Halal Meat Research Articles

Role of Department of Islamic Development Malaysia (JAKIM) in Controlling the Importation of Halal Meat in Malaysia

Role of Department of Islamic Development Malaysia (JAKIM) in Controlling the Importation of Halal Meat in Malaysia

Advanced Halal Authentication Methods and Technology for Addressing Non-Compliance Concerns in Halal Meat and Meat Products Supply Chain: A Review

Advanced Halal Authentication Methods and Technology for Addressing Non-Compliance Concerns in Halal Meat and Meat Products Supply Chain: A Review

Urgensi Sertifikasi JULEHA terhadap Tempat Pemotongan Unggas Bebek Beton

The large Muslim population in Indonesia has led to an increasing demand for halal meat. To ensure that the meat is slaughtered in accordance with Islamic law, JULEHA certification is essential. The importance of JULEHA certification lies in its ability to provide consumers with a guarantee that the meat they consume has been processed according to halal standards. This certification in poultry slaughtering aims to ensure that the slaughtering process complies with Islamic law, supports business sustainability, and guarantees that the raw materials used for halal meat processing are met. With the presence of JULEHA certification, the quality of products can be improved, halal integrity maintained, and consumer trust in poultry slaughtering facilities can be enhanced. This research is expected to contribute to the understanding of the importance of JULEHA certification in the culinary industry and among poultry slaughtering entrepreneurs. The method employed in this study is field research, utilizing a qualitative approach aimed at deeply understanding the significance of JULEHA in TPU Bebek Beton. The data sources used in this research include both primary and secondary data. Data collection techniques involved interviews, observations, and documentation. The results of this study indicate that JULEHA at TPU Bebek Beton possesses competency certification and has fulfilled the 13 competencies outlined in the SKNI. JULEHA has participated in training and education programs organized by Universitas Airlangga Surabaya.

The Rights and Rules of Birds in Islamic Jurisprudence

Mercy is considered one of the best and greatest subjects from the perspective of the sacred Islamic religion, and it is regarded as a good and commendable act. According to Islamic principles and foundations, in all circumstances individuals are obliged, even in dealing with animals, to exhibit mercy and not to act with stubbornness and anger against silent and voiceless creatures. Causing harm to animals is deemed a reprehensible and unacceptable act. Unfortunately, birds are also among the animals that are used as food sources in certain regions of the world. Birds have specific conditions and criteria; according to certain narrations, the meat of some species is considered halal (permissible), while the meat of other species is deemed haram (forbidden). In this context, comprehensive and integrated research has not yet been conducted, leading to the question of what rights birds have and which types of these birds have halal meat and which types have haram meat. Answering this question is a matter that requires further investigation; the author of the actual research has sought to reach a convincing answer regarding this issue. This research aims to explore the rights of birds and to delineate the limits of halal and haram concerning birds according to Islamic jurisprudence. Considering the title of the research and the scope of the topic, the primary research method is the descriptive method, where information has been gathered from library sources, along with an attempt to apply relevant concepts.

DETERMINANTS OF HALAL MEAT CONSUMPTION AMONG INDONESIAN GENERATION Z MUSLIMS: USING THE EXTENDED THEORY OF PLANNED BEHAVIOR

This study aims to examine the factors that influence halal meat consumption intention in generation Z Indonesian Muslims, using the Theory of Planned Behavior. This research is a quantitative study using primary data, obtained through distributing questionnaires. The sample used was 1182 people who belonged to generation Z Muslims, namely the age group with the criteria: born after 1996, aged at least 15 years, had consumed certified halal meat and lived in the territory of Indonesia. This study uses Structural Equation Modeling (SEM-PLS), to test the relationship between variables in the model. The results showed that there are 5 variables that directly affect Halal Meat Consumption Intent (IKDH), namely: attitude (Att), Trust (Kep), Moral Obligation (KM), Subjective Norm (SN), and Perceive Behavioral Control (PBC). Meanwhile, there are 6 interactions that affect indirectly.

