Hairy Nightshade Research Articles

Hydropriming Applied on Fast Germinating Solanum villosum Miller Seeds: Impact on Pre-germinative Metabolism.

Seed priming can circumvent poor germination rate and uniformity, frequently reported in eggplant (Solanum melongena L.) and its crop wild relatives (CWRs). However, there is still a gap of knowledge on how these treatments impact the pre-germinative metabolism in a genotype- and/or species-dependent manner. The CWR Solanum villosum Miller (hairy nightshade) investigated in this study showed a quite unique profile of fast germination. Although this accelerated germination profile would not apparently require further improvement, we wanted to test whether priming would still be able to impact the pre-germinative metabolism, eventually disclosing the predominant contribution of specific antioxidant components. Hydropriming followed by dry-back resulted in synchronized germination, as revealed by the lowest MGR (Mean Germination Rate) and U (Uncertainty) values, compared to unprimed seeds. No significant changes in ROS (reactive oxygen species) were observed throughout the treatment. Increased tocopherols levels were detected at 2 h of hydropriming whereas, overall, a low lipid peroxidation was evidenced by the malondialdehyde (MDA) assay. Hydropriming resulted in enhanced accumulation of the naturally occurring antioxidant phenolic compounds chlorogenic acid and iso-orientin, found in the dry seeds and ex novo accumulation of rutin. The dynamic changes of the pre-germinative metabolism induced by hydropriming are discussed in view of future applications that might boost the use of eggplant CWRs for breeding, upon upgrade mediated by seed technology.

Aspects of the epidemiology and control of powdery mildew (Oidium neolycopersici) on tomato in Ontario, Canada

The epidemiology and control of powdery mildew (Oidium neolycopersici) of tomato (Solanum lycopersicum L.) was studied in greenhouse, growth chamber, and field experiments at Harrow, Ontario. Greenhouse environmental conditions were more favourable for disease development, with higher disease progress rates than in the field. Symptoms were more severe on older, lower leaves where the air temperature was slightly lower and relative humidity higher than on young leaves at the top of the canopy. A temperature of 22°C with 16 or 24 h of leaf wetness was optimal for disease development in a growth chamber experiment. Early inoculation resulted in significantly greater final disease severity and area under the disease progress curve than later inoculations. Disease progress in greenhouse and growth chamber trials was best described by the Gompertz model, while the logistic model was best for disease progress in field studies and for sections of plants in greenhouse studies. No yield loss occurred in field studies. The best disease control was obtained with acibenzolar-S-methyl (Actigard®), trifloxystrobin (Flint®), JMS-Stylet Oil®, azoxystrobin (Quadris®) and sulphur applied as protectants. Some phytotoxicity occurred with Actigard in greenhouse studies. Serenade® (Bacillus subtilis) was less effective while Kaligreen, Sporodex® (Pseudozyma flocculosa), copper octanoate and fumed silica were ineffective. Quinoxyfen was phytotoxic at the rate applied. Several tobacco cultivars, jimsonweed, American and black nightshade were susceptible to infection by O. neolycopersici. Eggplant, hairy nightshade and bittersweet were less susceptible, while no visible symptoms developed on pepper, potato and tomato ‘Grace’, and only trace levels of sporulation occurred on cucumber.

Hairy Nightshade Critical Interference Period in Potatoes

Field research trials were conducted in Idaho at the Aberdeen Research and Extension Center in 2006 and 2007 to determine the critical interference period of hairy nightshade in potatoes. ‘Russet Norkotah’ variety was planted both years in plots three rows wide by 12 m long. When the potatoes had emerged, one- to two-leaf hairy nightshade plants that had been germinated and grown in the greenhouse were transplanted at a 2 m−1row density and allowed to grow for 10, 20, 30, or 40 d after emergence (DAE) before removal, or the potatoes were maintained weed-free for 0, 10, 20, 30, or 40 DAE before transplanting. Potatoes were harvested from the center row at the end of each growing season and yield and grade was determined. Russet Norkotah is a small-canopied potato variety and often does not completely close canopy in Idaho. Russet Norkotah U.S. No. 1 and total tuber yield were similar to weed-free yield when hairy nightshade transplanting was delayed up to 22 or 24 DAE, respectively, or planted at emergence and allowed to remain for only 6 or 11 d, respectively. Otherwise, yield decrease was 5% or greater. Therefore, the critical weed-free period for Russet Norkotah potato U.S. No. 1 or total tuber yields was 6 to 22 or 11 to 24 DAE, respectively.

