversification in the early Pliocene to generate clade I. Then, it gradually dispersed eastward and rapidly differentiated into clades II-V during the Pleistocene. The Yunnan-Guizhou Plateau and Nanling and Wuyi Mountains might act as geographical barriers for the spread of A. aspergillum to the west and north.

Genetic variability of Aedes aegypti (Diptera: Culicidae) in El Salvador and Honduras: presence of a widespread haplotype and implications for mosquito control

BackgroundThis study examined population genetics of Aedes aegypti in El Salvador and Honduras, two adjacent countries in Central America. Aedes aegypti is associated with yellow fever, dengue, chikungunya, and Zika. Each year, thousands of cases of dengue are typically reported in El Salvador and Honduras.MethodsIn El Salvador, collections were obtained from five Departments. In Honduras, samples were obtained from six municipalities in four Departments. Mitochondrial DNA cytochrome oxidase I (COI) was sequenced, and consensus sequences were combined with available sequences from El Salvador to determine haplotype number, haplotype diversity, nucleotide diversity, and Tajima’s D. A haplotype network was produced to examine the relationship between genotypes.ResultsIn El Salvador, there were 17 haplotypes, while in Honduras there were 4 haplotypes. In both El Salvador and Honduras, Haplotype 1 is most abundant and widespread. In El Salvador, haplotype H2 was also widespread in 10 of 11 sampled municipalities, but it was not present in Honduras. The capital of El Salvador (San Salvador) and the eastern region of ES had the highest haplotype diversity of regions sampled.ConclusionsHaplotype 1 and H2 each belong to different phylogenetic lineages of Ae. aegypti. The most geographically widespread haplotype (H1) may have been present the longest and could be a remnant from previous eradication programs. These data may contribute to future control programs for Ae. aegypti in the two countries.Graphical

Chloroplast Haplotype Diversity in the White Oak Populations of the Italian Peninsula, Sicily, and Sardinia

A phylogeographic study on the chloroplast DNA of natural white oak forests (Quercus subgen. Quercus, sect. Quercus) was carried out to identify possible haplotype-structured distribution within the Italian Peninsula, Sicily, and Sardinia. Sixty white oak populations belonging to Q. frainetto, Q. robur and the collective groups Q. petraea and Q. pubescens were considered and analyzed by combining five Chloroplast Simple Sequence Repeat (cpSSR) markers. A total of 28 haplotypes were detected. Central and southern Italy displayed the highest variability (14 and 10 haplotypes, respectively), followed by northern Italy (7), Sardinia (7), and Sicily (5). A complex geographical structure of the haplotype distribution emerged, highlighting (i) a high number of low-frequency haplotypes; (ii) the marked isolation of Sardinia; (iii) the occurrence of haplotypes widely distributed throughout the Italian Peninsula; (iv) the idiosyncrasy of Sicily, which exhibits exclusive haplotypes, and haplotypes shared with Sardinia and the rest of the Italian Peninsula. The haplotype distribution was also found to be partially related to the taxonomic identity of the specimens, with the following features emerging: a geographic separation between the central Italy and southern Italy Q. frainetto populations, an unexpected discontinuity between the Calabrian and Sicilian Q. petraea subsp. austrotyrrhenica populations, and the absence of the most common haplotype among the Q. pubescens populations of central and southern Italy.

Synergism between remdesivir and ribavirin leads to SARS-CoV-2 extinction in cell culture.

There is a need for effective anti-COVID-19 treatments, mainly for individuals at risk of severe disease such as the elderly and the immunosuppressed. Drug repositioning has proved effective in identifying drugs that can find a new application for the control of coronavirus disease, in particular COVID-19. The purpose of the present study was to find synergistic antiviral combinations for COVID-19 based on lethal mutagenesis. The effect of combinations of remdesivir and ribavirin on the infectivity of SARS-CoV-2 in cell culture has been tested. Viral populations were monitored by ultra-deep sequencing, and the decrease of infectivity as a result of the treatment was measured. Remdesivir and ribavirin exerted a synergistic inhibitory activity against SARS-CoV-2, quantified both by CompuSyn (Chou-Talalay method) and Synergy Finder (ZIP-score model). In serial passage experiments, virus extinction was readily achieved with remdesivir-ribavirin combinations at concentrations well below their cytotoxic 50 value, but not with the drugs used individually. Deep sequencing of treated viral populations showed that remdesivir, ribavirin, and their combinations evoked significant increases of the number of viral mutations and haplotypes, as well as modification of diversity indices that characterize viral quasi-species. SARS-CoV-2 extinction can be achieved by synergistic combination treatments based on lethal mutagenesis. In addition, the results offer prospects of triple drug treatments for effective SARS-CoV-2 suppression.