Securing Halal Integrity Resilience of Halal Meat Ecosystem for Society 5.0 Needs through IR4.0 Technologies

Malaysia maintains its leading position in Islamic finance, halal food, Muslim-friendly tourism, media, recreation, pharmaceuticals, and cosmetics for a decade, showcasing its commitment to the halal industry. The global halal meat market, driven by a significant portion of the population, is projected to reach USD 375.05 billion by 2030, with a 7.1% annual growth rate. Halal is viewed as a new standard for achieving various Sustainable Development Goals (SDGs), including health, economic growth, responsible consumption, and environmental sustainability. To stay competitive, halal supply chains must embrace advanced Industrial Revolution 4.0 (IR4.0) technologies like the Internet of Everything (IoE) for future readiness. IoE enhances connectivity, intelligence, and decision-making, empowering halal stakeholders to navigate present and future challenges and serve Society 5.0 while ensuring the sustainability of their enterprises in alignment with Maqasid al-Syariah.

TRAINING HALAL SLAUGHTERERS IN SAMARINDA ON KNIFE SHARPENING WITH WHETSTONE AND SHARPENING STEEL

Slaughtering animals is a crucial stage in the food production chain, especially for Halal meat products that adhere to animal welfare standards. Proper knife sharpening techniques are essential in minimizing pain and stress for animals during the slaughtering process. This study reports on a training program in knife sharpening techniques using a combination of whetstones and sharpening steel conducted in Samarinda. The training involved Halal slaughterers from various mosques and markets in the Sambutan District of Samarinda. The method aimed to enhance the participants' skills in optimal knife sharpening, forming a blade edge that meets the animal welfare-based meat-cutting industry standards. The training results indicated that 75% of participants successfully applied the sharpening techniques that were taught, producing convex-shaped blade edges that were more efficient in the slaughtering process. This success positively impacted the implementation of animal welfare standards and the quality of the resulting meat. In conclusion, the training effectively improved Halal slaughterers' skills and significantly impacted the implementation of animal welfare standards in Samarinda. Support from the Samarinda City Food Security and Agriculture Office, the Animal Husbandry Department of Mulawarman University, and the Halal Slaughtering Da'wah Organization of Samarinda City played a crucial role in the success of this training.

Diversity and practice: local decision-making practices on multi-cultural diets for British Muslim school children (BMSC) and implications for social justice.

British Muslim School Children (BMSC) are required to follow special halal dietary requirements in accordance with their religion, which is often not accounted for in British schools. This often leaves BMSC limited to a vegetarian diet while at school, despite this not being their chosen diet or preference. This study explores the perceptions of key stakeholders regarding fairness and accessibility of school meals for BMSC, as well as discussing school food provision for those maintaining a religious diet in light of social justice. This is in the context of limited knowledge previously being explored in the North East of England regarding procurement and decision-making at a systems level to cater for BMSC. A qualitative research design was conducted. A total of 62 participants (39 BMSC, 15 parents, and 8 school and catering staff) took part in a semi-structured interview or focus group. Participants were recruited from six schools, with these schools selected based on their differing levels of BMSC in attendance. This project took place between March 2022 and October 2023. Results suggested that where schools already catered for diverse food requirements, inclusive of BMSC dietary needs, food choices were still limited in the options and amount available. School and catering staff stated that cost implications contributed to their menu development process. Despite this, there was an evident willingness to learn about the cultural food options and how these can be implemented in future school menus. Suggestions discussed included an increase in the use of halal meat in order to provide a more inclusive school food experience for BMSC.

Observational Study Of Animal Slaughterhouses (RPH) Muaro Kumpeh Village Muaro Jambi

A slaughterhouse (RPH) is a building or building complex with certain designs and conditions used for slaughtering animals to produce safe, healthy, whole, and halal (ASUH) meat for consumption by the general public. This research aims to find out the process carried out by the RPH in carrying out its duties by Islamic law. In this research, the method used to analyze the Muaro Jambi Mandiri Enterprise RPH was to use literature review and observation methods to describe and explain the condition of the Mandiri Enterprise RPH in Muaro Kumpeh Village. The data used in this research uses primary data obtained directly through observation or interviews and secondary data. The data collection methods in this research are interviews and observations regarding the suitability of animal slaughtering, physical facilities, distribution of slaughtered products, and critical points. at this RPH. The study results show that this abattoir has carried out its business by Islamic law and has MUI halal certification. It was found that the critical point in this abattoir is in the place used for slaughtering animals, where the condition of the place is very at risk of unclean contamination.