Investigating the Host Range of the US-22, US-23, and US-24 Clonal Lineages of Phytophthora infestans on Solanaceous Cultivated Plants and Weeds.

Phytophthora infestans causes late blight, one of the most important diseases of potato and tomato worldwide. Recently in the United States, three newly identified clonal lineages, US-22, US-23, and US-24, have become widespread. While potato and tomato are the most commonly infected solanaceous hosts for P. infestans, new lineages may have a broader or different host range. Under controlled conditions, we determined the host range of isolates representing US-22, US-23, and US-24 genotypes of P. infestans on detached tissues of cultivated solanaceous plants and solanaceous weeds common to the upper midwestern production region. None of the isolates representing the clonal lineages produced late blight symptoms or signs on foliage of selected cultivars of eggplant, pepper, tomatillo, or ground cherry in a detached leaf assay. Symptoms and signs were evident on the potato and tomato cultivars tested, although with the US-24 isolate, infection on tomato was limited. None of the isolates sporulated on the common weed black nightshade, but some sporulation and necrosis was observed with all representatives of the lineages on bittersweet nightshade and petunia. Hairy nightshade supported abundant sporulation and symptoms, and sporangial production was not significantly different than that on tomato for each of the isolates representing the three lineages, indicating the potential for this weed to be a source of inoculum and contribute substantially to late blight epidemics. Interestingly, black nightshade had the highest incidence of sporulation on berries, but the lowest on leaves, suggesting the importance of testing multiple plant organs when determining susceptibility of a species. Our results update knowledge of the host range of the ever-changing P. infestans populations and will help to improve late blight management strategies by targeting these additional hosts.

Influence of black nightshade (Solanum nigrum) and hairy nightshade (Solanum physalifolium) phenology on processed pea contamination

Fruit of black (Solanum nigrum) nightshade and hairy nightshade (S. physalifolium var. nitidibaccatum) contaminate processed peas. The phenology of flower bud appearance (FBA) and flowering in both species was quantified using thermal time (base temperature (Tb), 6 °C) across five sowing dates, to inform management strategies. There was no photoperiod requirement for flowering in either species, hairy nightshade developed earlier (FBA, 352 °Cd; flowering, 509 °Cd) than black nightshade (FBA, 434 °Cd; flowering, 633 °Cd) but had a slower fruit growth rate than black nightshade. Hairy nightshade fruits reached the pea contamination threshold (3 mm diameter) prior to those of black nightshade. A comparison of processed pea cultivar maturity and sowing date showed that cultivars with a short thermal time to maturity (< 730 °Cd, Tb 4.5°C) would have a reduced risk of contamination by black nightshade but not by hairy nightshade.

Cured Dairy Compost Influence on Weed Competition and on ‘Snowden' Potato Yield

Potatoes are an important global food crop typically produced in high-input systems in temperate zones. Growers that have access to compost may use it to improve soil health and increase tuber yields, but compost may also increase weed competition by increasing early-season water availability and weed growth. A field study at the Michigan State University Montcalm Research farm in 2010 and 2011 investigated the impact of compost on weed competition in potato. Potatoes were grown in field plots with 0, 4,000, or 8,000 kg carbon (C) ha−1of compost under weed-free conditions, and in competition with common lambsquarters, giant foxtail, and hairy nightshade. Compost did not increase biomass or seed production of any weed species. Giant foxtail and hairy nightshade at 5.3 plants per meter of row reduced potato yield by 20%; common lambsquarters reduced yield by 45%. The yield reduction by giant foxtail and hairy nightshade was due to a decrease in tuber bulking, whereas yield reductions from common lambsquarters were a result of lower tuber set and bulking. Potato yield increased 5 to 15% in compost compared to non-compost treatments; tuber specific gravity decreased by 0.3% in composted treatments. Across weed densities, elevated soil potassium levels in the 8,000 kg C ha−1composted treatment may have increased potato yield and decreased tuber specific gravity.

