GVHD Direction Research Articles

Outcomes of Pediatric Patients with JMML Following Unrelated Donor Transplant: The Impact of Donor KIR Gene Content and KIR Ligand Matching

Introduction Allogeneic hematopoietic cell transplantation (HCT) remains the sole curative therapy for patients with juvenile myelomonocytic leukemia (JMML) leading to a 5-year disease-free survival of ~50%. Whether donor NK cell determinants (e.g., KIR mismatch, KIR A/B genotype) correlate with relapse and survival are unknown. We previously demonstrated that JMML stem cells, defined as Lin-CD34+CD38-, express ligands for NKG2D, NKp30, and NKp44 at levels equal or greater than AML stem cells and that colony-forming units were significantly reduced following incubation of JMML cells with NK cells. Based on these observations we hypothesized that NK cell-dependent mechanisms are a major component of protection from JMML relapse after HCT, and specifically that determinants of greater donor NK cell function (e.g. KIR Bx donors or KIR ligand mismatch) are associated with reduced relapse. We therefore investigated NK cell-related donor and recipient immunogenetics as determinants for outcomes in children transplanted for JMML. Methods: Patients (0 to < 19 years) who received a first allogenic HCT from an alternative donor between 2000 to 2017 and had available donor samples from the Center for International Blood and Marrow Transplant Research (CIBMTR) repository were included in the study. Donor KIR typing was performed on pre-HCT samples and results were correlated with clinical data extracted from the CIBMTR database. The primary endpoint was disease free survival (DFS); secondary endpoints included relapse rate (REL), acute graft versus host disease (aGVHD), chronic graft versus host disease (cGVHD), GVHD relapse free survival (GRFS) and overall survival (OS). Patient and transplant related variables included age (< 2 years vs ≥ 2 years), sex, race, performance score (< 90 vs >90), disease status, graft type (bone marrow, peripheral blood, and cord blood), HLA matching (8/8 vs others), conditioning intensity (myeloablative vs others), use of serotherapy, GVHD prophylaxis (calcineurin inhibitor (CNI)+ methotrexate (Mtx) ± others vs others) and year of HCT (2000-2007 vs 2008-2017). KIR models tested included KIR genotype (AA vs Bx), Donor KIR B content (0-1 vs ≥ 2), centromeric and telomeric region score (AA vs AB vs BB), donor KIR B content score (best, better, neutral), KIR composite score (2 vs 3 vs 4), activating KIR content, presence of activating KIR DS4, ligand-ligand (L-L) mismatch, KIR ligand (KIR-L) mismatch, and missing ligand. Proportional hazards were checked for all covariates in every model. Univariate analysis was performed for primary and secondary outcomes of interest. Covariates with overall p-value < 0.05 and pairwise comparisons with p-value < 0.05 were considered significant. L-L and KIR-L mismatch effects were studied for all outcomes in a subgroup of HLA-mismatched donors (high resolution match <8/8). Results: 165 patients (113 males) with a median follow up of 85 (6-216) months met the study criteria. Of these, 111 received an unrelated donor transplant and 54 received cord blood transplants. This included 77 HLA-mismatched donor transplants. Almost all (161, 98%) received myeloablative conditioning. Half of the study cohort received ATG (91, 55%) and CNI + Mtx based GVHD prophylaxis (81, 49%). Based on donor KIR genotype, 43 patients received grafts from AA donors and 122 from Bx donors. On univariate analysis, there was no difference between AA vs Bx for the primary and secondary outcomes (Table 1). Considering the various KIR models, OS was significantly better for patients without L-L mismatch in the GVHD direction (HR 0.43 (95% CI: 0.20-0.91), p=0.027). Risk of grade II-IV aGVHD was lower in patients with Bx donors (HR 0.59 (CI: 0.35-0.99), p=0.047) and donors with B content score of ≥ 2 (HR 0.51 (0.29-0.89), p=0.017) (Table 2). Conclusion: To our knowledge this is the first study analyzing NK determinants in pediatric JMML HCT recipients. OS and aGVHD were the only outcomes associated with NK cell immunogenetics, but not in expected directions. These unexpected findings may be due to our limited sample size or heterogeneity in graft sources or treatment regimens. Our study identifies a potential benefit of donor of KIR-B genotypes and absence of L-L mismatch in the GVH direction for pediatric JMML patients. These observations require further investigation for confirmation and understanding of mechanism. Disclosures Verneris: Novartis: Membership on an entity's Board of Directors or advisory committees; Fate Therapeutics: Consultancy, Current equity holder in publicly-traded company; Bmogen: Consultancy, Current equity holder in publicly-traded company; Uptodate: Consultancy. Lee:Kiadis Pharma Netherlands B.V: Consultancy, Current equity holder in publicly-traded company, Membership on an entity's Board of Directors or advisory committees, Patents & Royalties.