Comparison of recovery of sheep, goats, and calves from reversible electrical head-only and head-to-body stunning for halal meat production

ABSTRACT Aims To compare the recovery of lambs, goats, and calves from head-only (HO) or high-frequency head-to-body stunning and evaluate the complementary use of behaviour and electroencephalography (EEG) to assess return to consciousness after electrical stunning in these species. Methods Six-month-old lambs, adult goats and calves (< 7 days old) were subjected to reversible head-only stunning (50 Hz, 1 A, 2 seconds) or reversible high-frequency head-to-body stunning (RHTB: HO followed by 2,000 Hz, 2 A, 4-second stun to body). Following stunning, behavioural recovery was assessed in 21 lambs, 22 goats, and 20 calves. Latencies to first perform behaviours (end of convulsions, head lift, attempt to right, successful righting, attempt to stand, successful standing) after stunning were scored from video recordings. Recovery of electrical brain activity indicative of consciousness was assessed using EEG in a separate cohort of minimally-anaesthetised lambs, goats and calves (n = 20 per species). EEG traces collected before and after stunning were classified as normal, epileptiform, isoelectric, or transitional activity. Following stunning, the duration of epileptiform and isoelectric activity combined (states of brain activity incompatible with conscious awareness) was calculated, as was latency to return of normal (pre-stun) EEG. Results The RHTB stun was reversible in all three species, although one sheep failed to recover and was euthanised. Both methods caused tonic and clonic convulsions in all species. Behavioural recovery of sheep and calves was similar for both methods while goats took longer to recover from RHTB than HO stunning. There was no evidence of differences between methods in the duration of EEG incompatible with consciousness or the latency to recovery of normal EEG. Conclusions Head-to-body stunning as applied here produced a reversible electrical stun in lambs, adult goats and young calves, although the benefits in terms of meat quality and operator safety are uncertain. Goats took longer to recover behaviourally from head-to-body stunning, possibly due to disrupted motor function, but there was no indication that post-stun unconsciousness lasted longer than following head-only stunning in any species. The normal behaviour for the animals’ developmental age should be considered when deciding on behavioural indicators of recovery. The minimal anaesthesia model provided excellent quality EEG data that was valuable for interpretation of the behavioural responses. Clinical relevance For the purposes of pre-slaughter stunning of sheep, goats and young calves, recovery appears comparable between the two methods, with all but 1/63 animals in the behaviour study recovering normal function.

Specific Real-Time PCR Assay Targeting D-loop Gene and Short Amplicon Sequencing for Identification of Monkey Meat in Beef Meatballs

Macaque monkey (Macaca fascicularis) meat (MM) has been reported to be consumed as meatball and soup products in Indonesia. MM is not allowed to be traded in Indonesia and is considered not halal meat; therefore, MM is not allowed to be consumed by Muslim communities. In this study, species-specific primer (SSP) targeting on mitochondrial displacement (D-loop) region coupled with real-time PCR assay was used to identify monkey meat in beef meatballs. The PCR product was also subjected to sequencing in order to ensure the adulteration practice of MM in beef meatballs. The primers were designed and subjected to in silico specificity test using BLAST. The used primers were: forward: 5’-TGACTCCCACCACATCCC-3’ and reverse: 5’-GTGTGGAGCTAGAATATTGAACCG-3’. Real-time PCR assay using SSP targeting on mt-D-loop primers was capable of identifying MM in meatball products, specifically with a detection limit of 0.0078 ng corresponding to 1% MM in beef meatballs. The developed method can be proposed as the standard method for detecting MM in food products intended for halal authentication analysis, provided that DNAs are available in food products.