Interaction between Preemergence Ethofumesate and Postemergence Glyphosate

Greenhouse and field experiments were conducted to determine whether PRE-applied ethofumesate increased POST spray retention and weed control with glyphosate. In greenhouse studies, ethofumesate was applied PRE at rates from 0 to 224 g ai ha−1followed by POST treatment with either water or glyphosate (840 g ae ha−1) to which a red dye had been added. Plants were immediately washed and spray retention determined spectrophotometrically. Common lambsquarters retained more glyphosate solution compared to water, regardless of PRE ethofumesate rate. Increasing the rate of PRE ethofumesate increased the POST spray retention of both water and glyphosate. PRE application of ethofumesate increased POST spray retention of water by 114% and glyphosate solution by 18% compared to no ethofumesate treatment as determined by nonlinear regression. Ethofumesate rates of 90 g ha−1increased POST spray retention to at least 95% of the total observed response. In field studies, common lambsquarters, redroot pigweed, and hairy nightshade densities were all reduced by ethofumesate, although the duration of ethofumesate effect varied by species and ethofumesate application timing. PRE ethofumesate had no significant effect on hairy nightshade density until after POST glyphosate was applied, whereas common lambsquarters densities were most affected by PRE ethofumesate early in the season. Late-season redroot pigweed density was reduced by ethofumesate regardless of application timing.

The effect of an alternate weed host, hairy nightshade, Solanum sarrachoides (Sendtner) on green peach aphid distribution and Potato leafroll virus incidence in potato fields of the Pacific Northwest

Hairy nightshade, Solanum sarrachoides (Sendtner) is an annual solanaceous weed prevalent in potato farmlands of the Pacific Northwest. S. sarrachoides is also a reservoir for Potato leafroll virus (PLRV) and its most important vector, the green peach aphid, Myzus persicae (Sulzer). Green peach aphids prefer S. sarrachoides than potato, Solanum tuberosum (L.), and produce more nymphs on S. sarrachoides than on potato. Increased green peach aphid preference for S. sarrachoides and greater fecundity on this plant could lead to overcrowding and movement toward neighboring potato plants. To test our hypothesis, field trials were conducted at Kimberly, Idaho during the summers of 2003 and 2004. A row of S. sarrachoides seedlings was planted in the middle of potato plots and naturally occurring green peach aphid populations were monitored weekly on potato plots with and without S. sarrachoides. More aphids were consistently found on S sarrachoides plants than on potato plants. More aphids were found on potato plants in plots with S. sarrachoides plants than without S. sarrachoides. Targeted insecticide applications on S. sarrachoides rows alone reduced the number of aphids on potato plants in those plots, suggesting that insecticide sprays prevented aphid movement from S. sarrachoides to potato. Testing of potato tuber sprouts 90 days after harvest by double antibody sandwich ELISA indicated a greater PLRV infection rate on plots with S. sarrachoides than plots without S. sarrachoides. Therefore, the presence of S. sarrachoides in potato plots will likely increase aphid populations and PLRV incidence on neighboring potato plants.