A Two Step Myeloablative Approach to Allogeneic Hematopoietic Stem Cell Transplantation (HSCT) for Hematological Malignancies From HLA Partially-Matched (Haploidentical) Related Donors.

Abstract 2292Poster Board II-269Lack of a matched donor remains a major obstacle to the application of allogeneic HSCT in all appropriate patients. We developed a haploidentical 2 step myeloablative transplant regimen that used Cyclophosphamide (CY) tolerization to avoid severe GVHD while still allowing rapid post-HSCT immune reconstitution. We refer to this as a two step approach because the patients receive the lymphoid and stem cell portions of the graft at different times during the transplant regimen rather than as a single transplant inoculum. Between 2006 and 2009 twenty-seven patients, median age of 52 years (range 19-67), with high risk hematological malignancies were transplanted from haploidentical donors that were mismatched for HLA-A, B, C, and DR in the GVHD direction at 4 antigens (13), 3 antigens (11), and 2 antigens (2). One patient had no mismatches in the GVHD direction but was a 3 antigen mismatch in the rejection direction. The patients were given a conditioning regimen consisting of eight fractions (total dose 12 Gy) of total body irradiation (TBI) followed immediately thereafter by a donor lymphocyte infusion (DLI) of 2 ×10e8 CD3+ donor T cells, the first step of the transplant process. Within 24 hours, this dose of T cells consistently produced an in-vivo allogeneic reaction characterized by fever (median temperature 103.8f) and in many cases rash and diarrhea. Skin biopsies performed on 2 of the patients with rash were consistent with GVHD. After a median time of 63 hours (range 60-66 hours) following the DLI, CY (60 mg/kg/day) was given for 2 days to eliminate alloactivated donor and host T cells. The symptoms caused by the DLI typically disappeared 24 hours after completion of CY. The second step of the transplant occurred when a CD34 selected HSC product from the same donor was infused 24 hours after the end of the infusion of CY. GM-CSF was used post HSCT to accelerate white cell recovery and to promote a TH1 type immune response. Tacrolimus and mycophenylate mofetil were used for GVHD prophylaxis. Donor apheresis was performed over 2 days for lymphocyte collection followed by administration of G-CSF for 5 days and an additional 2 aphereses for HPC collection on days 4 and 5 of G-CSF administration. Fifteen of 27 patients (56%) are alive without evidence of their disease 3 to 32 months past HSCT. One additional patient is alive but with relapsed disease. Kaplan-Meier estimates of survival are 70% in patients without disease at the time of HSCT and 43% in patients not in remission at HSCT. Eleven patients (41%) died, 5 from relapsed disease, 3 from toxicity, and 3 from infection. Of the 6 relapses, 5 occurred in mothers who received transplants from their children. There were no deaths attributable to GVHD and only 1 brief occurrence of severe (grade III gut) GVHD. Fifteen patients (55%) developed grade 1-2 GVHD, mostly of the skin and easily controlled with steroids in 11 or with steroids plus photopheresis in 4 patients. Three patients developed limited chronic GVHD, one of whom is off immunosuppressive therapy. Immune reconstitution was brisk. Patients typically reached CD3+CD4+ counts of >100 cells/ul within a few months of discontinuation of immunosuppressive therapy. Two multiparous females with pre-existing anti-donor antibodies experienced humorally mediated rejections. Both died of toxicities related to a second HSCT. The other toxic death occurred in the patient with no mismatches in the GVHD direction who experienced a flare of his Crohn's disease shortly before conditioning. Three infectious deaths occurred, one due to progression of preexisting aspergillus lung disease and bacteremia, 1 due to RSV pneumonia, and 1 due to brain abscess.This 2 step technique; 1) allows for the administration of a prescribed amount of tolerized lymphocytes in an effort to promote consistent immunologic outcomes post transplant, 2) prevents exposure of the donor HSC to CY, 3) prevents exposure of the donor lymphocytes to G-CSF thus avoiding skewing to a TH2 T cell phenotype, and 4) allows for a greater separation between TBI and CY in the conditioning regimen which may help decrease regimen related toxicity. The high overall survival rate in patients in remission at the time of transplant illustrates the importance of early identification of patients for haploidentical HSCT who are without well matched donors. These encouraging clinical outcomes suggest that this novel 2 step approach to HSCT should be further explored. Disclosures:Off Label Use: Off Label Use of CD34 selection Device.