Genotyping Plasmodium falciparum gametocytes using amplicon deep sequencing

BackgroundUnderstanding the dynamics of gametocyte production in polyclonal Plasmodium falciparum infections requires a genotyping method that detects distinct gametocyte clones and estimates their relative frequencies. Here, a marker was identified and evaluated to genotype P. falciparum mature gametocytes using amplicon deep sequencing.MethodsA data set of polymorphic regions of the P. falciparum genome was mined to identify a gametocyte genotyping marker. To assess marker resolution, the number of unique haplotypes in the marker region was estimated from 95 Malawian P. falciparum whole genome sequences. Specificity of the marker for detection of mature gametocytes was evaluated using reverse transcription-polymerase chain reaction of RNA extracted from NF54 mature gametocytes and rings from a non-gametocyte-producing strain of P. falciparum. Amplicon deep sequencing was performed on experimental mixtures of mature gametocytes from two distinct parasite clones, as well as gametocyte-positive P. falciparum field isolates to evaluate the quantitative ability and determine the limit of detection of the genotyping approach.ResultsA 400 bp region of the pfs230 gene was identified as a gametocyte genotyping marker. A larger number of unique haplotypes was observed at the pfs230 marker (34) compared to the sera-2 (18) and ama-1 (14) markers in field isolates from Malawi. RNA and DNA genotyping accurately estimated gametocyte and total parasite clone frequencies when evaluating agreement between expected and observed haplotype frequencies in gametocyte mixtures, with concordance correlation coefficients of 0.97 [95% CI: 0.92–0.99] and 0.92 [95% CI: 0.83–0.97], respectively. The detection limit of the genotyping method for male gametocytes was 0.41 pfmget transcripts/µl [95% CI: 0.28–0.72] and for female gametocytes was 1.98 ccp4 transcripts/µl [95% CI: 1.35–3.68].ConclusionsA region of the pfs230 gene was identified as a marker to genotype P. falciparum gametocytes. Amplicon deep sequencing of this marker can be used to estimate the number and relative frequency of parasite clones among mature gametocytes within P. falciparum infections. This gametocyte genotyping marker will be an important tool for studies aimed at understanding dynamics of gametocyte production in polyclonal P. falciparum infections.

Mitochondrial DNA diversity of sperm whales (Physeter macrocephalus) in the Gulf of California under a changing environment

The mitochondrial diversity of the sperm whale in the Gulf of California (GC) from 2004 to 2017 was analyzed using the control region from 95 samples and compared with two preceding studies. This study examined the relationship between the mitochondrial genetic diversity of sperm whales, and the abundance of jumbo squid (Dosidicus gigas) in the GC, as indicated by squid catches. Furthermore, the influence of climate regimes on this relationship was also assessed. Of the total 16 haplotypes registered for the GC, eight haplotypes, representing 50%, were identified in this study. One of these haplotypes was only recorded in the Atlantic Ocean, and another is newly documented. Haplotype diversity (h = 0.640 ± 0.051) and nucleotide diversity (π = 0.00158 ± 0.00019) showed lower values than those previously reported for the GC. The genetic differentiation index among three periods analyzed was significant (Fst = 0.27, p < 0.01), with a greater variability observed within periods (72.19%) compared to between periods (27.81%). This suggests either a differential influx of haplotypes or a preference of matrilines for specific areas within the GC. The sex ratio of 3.5:1 females to males was consistent with previously reported data for the GC and other regions. A temporal decrease in the number of haplotypes in the GC coincided with an increase in Sea Surface Temperature (SST), a decrease in chlorophyll values (Chl-a), and a reduction of giant squid catches. These trends suggest that shifts in the GC climate regime could exert selective pressure, favoring certain matrilineal lineages.