Preemergence Herbicides for Potential Use in Potato Production

Field trials were conducted in 2009 and 2010 near Paterson, WA and Ontario, OR to evaluate weed control and potato tolerance to PRE-applied pyroxasulfone, saflufenacil, and KSU12800 herbicides. Pyroxasulfone at 0.09 to 0.15 kg ai ha−1and saflufenacil at 0.05 to 0.07 kg ai ha−1applied PRE alone or in tank mixes with several currently labeled herbicides did not injure potatoes at either site in both years. KSU12800 at 0.15 kg ai ha−1injured potatoes from 18 to 26% for a period of about 4 wk after emergence at Ontario both years. In addition, KSU12800 at 0.29 and 0.45 kg ha−1injured potatoes from 17 to 38% at 17 d after treatment (DAT) at Paterson in 2009. Pyroxasulfone at 0.15 kg ha−1controlled barnyardgrass, hairy nightshade, and redroot pigweed 96% or greater, but control of common lambsquarters was variable. Saflufenacil at 0.07 kg ha−1provided greater than 93% control of common lambsquarters, hairy nightshade, and redroot pigweed at both sites in 2010. KSU12800 at 0.15 kg ha−1controlled common lambsquarters, hairy nightshade, and redroot pigweed 99% or more at Ontario, but only 87 to 93% at Paterson in 2010. These herbicides did not reduce yield of U.S. no. 1 tubers or total tuber yields compared to standard labeled herbicide treatments when weed control was adequate.

Selectivity of fomesafen based systems for preemergence weed control in cucurbit crops

Experiments at two sites during two years evaluated the selectivity of preemergence fomesafen in cucurbit crops of winter and summer squash, zucchini, cantaloupe, cucumber, and pumpkin. Cucumbers were the most sensitive of the cucurbit crops to fomesafen and produced little or no fruit in two out of three experiments when applied at 0.28 kg ai ha−1. Fomesafen also reduced cantaloupe yield. Visual damage was noted on the other crops tested, but crop yield was not impacted by fomesafen at 0.28–0.35 kg ai ha−1. With the exception of cucumbers, injury caused by fomesafen to cucurbit crops was transitory even when fomesafen-treated soil splashed onto the leaves of emerging cucurbits during a powerful thunderstorm at one of the test sites. Control of redroot pigweed (Amaranthus retroflexus), Powell amaranth (Amaranthus powellii) and other Amaranthus spp., lambsquarters (Chenopodium album), hairy nightshade (Solanum physafolium), common purslane (Portulaca oleraceae), and velvetleaf (Abutilon theophrastii) ranged from 92 to 100% with fomesafen applied at 0.28 kg ai ha−1. The excellent efficacy on these difficult to control weed species suggests that lower rates of fomesafen may be appropriate and improve crop tolerance, particularly if fomesafen is tankmix-applied with other preemergence herbicides such as s-metolachlor or dimethenamid-p. Weed control with these combinations was excellent for all weed species in these experiments.

Common Lambsquarters and Hairy Nightshade Control in Potato with Dimethenamid-p Alone and in Tank Mixtures and Comparison of Control by Dimethenamid-p with S-metolachlor and Metolachlor

Dimethenamid-p was labeled for preemergence use in potatoes in 2005. The herbicide provides hairy nightshade control; however, a tank-mix partner targeting common lambsquarters must be used in order to provide satisfactory control of that weed. S-metolachlor and metolachlor, also labeled for use in potato, are in the same chemical family as dimethenamid-p and questions have arisen as to whether or not these herbicides provide the same or different levels of hairy nightshade control. The objectives of this study, therefore, were (1) to compare preemergence control of common lambsquarters and other weeds in potato with dimethenamid-p applied at 0.72, 0.94, or 1.12 kg ai ha−1alone or in two-way tank mixtures to determine appropriate tank-mix partners, and (2) to compare hairy nightshade control by dimethenamid-p with control by S-metolachlor or metolachlor. Two-way tank mixtures of dimethenamid-p with ethalfluralin, EPTC, flumioxazin, metribuzin, pendimethalin, or sulfentrazone generally improved season-long common lambsquarters control compared with dimethenamid-p applied alone at 0.72, 0.94, or 1.12 kg ha−1. When compared with control by dimethenamid-p alone at 0.72 or 0.94 kg ha−1, control by dimethenamid-p at either rate tank-mixed with ethalfluralin or EPTC was not improved as much as control by combinations of dimethenamid-p at those rates with the other tank-mix partners. Hairy nightshade control by three-way tank mixtures of S-metolachlor or metolachlor with various combinations of metribuzin, ethalfluralin, EPTC, or pendimethalin ranged from 60 to 86% and was not as great as the 93 to 98% control by dimethenamid-p at 0.72 kg ha−1combined with the same tank-mix partners. U.S. No. 1 and total tuber yields of comparative two- and three-way tank mixtures were generally increased when weed control was improved.