Consumers' Confidence Level Towards Imported Halal Meat Post-Meat Cartel Issues

Consumers' Confidence Level Towards Imported Halal Meat Post-Meat Cartel Issues

Pengembangan Strategi Pemasaran Syariah Daging dan Ikan Halal melalui Digital Marketing :Studi Kasus Pada PT Daya Desa Asasta

The research is aimed at developing marketing strategies for halal meat and fish through digital marketing at PT Daya Desa Asasta. Digital marketing, or digital marketing, is a set of strategies to market goods or services through digital or online media, such as the Internet, social media, search engines, email, mobile applications, and other online platforms. This research assesses what has been implemented and which digital marketing strategies have had the most or the least impact. Through this research, more objective evaluations can be obtained, which can serve as the basis for making recommendations for improvements or decision-making related to marketing through digital marketing.This type of research is qualitative, using the research evaluation method and the goal-free evaluation model by Michael Scriven. Data collection is carried out with interviews with 2 subjects involved in the company's Power Village Asasta, observation, and document study. Data analysis with Miles &amp; Huberman thematic analysis techniques (1994). Further, the monitoring of research credibility was carried out through steps of triangulation of data from Patton (1990). The results of the research were evaluation results, namely (a) 3 digital marketing strategies used: Tokopedia, Instagram, and Whatsapp (b) 1 digital marketing strategy and 1 recommended product processing.Keywords: Digital Marketing, Sharia Marketing, Meat ,and Fish

Millennial generation awareness of halal supply chain knowledge toward purchase intention for halal meat products: empirical evidence in Indonesia

PurposeThis paper aims to investigate the impact of halal awareness on the relationship between halal supply chain knowledge and purchase intention for halal meat products in the millennial generation.Design/methodology/approachThe quantitative approach with the respondents of 177 millennial generations in Indonesia is selected to understand the relationships between variables. Structural equation model-partial least square is used to analyze the relationship between variables.FindingsThe findings of this study found that the purchase intention of halal products in the millennial generation is influenced by several factors such as halal supply chain knowledge, halal certification and logo and religious beliefs. However, the results of this study also show that concern for halal products failed to moderate the relationship between these three main variables on the purchase intention of halal products.Originality/valueThis study provides insights into the concern that strengthens the relationship between the main variables on the intention to purchase halal meat products for the millennial generation.

Illegal rural enterprise – developing a framework to help identify and investigate shadow infrastructures and illicit criminal networks

Purpose This study builds on the extant research of the authors on illegal rural enterprise (IRE). However, instead of taking a single or micro case approach within specific sections of the farming and food industries we examine the concept holistically from a macro case perspective. Many IRE crimes simply could not be committed without insider knowledge and complicity, making it essential to appreciate this when researching or investigating such crimes.Design/methodology/approach Using data from published studies, we introduce the theoretical concept of “Shadow infrastructure” to analyse and explain the prevalence and endurance of such criminal enterprises. Using a multiple case approach, we examine data across the cases to provide an analysis of several industry wide crimes—the illicit halal meat trade; the theft of sheep; the theft of tractors and plant; and the supply of illicit veterinary medicines.Findings We examine IRE crimes across various sectors to identify commonalities in practice and in relation to business models drawing from a multidisciplinary literature spanning business and criminology. Such enterprises can be are inter-linked. We also provide suggestions on investigating such structures.Practical implications We identify academic and practical implications in relation to the investigation of IRE crime and from an academic perspective in relation to researching the phenomenon.Originality/value This study combines data from numerous individual studies from a macro perspective to provide practical solutions to a multifaceted problem.

Certification of Halal Meat: Exploring the Management &amp; Production Environment in Malaysia and Australia

Certification of Halal Meat: Exploring the Management &amp; Production Environment in Malaysia and Australia

Development of real-time polymerase chain reaction for analysis of rat meat (Bandicota bengalensis) in beef meatballs for halal authentication

Background: Consumer awareness of food adulteration is increasing nowadays. Motivated by economic gain, unethical meat producers try to blend halal meat such as beef with non-halal meat like Rat Meat (RM). Aim: This study aims to develop a Real-Time Polymerase Chain Reaction (RT-PCR) analysis method to analyze the presence of RM in beef meatballs. Methods: This research was carried out in the following stages: primer design, DNA isolation, analysis of DNA isolates, the optimization of primer annealing temperature, primer specificity test, sensitivity, and repeatability. The validated RT-PCR method was then used to analyze the marketed meatball samples. Results: The result showed that the designed primer targeting on ND2 gene set rat mt-DNA (forward: ACTCCATATCTCTCACCATATTTCC; reverse: GGGTTAGGGTACTTAGGATTGTTAG), had good specificity at an optimal annealing temperature of 56.3oC over the other 8 species. The developed RT-PCR method produces a limit detection value of 195.31 pg, coefficient of determination (R2) for linearity of 0.983, amplification efficiency (E) of 100%, and CV value for amplification response of 1.8%. The result showed that the developed RT-PCR method did not detect the presence of RM DNA in 8 marketed beef meatball samples. Conclusion: The developed method meets the acceptance criteria for RT-PCR and can be used as a halal authentication method to identify the presence of RM in beef meatballs.