DNA variants and population structure of Magelang ducks across generation

Magelang ducks (MD) are Indonesian local ducks and are known as dual-purpose type ducks which have high egg production, duck day production (DDP), and body weight size. Nowadays, the MD is selected to establish the pure line to advance the egg production trait in the Breeding and Rearing Center of Non-Ruminant Animals Banyubiru, Central Java. The mitochondrial DNA (mtDNA) Dloop region, is highly polymorphic and could be used to analyze the population genetics. The present research aims to examine the impacts of continuous selection on population structure and genetic mutations on MD across two generations using the mtDNA D-loop region. Thirty-six blood samples from the second (G2) and third (G3) generations were examined using the sequencing method. The MEGA X and DnaSP software were applied to calculate the genetic diversity, genetic distance, and to generate a phylogenetic tree. The number of haplotypes (H), haplotype diversity (Hd), and Tajima's D are 26, 0.9746, and -1.46, respectively. The Fst value of MD is 0.156. The genetic distance among populations ranges from 0.0000 – 2.097. The UPGMA analysis constructs one clade in a phylogenetic tree between MD, Indonesian local Ducks, Indian Ducks, Vietnamese Ducks, and Chinese Ducks. The study found that the genetic variation and population structure did not significantly change between the second and third generations.

Genetic differentiation of Plasmodium vivax duffy binding protein in Ethiopia and comparison with other geographical isolates

BackgroundPlasmodium vivax Duffy binding protein (PvDBP) is a merozoite surface protein located in the micronemes of P. vivax. The invasion of human reticulocytes by P. vivax merozoites depends on the parasite DBP binding domain engaging Duffy Antigen Receptor for Chemokine (DARC) on these red blood cells (RBCs). PvDBPII shows high genetic diversity which is a major challenge to its use in the development of a vaccine against vivax malaria.MethodsA cross-sectional study was conducted from February 2021 to September 2022 in five study sites across Ethiopia. A total of 58 blood samples confirmed positive for P. vivax by polymerase chain reaction (PCR) were included in the study to determine PvDBPII genetic diversity. PvDBPII were amplified using primers designed from reference sequence of P. vivax Sal I strain. Assembling of sequences was done using Geneious Prime version 2023.2.1. Alignment and phylogenetic tree constructions using MEGA version 10.1.1. Nucleotide diversity and haplotype diversity were analysed using DnaSP version 6.12.03, and haplotype network was generated with PopART version 1.7.ResultsThe mean age of the participants was 25 years, 5 (8.6%) participants were Duffy negatives. From the 58 PvDBPII sequences, seven haplotypes based on nucleotide differences at 8 positions were identified. Nucleotide diversity and haplotype diversity were 0.00267 ± 0.00023 and 0.731 ± 0.036, respectively. Among the five study sites, the highest numbers of haplotypes were identified in Arbaminch with six different haplotypes while only two haplotypes were identified in Gambella. The phylogenetic tree based on PvDBPII revealed that parasites of different study sites shared similar genetic clusters with few exceptions. Globally, a total of 39 haplotypes were identified from 223 PvDBPII sequences representing different geographical isolates obtained from NCBI archive. The nucleotide and haplotype diversity were 0.00373 and 0.845 ± 0.015, respectively. The haplotype prevalence ranged from 0.45% to 27.3%. Two haplotypes were shared among isolates from all geographical areas of the globe.ConclusionsPvDBPII of the Ethiopian P. vivax isolates showed low nucleotide but high haplotype diversity, this pattern of genetic variability suggests that the population may have undergone a recent expansion. Among the Ethiopian P. vivax isolates, almost half of the sequences were identical to the Sal-I reference sequence. However, there were unique haplotypes observed in the Ethiopian isolates, which does not share with isolates from other geographical areas. There were two haplotypes that were common among populations across the globe. Categorizing population haplotype frequency can help to determine common haplotypes for designing an effective blood-stage vaccine which will have a significant role for the control and elimination of P. vivax.