Can Weed Hosts Increase Aggressiveness of Phytophthora infestans on Potato?

Potato late blight, caused by Phytophthora infestans, is a major disease in potato production throughout the world. In southern Sweden, hairy nightshade (Solanum physalifolium), an alternative non-crop host to the pathogen, is an increasing weed problem. Single-lesion leaves infected by P. infestans were collected from potato and hairy nightshade to determine phenotypic and genotypic population differentiation of P. infestans between the two hosts. Genotypic variation was estimated using microsatellites as markers. The results showed no genotypic differentiation in the samples between the two hosts. Aggressiveness tests were performed using the sampled isolates to cross-inoculate potato and hairy nightshade. The proportion of infected leaves, latency period, lesion growth rate, and sporulation capacity were measured. For isolates from hairy nightshade, the odds of infection were higher on both hosts combined. When tested on potato leaves, isolates from hairy nightshade showed a significantly shorter latency period and higher sporulation capacity compared with isolates from potato. This indicates that an alternative host can filter populations of P. infestans toward a higher aggressiveness, which could lead to increasing problems in controlling potato late blight.

Factors influencing plant regeneration from seedling explants of Hairy nightshade (Solanum sarrachoides)

Hairy nightshade (Solanum sarrachoides) has the potential to be a model system for the study of plant-pathogen interactions, however, the availability of tissue culture and transformation methods would strengthen its utility. For the development of tissue culture methods, we investigated, explant type (cotyledons, hypocotyls, roots), hypocotyl explant origin, cotyledon orientation (abaxial vs. adaxial) in direct contact with the medium, gelling agents (agar and agargel) and cytokinins (zeatin and 6-benzyladenine) at different concentrations. Cotyledon explants resulted in the greatest biomass as compared to root and hypocotyl. As for hypocotyl explant origin, explants proximal to the cotyledons had a significant effect on plant regeneration. However, cotyledon orientation and gelling agent had no effect on plant regeneration. Medium supplemented with either zeatin or 6-benzyladenine at 1 mg L−1 resulted in significant shoot regeneration. Shoots rooted readily when cultured on a non-hormone based rooting medium.

Within plant distribution of Potato Virus Y in hairy nightshade ( Solanum sarrachoides): An inoculum source affecting PVY aphid transmission

Potato virus Y (PVY) is vectored by several potato-colonizing and non-colonizing aphid species in a non-persistent manner and has a wide host range. It occurs naturally in several plant families. Myzus persicae and Macrosiphum euphorbiae are the most efficient potato-colonizing aphid vectors of PVY. Rhopalosiphum padi, a cereal aphid that migrates in large numbers through potato fields during the middle of the growing season, does not colonize potato plants but can transmit PVY. Hairy nightshade, Solanum sarrachoides, a prevalent annual solanaceous weed in the Pacific Northwest (PNW) of the United States, is an alternative host for PVY and a preferred host for M. persicae and M. euphorbiae. Hence, hairy nightshade plants might play an important role as an inoculum source in the epidemiology of PVY. We looked at titre accumulation and distribution of PVY O, PVY N:O and PVY NTN in S. sarrachoides and potato after aphid inoculation with M. persicae and studied the transmission of PVY O and PVY NTN, by M. persicae, M. euphorbiae and R. padi from hairy nightshade to potato plants. Virus titre at different positions on the plant was similar in S. sarrachoides and potato plants with strains PVY O and PVY N:O. Titres of PVY NTN were similar in S. sarrachoides and potato but differences in titre were observed at different positions within the plant depending on the plant phenology. Percentage transmission of PVY NTN by M. persicae and M. euphorbiae was twice as high (46 and 34%, respectively) from hairy nightshade to potato than from potato to potato (20 and 14%). Percentage transmission of PVY O by M. persicae and M. euphorbiae was not affected by the inoculum source. No effect of the inoculum source was observed in the transmission of either PVY strain by R. padi. These results show that hairy nightshade may be an equal or better virus reservoir than potato and thus, important in the epidemiology of PVY.