MEAT CARTELS AND THEIR MANIPULATION OF HALAL CERTIFICATION IN MALAYSIA

A cartel is an agreement between several individuals or companies and others to engage in a scheme for the purpose of maintaining the business status quo by inter alia regulating and controlling prices and marketing territories. This is usually done with the aim of curbing competition and maximising profit, especially in the food supply chain. Qualitative research methods were used to investigate meat cartels falsifying halal certifications. Legal provisions, case law, journals, and articles were examined as sources of information and analysed to gather information related to the research topic. Presently, the perpetrators can be charged under Trade Descriptions Act 2011 and the Trade Descriptions (Certification and Halal Marking) Order 2011. There are more than 20 Acts that relate to halal standards which could be enforced under the law to ensure heavier punishments are meted out on the ‘food criminal’. The article also looks at the extent of the issue of corporate liability of companies that can be imposed on individuals involved with halal criminal offenses based on legislations other than the Trade Descriptions Act 2011 and the Trade Descriptions Order (Halal Certification and Marking) 2011. Hence the objectives of this article are to analyse the issue of meat cartels in Malaysia and to study the laws related to halal matters in terms of corporate liability within the provisions of the law. It is suggested that there is a need for a legal improvement relating to company liability in criminal cases relating to halal meat in Malaysia.

Exploring Untargeted metabolomics for halal authentication of Triceps brachii, Longissimus Dorsi, and Biceps femoris of meat muscles

ABSTRACT The demand for authentic meat has increased due to the growing consumption of halal meat. In this study, a combined metabolomics and chemometrics approach was employed to authenticate beef and pork samples from specific muscle groups. By using an untargeted metabolomics analysis, distinct metabolite profiles were observed in TB, LD, and BF muscles, differentiating pork from beef. Subsequently, Principal Component Analysis (PCA) results confirmed the distinguishable metabolite profiles between beef and pork. Cluster analysis further revealed that the metabolites in each muscle of beef and pork have different characteristics. Additionally, Partial Least Squares-Discriminant Analysis identified 15 potential metabolites could be used to authenticate the halal status of meat. Creatine, L-carnitine, carnosine, nicotinamide, L-phenylalanine, DL-lactic acid, acetyl L-carnitine, hypoxanthine, inosine, DL-malic acid, N-methyl-2-pyrrolidone, L-glutathione, Inosine-5-monophosphate (IMP), L-tyrosine, and palmitoylcarnitine is a potential metabolite to differentiate beef and pork. This study offers valuable insights into determining the halal status of meat based on metabolite profiles.

DIFFICULTIES IN IMPLEMENTING THE HALAL TRACEABILITY SYSTEM AMONG IMPORTED HALAL MEAT SUPPLIERS

Nowadays, a lot of halal related issues arouse a bad image to religion and many parties includes halal industry players and consumers, directly or indirectly. The meat cartel scandals issuehas shocked Malaysia in the previous year. In conjunction to the issue, many Muslim consumers had lost their confidence towards the consumption of halal meat imports. The unfolding scandal over fake halal documentation, fake halal logos, and fake halal meat has really affected the halal meat import industry since consumer confidence is decreasing and honest businesses are working hard to convince customers of their compliance with halal requirements. Transparency in the implementation of a halal traceability system on the meat import supply chain helped prevents any violations or fraudulent cases. The aims of this studyis to discover the challenges of implementing a halal traceability system among halal meat import suppliers. This research adopts a qualitative method and the data was collected through a semi-structured interview. The thematic analyses was conducted on transcribed and coded data interview. The results of the study showed that time consumption, cost implementation, and lack of digital expertise have become challenges for halal meat import suppliers in implementing a halal traceability system.