Single nucleotide polymorphisms (SNPs) in the open reading frame (ORF) of prion protein gene (PRNP) in Nigerian livestock species

BackgroundPrion diseases, also known as transmissible spongiform encephalopathies (TSEs) remain one of the deleterious disorders, which have affected several animal species. Polymorphism of the prion protein (PRNP) gene majorly determines the susceptibility of animals to TSEs. However, only limited studies have examined the variation in PRNP gene in different Nigerian livestock species. Thus, this study aimed to identify the polymorphism of PRNP gene in Nigerian livestock species (including camel, dog, horse, goat, and sheep). We sequenced the open reading frame (ORF) of 65 camels, 31 village dogs and 12 horses from Nigeria and compared with PRNP sequences of 886 individuals retrieved from public databases.ResultsAll the 994 individuals were assigned into 162 haplotypes. The sheep had the highest number of haplotypes (n = 54), and the camel had the lowest (n = 7). Phylogenetic tree further confirmed clustering of Nigerian individuals into their various species. We detected five non-synonymous SNPs of PRNP comprising of G9A, G10A, C11G, G12C, and T669C shared by all Nigerian livestock species and were in Hardy-Weinberg Equilibrium (HWE). The amino acid changes in these five non-synonymous SNP were all “benign” via Polyphen-2 program. Three SNPs G34C, T699C, and C738G occurred only in Nigerian dogs while C16G, G502A, G503A, and C681A in Nigerian horse. In addition, C50T was detected only in goats and sheep.ConclusionOur study serves as the first to simultaneously investigate the polymorphism of PRNP gene in Nigerian livestock species and provides relevant information that could be adopted in programs targeted at breeding for prion diseases resistance.

Genetic variation of the native Rusa deer (Rusa timorensis) in Java and Bali (Indonesia) as revealed using non-invasive sampling

Abstract. Iman MH, Kuswandi PC, Subrata SA. 2024. Genetic variation of the native Rusa deer (Rusa timorensis) in Java and Bali (Indonesia) as revealed using non-invasive sampling. Biodiversitas 25: 355-360. Rusa deer is a vulnerable species with a large geographic range but natively inhabits Java and Bali. Despite the wide distribution, its native population is declining, raising a concern about a small population's adverse genetic effect. It encourages genetic studies to provide baseline data that has been vacant recently. This research aimed to demonstrate an application of non-invasive sampling to collect DNA samples and a simple procedure to obtain and analyze genetic data for the Rusa deer. This research also aimed to provide genetic variation of the native deer population as baseline data. The research sites were Baluran, Alas Purwo in East Java, and Bali Barat national parks from which fecal samples were collected. Moreover, 20 DNA samples were isolated from the feces using a kit (Dneasy PowerSoil Pro from Qiagen) and amplified at the control region gene using a forward: AAACCAGAAAAGGAGAGCAAC and a reverse: TCATCTAGGCATTTTCAGTGCC primer. The amplicons were sequenced, and the number of Haplotypes (Hn), Haplotype diversity (Hd), nucleotide diversity (p), site polymorphism, and phylogeographic tree were determined. The result showed that all the sequences had coverage of 100% and identity &gt;98% with the Rusa timorensis sequence available in the GenBank. Furthermore, we found Hn = 11, Hd = 0.88, p = 0.005 and 30 site polymorphisms. Therefore, compared to an introduced population, the Rusa deer has a richer Hd and higher site polymorphism but a poorer p. Furthermore, we found that the Baluran population had high Hd, p, and is possibly forming a distinct clade.

Comparative phylogeography shows congruent co‐divergence in Neotropical seasonally dry forest and savanna tree species