Specialized Host Utilization of &lt;I&gt;Macrosiphum euphorbiae&lt;/I&gt; on a Nonnative Weed Host, &lt;I&gt;Solanum sarrachoides&lt;/I&gt;, and Competition With &lt;I&gt;Myzus persicae&lt;/I&gt;

The potato aphid, Macrosiphum euphorbiae (Thomas), (Homoptera: Aphididae), is a polyphagous aphid known to feed on over 200 plant species across 20 families. Although this aphid is known as one of the potato (Solanum tuberosum L.) colonizing aphids, field observations for populations of M. euphorbiae in southern Idaho indicated that they preferentially settled and colonized hairy nightshade, Solanum sarrachoides (Sendtner), plants rather than potato plants. Laboratory investigations revealed that M. euphorbiae survived only on S. sarrachoides and not on potato. A series of subsequent laboratory experiments conducted using laboratory-reared and field-collected aphids confirmed that M. euphorbiae survived only on S. sarrachoides. Experiments also showed that M. euphorbiae produced more winged morphs (alatae) than Myzus persicae on S. sarrachoides when reared alone under similar conditions. Furthermore, we documented intraguild competition between M. euphorbiae and M. persicae on S. sarrachoides. Results suggested that M. euphorbiae can potentially suppress M. persicae on S. sarrachoides. Competition studies reiterated that M. euphorbiae produced more alatae than M. persicae. Results also indicated that M. euphorbiae may have specialized on S. sarrachoides. The loss of polyphagous abilities of this M. euphorbiae “biotype” is intriguing and the factors responsible for specialized host utilization pattern remain to be elucidated.

Hairy Nightshade (Solanum sarrachoides) Competition with Two Potato Varieties

Greenhouse and field trials were conducted at the Aberdeen Research and Extension Center to determine the effect of hairy nightshade competition on two potato varieties with different growth habits. Greenhouse replacement trials included treatments of three plants total in each pot with potato : hairy nightshade ratios of 3 : 0, 2 : 1, 1 : 2, or 0 : 3. Varieties tested were ‘Russet Burbank’ and ‘Russet Norkotah’. Greenhouse-grown hairy nightshade (cotyledon to one-leaf stage) were transplanted into pots earlier than or at the same time as potato plant emergence. As the number of Russet Burbank plants per pot decreased, potato plant biomass dry weight (average per plant) increased, regardless of hairy nightshade number or transplant time. When hairy nightshade were transplanted before Russet Norkotah emergence, potato plant biomass dry weight per plant was similar, regardless of potato : nightshade ratio. Field trials were conducted with Russet Burbank and Russet Norkotah in 2004 and 2005. At potato emergence, greenhouse-grown hairy nightshade plants (one- to two-leaf) were transplanted in between potato rows at densities of 0, 1, 2, or 3 plants m−1row, and solid-seeded at approximately 100 plants m−1row. Hairy nightshade biomass, stem and berry number, and seeds per berry were reduced by competition from Russet Burbank due to the amount and duration of shading, as compared with Russet Norkotah. Russet Burbank U.S. No. 1 and total tuber yields in plots with 1 hairy nightshade plant m−1row were similar to weed-free control yields, whereas yields in plots with 2, 3, or 100 m−1row were reduced in comparison. In contrast, Russet Norkotah yields were reduced when only 1 hairy nightshade plant m−1row was present. Overall, Russet Norkotah were less competitive with hairy nightshade than Russet Burbank in both the greenhouse replacement and field trials.

First Report of Impatiens necrotic spot virus Infecting Greenhouse-Grown Potatoes in Washington State.

In April and May 2010, leaves on approximately one-half of 200 potato (Solanum tuberosum L. cv. Atlantic) plants, 20 to 25 cm high, grown from prenuclear minitubers in greenhouses located at the USDA-ARS facility in Prosser, WA exhibited necrotic spots similar to those produced by the early blight pathogen, Alternaria solani. Fungicide sprays did not reduce incidence of the symptoms. Observations associated the symptoms with thrips feeding damage so plants were tested for Tomato spotted wilt virus (TSWV) and Impatiens necrotic spot virus (INSV) with ImmunoStrips from Agdia, Inc (Elkhart, IN). Three of three, two of two, and two of two symptomatic plants from three greenhouses were positive for INSV and negative for TSWV. Two symptomless plants tested negative. Four of four symptomatic and zero of two symptomless plants were positive by reverse transcription (RT)-PCR with INSV specific primers (forward: 5' TAACACAACACAAAGCAAACC 3' and reverse: 5' CCAAATACTACTTTAACCGCA 3') (4). The 906-bp amplicon from one sample was cloned and three clones were sequenced. The three clones were 99.7% identical, and BLAST analysis of the consensus sequence (GenBank Accession No. HM802206) showed 99% identity to INSV accessions D00914 and X66972, and 98% identity to other INSV isolates. The isolate, designated INSV pot 1, was mechanically inoculated to one plant of potato cv. GemStar and produced local, spreading necrotic lesions. The virus did not go systemic, as determined by RT-PCR of upper leaves 30 days after inoculation. The local necrotic lesions on GemStar were positive for INSV by ImmunoStrips and RT-PCR. The original source of the INSV inoculum is unknown. However, hairy nightshade (Solanum sarrachoides Sendtn.) and plantain (Plantago major L.) weeds in an ornamental planting near one of the affected greenhouses tested positive for INSV by ImmunoStrips. The nightshade showed obvious thrips feeding damage but no obvious virus symptoms while the plantain showed less thrips feeding damage but distinct necrotic rings. Subsequently, two of two symptomatic potato plants of cv. Desiree in another greenhouse near the initial site tested INSV positive with the ImmunoStrips. In addition to the necrotic lesions on leaves observed in cv. Atlantic, these plants also showed necrosis of petioles and stems. INSV is transmitted by a number of species of thrips, but the western flower thrips (Frankliniella occidentalis Perg.) is considered the most important under greenhouse conditions. The species of thrips in the affected greenhouses was not determined before all materials were discarded. Both INSV and the thrips vector have large host ranges including many crops and weeds, and have become increasingly important in recent years (1,2). INSV was reported on greenhouse-grown potatoes in New York in 2005 (3). These findings indicate INSV can be a major problem in greenhouse potatoes, whether for research purposes or production of virus-free minitubers destined for field plantings.

Evaluation of Imazosulfuron for Yellow Nutsedge (Cyperus esculentus) and Broadleaf Weed Control in Potato

Field studies were conducted in 2007 and 2008 near Nyssa, OR, and Pasco and Paterson, WA to evaluate yellow nutsedge and broadleaf weed control and potato tolerance to imazosulfuron. No injury symptoms from imazosulfuron were evident on potato at Nyssa, whereas in Washington, imazosulfuron caused some chlorosis of potato foliage ranging from 6 to 15% and &lt; 4% at 6 and 15 d after POST application, respectively. Sequential applications of imazosulfuron controlled yellow nutsedge better than a single PRE application. Sequential applications of imazosulfuron or imazosulfuron in combination withs-metolachlor controlled yellow nutsedge &gt; 92 and 89% at 21 and 42 d after POST applications, respectively. Imazosulfuron controlled ≥ 98% of common lambsquarters and 100% of pigweed species. Imazosulfuron provided season-long control of common mallow at Nyssa. However, imazosulfuron failed to control Russian thistle at Paterson, and only partially controlled hairy nightshade. Yield of U.S. no. 1 potato at Nyssa ranged from 44 to 54 T ha−1and 42 to 52 T ha−1for imazosulfuron PRE and imazosulfuron sequential treatments in 2007 and 2008, respectively. U.S. no. 1 potato yield following imazosulfuron PRE and sequential treatments at Pasco ranged from 49 to 57 T ha−1in 2007, and at Paterson from 36 to 54 T ha−1in 2008. Lower yields in 2008 were attributed to poor control of hairy nightshade. Imazosulfuron has potential to become a valuable tool for yellow nutsedge management in potato. Studies are needed to evaluate the soil persistence for imazosulfuron in order to determine safety to crops grown in rotation with potato.