AbstractAimThe response of South American seasonally dry tropical forest (SDTF) and savanna species to the Quaternary climate changes is still poorly understood. Here we use multi‐model inference approach to compare the phylogeography and demographic history of five trumpet tree species (also known as pau‐d'arco) and draw general biogeographical patterns: Handroanthus impetiginosus, H. ochraceus, H. serratifolius, Tabebuia aurea and T. roseoalba.LocationAmazonia, Atlantic Forest, Cerrado and Caatinga ecoregions, South America and Brazil.TaxaBignoniaceae, Tabebuia Alliance, trees.MethodsWe compiled genetic data, occurrence records and ecological niche modelling (ENM) from published articles. We used coalescent modelling to test patterns of co‐divergence, and analysed niche breadth and overlap and spatial patterns in genetic diversity using quantile regressions.ResultsSpecies showed concordant lineage divergence times in the Pleistocene. Lineage diversification and phylogeographical patterns are more related to species niche breadth than to biome (savanna or SDTF). Differences in genetic diversity among species matches the expected for the demographic scenarios obtained with coalescent simulations and ENMs: species with wider range expansion during the Last Glacial Maximum had higher diversity than species with range retraction or multiple refugia.Main ConclusionsDiversification burst in the Pliocene, and major diversification of lineages during the Pleistocene seems to be a general pattern in SDTF and savannas in the South America. The high number of haplotypes at the Central Brazil, corresponding to the Cerrado ecoregion, highlights the importance of Protected Areas for SDTFs and savannas, highly threatened biomes in Brazil.

First report on the molecular detection and genetic diversity of Anaplasma marginale in healthy dairy cattle in Khon Kaen province, Thailand

Background and Aim: Bovine anaplasmosis (BA) is one of the most important diseases of ruminants worldwide, causing significant economic losses in the livestock industry due to the high morbidity and mortality in susceptible cattle herds. Anaplasma marginale is the main causative agent of BA occurring worldwide in tropical and subtropical regions. This study aimed to investigate the first molecular detection and genetic diversity of A. marginale in dairy cattle in Khon Kaen Province, Thailand. Materials and Methods: Blood samples were collected from 385 lactating cows from 40 dairy farms in five districts of Khon Kaen, regardless of age and health status. To detect A. marginale, all DNA preparations were used for molecular diagnosis using a single polymerase chain reaction with the msp4 gene target. A phylogenetic tree was constructed from the msp4 gene sequences using molecular genetic characterization. Genetic diversity was calculated as haplotype diversity, haplotype number, number of nucleotide differences, nucleotide diversity, and average number of nucleotide differences. Results: The overall prevalence of A. marginale was 12.72% (49/385). The highest prevalence (17.19%) was found in Ubolratana district, followed by Muang, Kranuan, Khao Suan Kwang, and Nam Phong districts (14.94%, 14.74%, 13.79%, and 3.70%, respectively). Phylogenetic analysis showed that A. marginale was closely related to isolates from Australia (98.96%), China (99.68%), Spain (99.74%), and the USA (99.63%). Conclusion: The molecular prevalence of BA in dairy cattle is the first to be observed in this area, and the genetic variability with separated clusters shown in the msp4 gene of A. marginale revealed species variation in dairy cattle. This significant genetic diversity contributes to the understanding of the diversity of A. marginale and will be important for the control and prevention of A. marginale in dairy cattle. Keywords: Anaplasma marginale, bovine anaplasmosis, dairy cattle, molecular prevalence.

Genetic diversity and population structure analysis of blunt snout bream (Megalobrama amblycephala) in the Yangtze River Basin: Implications for conservation and utilization

The blunt snout bream, Megalobrama amblycephala, is a commercially significant freshwater fish species indigenous to China. In recent decades, fishery resources of blunt snout bream in the Yangtze River have been severely depleted owing to human activities, and limited information is available regarding their genetic characteristics. This study aimed to assess the genetic diversity and population structure of different native populations of blunt snout bream in the Yangtze River. We analyzed 222 samples from six natural populations in the middle reaches of the Yangtze River and its affiliated lakes were analyzed using ten microsatellite DNA markers and concatenated sequences of two mitochondrial DNA markers (Cytb and ND2). Microsatellite analysis showed that the average observed heterozygosity (Ho), expected heterozygosity (He), and polymorphic information content (PIC) for all populations were determined as 0.687, 0.739, and 0.748 respectively. Mitochondrial sequence analysis showed that the number of haplotypes (h), haplotype diversity (Hd) and nucleotide diversity (π) of the six populations were 29, 0.768, and 0.00641, respectively. The above findings reveal high genetic diversity within blunt snout bream populations, suggesting a robust potential for selective breeding. The phylogenetic relationship results showed that the six blunt snout bream populations clustered into two branches, indicating a measurable degree of differentiation among the populations in the middle reaches of the Yangtze River Basin and its affiliated lakes. The populations may represent distinct spawning grounds, and corresponding conservation units should be implemented to protect them. In summary, these findings provide vital genetic information for the conservation and commercialization of blunt snout bream in the Yangtze River Basin of China.