Weed Hosts of Globodera pallida from Idaho.

The potato cyst nematode, Globodera pallida (PCN), a restricted pest in the United States, was first reported in Bingham and Bonneville counties of Idaho in 2006 (1). The U.S. government and Idaho State Department of Agriculture hope to eradicate it from infested fields. Eradicating PCN will require depriving the nematodes of their hosts over a protracted time period. Functional eradication might be achieved with relatively high, proven to be efficacious dosages of soil fumigants. The presence of host weeds of PCN can play a significant role in the success of the eradication program. To determine the host status of common weeds found in potato fields of the Pacific Northwest, host suitability tests were conducted in a secured greenhouse located at the University of Idaho at Moscow. Reproduction of PCN on nine weeds including hairy nightshade (Solanum physalifolium formerly S. sarrachoides) and cutleaf nightshade (S. triflorum) (biotypes from Idaho and Washington), black nightshade (S. nigrum) (Washington biotype), bittersweet nightshade (S. dulcamara) (Idaho biotype), redroot pigweed (Amaranthus retroflexus), kochia (Kochia scoparia), and common lambsquarters (Chenopodium album) were compared with reproduction on Desiree, Russet Burbank (known hosts), and Santé (poor host) potatoes (S. tuberosum). Plants were grown in 10-cm-diameter clay pots containing sandy loam soil previously fumigated with methyl bromide and inoculated with 10 to 150 cysts that were either collected from infested fields or raised in the secured greenhouse (ample diapause period elapsed). Treatments were replicated five times and each trial lasted 3 months. Cysts were extracted from soil with a Fenwick can, and the reproductive factor (RF = final cyst count ÷ initial inoculum) was determined. While both biotypes of hairy nightshade were suitable hosts of PCN (161-668 ÷ 150; RF = >1), cutleaf biotypes, black, and bittersweet nightshades were poor hosts (1-108 ÷ 150; RF = <1). Russet Burbank (77 ÷ 40; RF = 1.9) and Desiree (21-119 ÷ 75; RF = >1) proved to be suitable hosts and Santé (1-20 ÷ 150; RF = <1) a poor host of Idaho PCN. Although some cysts were recovered from pots containing the remaining weed species, they may have been part of the original inoculum. The significance of nightshade species (whether suitable or poor hosts) in eradication of potato cyst nematode from infested fields cannot be overemphasized. Reference: (1) A. M. Skantar et al. J. Nematol. 39:133, 2007.

Nightshade weeds (Solanumspp.) confirmed as hosts of the potato pathogensMeloidogyne fallaxandSpongospora subterraneaf. sp.subterranea

Hairy nightshade (Solanum physalifolium) and black nightshade (S. nigrum) are common weeds in cropping soils and potato crops (S. tuberosum) in New Zealand. Root galls were found on field-grown plants of hairy and black nightshade, and potato. Microscopic examination indicated that small galls (approx. 1 mm diameter) were caused by Meloidogyne fallax and larger galls (1–5 mm diameter) were caused by Spongospora subterranea f. sp. subterranea, and this was confirmed using species-specific PCR primers. Furthermore, infections caused by both pathogens were found simultaneously on individual specimens from all three hosts, and in a few cases, both pathogens occurred in the same individual gall. Mycelia of Rhizoctonia solani were also observed on galls and roots. Pathogenicity of M. fallax and Sp. subterranea f. sp. subterranea from field-grown nightshade plants was confirmed by inoculating glasshouse-grown tomato (Lycopersicon esculentum) and potato plants. This is the first record of M. fallax infecting S. physalifolium. Nightshade weeds are very likely to be important sources of M. fallax and Sp. subterranea f. sp. subterranea inoculum. Control of these weeds should be an important component of management of soilborne diseases in potato crops, to reduce pathogen inoculum and between-crop perennation.