Phylogenetic analysis and haplotype networking of Hepatozoon felis infecting wild animals in Gir National Park, Gujarat, India.

The present study was aimed to determine the phylogenetic relationship, haplotype network, and demographic dynamics of H. felis infecting the endangered Asiatic lions in Gir National Park, Gujarat, India, on the basis of partial 18S rRNA gene. The phylogenetic analysis based on the partial 18S rRNA gene sequences of H. felis exhibited the presence of two distinct genotypes of H. felis (HfG1 and HfG2) infecting the Indian wild felids, viz., the Asiatic lion, Royal Bengal tiger, and Indian leopard. The HfG1 and HfG2 genotypes exhibited 97.6-100% and 99.7-100%, and 96.9-98.7% nucleotide identity within and between themselves, respectively. The HfG1 genotype exhibited a higher genetic diversity as compared to HfG2. A total of 22 molecular signatures were identified in the 18S rRNA gene between these genotypes. Further, analysis of a total 67 sequences of H. felis (13 different host species from 13 countries of Africa, South America, Asia, and Europe) that were downloaded from GenBankTM, generated 30 haplotypes. Among all the haplotypes, Hap_17 (h=12) was the most frequent followed by Hap_12 (h=09) and Hap_4 (h=05). Out of 13 location-wise populations, India (h=12) shared the highest number of haplotypes followed by Japan (h=08), and the least number of haplotypes were found in Hungary (h=02). Population dynamics study involving neutrality tests and mismatch distribution, and genetic differentiation indices, revealed the presence of phylogeographic population structure and a constant population size indicating a uniform gene flow among the populations worldwide. In conclusion, a high genetic diversity along with the presence of two distinct genotypes of H. felis were observed on the basis of 18S rRNA gene sequence analysis.

An intermediate-sized donor registry experience: HLA barriers in matching procedures.

The data enabling the estimation of the possibility of finding a matched unrelated donor (MUD) within a relatively short time is important for the success of hematopoietic stem cell transplantation (HSCT). In the present study, 738 unrelated Croatian patients in the program of unrelated HSCT were retrospectively analyzed for gender matching, donor origin (national or international), the distribution of HLA alleles and haplotypes, as well as for the probability of finding a 9-10/10 MUD. Almost 70% of the patients in our study group had a 10/10 MUD, while among the patients with a 9/10 MUD, a 1st field resolution level mismatched donor was selected for 55.0% of patients. The majority of pairs were HLA-A mismatched (33.8%). A comparison of HLA allele frequencies between two subgroups of patients revealed significant differences for 13 alleles. However, after p value correction, the difference in frequency remained significant only for four alleles; three HLA alleles (B*08:01, C*07:01, and DRB1*03:01) demonstrated a significantly higher frequency among patients with a 10/10 MUD (Pcorr < 0.0001, Pcorr = 0.0096, and Pcorr < 0.0001, respectively), while the B*35:08 allele was significantly more present among patients with a 9/10 MUD (Pcorr = 0.0328). The comparison of the distribution of HLA haplotypes between patients with a 10/10 MUD and patients with a 9/10 MUD showed significant differences for a number of two-locus and three-locus haplotypes, as well as for one five-locus haplotype (HLA-A*01:01~B*08:01~C*07:01~DRB1*03:01~DQB1*02:01), which was significantly more present in the group of patients with a 10/10 MUD. At least one HLA haplotype from the group of non-frequent HLA haplotypes (positions >1000) was carried by patients with a 9/10 MUD. The data obtained by the present study will contribute to a better estimation of the probability of finding a suitable 9-10/10 MUD for Croatian patients in need of HSCT.

Genetic diversity of a recovering European roller (Coracias garrulus) population from Serbia.

The European Roller (Coracias garrulus), a long-distance migratory bird, faced a considerable decline in breeding pairs throughout Europe at the end of the 20th century. Due to conservation efforts and the installation of nesting boxes, the population of the European Roller in Serbia has made a remarkable recovery. Here, we used the variability of nucleotide sequences of the mitochondrial DNA (mtDNA) control region and 10 microsatellite loci to assess the genetic diversity and structuring, phylogeographic patterns and demographic history of this species using 224 individuals from Serbia. Our results showed moderate level of genetic diversity (HO = 0.392) and a slightly elevated level of inbreeding and homozygosity (FIS = 0.393). Genetic structuring based on microsatellite data indicated three genetic clusters, but without a clear spatial pattern. High haplotype diversity (Hd = 0.987) of the mtDNA control region sequences was detected, and neutrality tests indicated a recent demographic expansion. The phylogeographic analysis, which also included previously published sequences of the mtDNA control region, supported the subdivision into two distinct European and Asian haplogroups (ΦST = 0.712). However, the results of our study showed that a larger number of haplotypes sampled in Serbia are clustered in the Asian haplogroup as compared to previous studies, indicating a historically continuous distribution of this species and possibly a wider distribution of the subspecies Coracias garrulus semenovwi. Our results suggest that the European Roller population in Serbia is genetically stable, with no evidence of recent bottlenecks, and emphasize the importance of artificial nest boxes for promoting and maintaining population dynamics of European Rollers.

Genotyping of European Toxoplasma gondii strains by a new high-resolution next-generation sequencing-based method

PurposeA new high-resolution next-generation sequencing (NGS)-based method was established to type closely related European type II Toxoplasma gondii strains.MethodsT. gondii field isolates were collected from different parts of Europe and assessed by whole genome sequencing (WGS). In comparison to ME49 (a type II reference strain), highly polymorphic regions (HPRs) were identified, showing a considerable number of single nucleotide polymorphisms (SNPs). After confirmation by Sanger sequencing, 18 HPRs were used to design a primer panel for multiplex PCR to establish a multilocus Ion AmpliSeq typing method. Toxoplasma gondii isolates and T. gondii present in clinical samples were typed with the new method. The sensitivity of the method was tested with serially diluted reference DNA samples.ResultsAmong type II specimens, the method could differentiate the same number of haplotypes as the reference standard, microsatellite (MS) typing. Passages of the same isolates and specimens originating from abortion outbreaks were identified as identical. In addition, seven different genotypes, two atypical and two recombinant specimens were clearly distinguished from each other by the method. Furthermore, almost all SNPs detected by the Ion AmpliSeq method corresponded to those expected based on WGS. By testing serially diluted DNA samples, the method exhibited a similar analytical sensitivity as MS typing.ConclusionThe new method can distinguish different T. gondii genotypes and detect intra-genotype variability among European type II T. gondii strains. Furthermore, with WGS data additional target regions can be added to the method to potentially increase typing resolution.

In-Host HEV Quasispecies Evolution Shows the Limits of Mutagenic Antiviral Treatments.

Here, we report the in-host hepatitis E virus (HEV) quasispecies evolution in a chronically infected patient who was treated with three different regimens of ribavirin (RBV) for nearly 6 years. Sequential plasma samples were collected at different time points and subjected to RNA extraction and deep sequencing using the MiSeq Illumina platforms. Specifically, we RT-PCR amplified a single amplicon from the core region located in the open-reading frame 2 (ORF2). At the nucleotide level (genotype), our analysis showed an increase in the number of rare haplotypes and a drastic reduction in the frequency of the master (most represented) sequence during the period when the virus was found to be insensitive to RBV treatment. Contrarily, at the amino acid level (phenotype), our study revealed conservation of the amino acids, which is represented by a high prevalence of the master sequence. Our findings suggest that using mutagenic antivirals concomitant with high viral loads can lead to the selection and proliferation of a rich set of synonymous haplotypes that express the same phenotype. This can also lead to the selection and proliferation of conservative substitutions that express fitness-enhanced phenotypes. These results have important clinical implications, as they suggest that using mutagenic agents as a monotherapy treatment regimen in the absence of sufficiently effective viral inhibitors can result in diversification and proliferation of a highly diverse quasispecies resistant to further treatment. Therefore, such approaches should be avoided whenever possible.