HLA Match and Mismatch Direction in Cord Blood (CB) Transplantation: Impact On Outcome and Implications for Cord Blood Unit Selection.

Abstract 2297Poster Board II-274Apparent immunological tolerance allows for transplantation of cord blood (CB) hematopoietic stem cells that are mismatched for human leukocyte antigens (HLA) with the recipient. HLA match, however, affects CB transplant outcome. To explore the possibility that the direction of HLA mismatch (MM) also has an impact on outcomes, we evaluated patients (pts) transplanted in the US with single CB units provided by the New York Blood Center, with 0-2 HLA MM, during the period 1993-2006. We hypothesized that CB grafts with MM in the rejection direction only (pt homozygous at the mismatched locus) would have higher rates of graft failure and, consequently, relatively poor post-transplant survival. Conversely, CB grafts with no rejection MM (i.e., GVHD only MM; CB unit homozygous at the mismatched locus) would have better engraftment and survival. Match level was evaluated at low-intermediate resolution for HLA-A and -B and at high resolution level for -DRB1. Of the 1,207 pts with outcome data (94% of eligible pts), 72% had hematological malignancies, 8% had bone marrow failure and the rest had various genetic diseases. Most pts (92%) had myeloablative conditioning, 26% were ≥16 years of age and 48% had non-Caucasian ancestry. CB grafts were HLA matched in 73 donor/patient pairs. Ninety-eight pairs (8% of total) had only unidirectional MM: 58 in the GVHD direction only (51 with 1 HLA MM; 7 with two) and 40 in the rejection direction only (30 with 1 HLA MM; 10 with two). There were 360 donor/patient pairs with 1 bidirectional MM, 524 with 2 bidirectional MM, 137 with 2 mismatches that were a mixture of bi- and uni-directional, and 5 with both types of unidirectional MM (different loci). In multivariate analyses, compared to CB grafts having 1 bidirectional MM, pts with matched grafts and those with GVHD only MM had faster ANC engraftment (RR=1.7, p=0.037 and RR=1.6, p=0.006, respectively) and improved TRM (RR=0.5, p=0.041 and RR=0.6, p=0.046, respectively), overall mortality (RR=0.6, p=0.041 and RR=0.6, p=0.016, respectively) and disease-free survival (RR=0.6, p=0.055 and RR=0.6, p=0.009, respectively). These grafts had no association with relapse risk in pts with hematological malignancies. In contrast, CB grafts with rejection only MM had a lower engraftment rate (RR=0.7, p=0.086) and a higher relapse rate. These associations were most apparent in patients with hematological malignancies (Table). These relationships were independent of other predictors in the multivariate models and of matching for the donor's non-inherited maternal antigens (NIMA), another factor we have recently found to affect outcome in MM CB transplants. Further, MM direction had no significant association with acute or chronic GVHD. No associations with outcome were found in grafts with a mix of both bi-directional and uni-directional MM or two unidirectional MM.HLA Match and MM Direction in CB Recipients with Hematologic MalignanciesGroupN3-year DFS3-year RelapseRR(95% CI)p valueRR(95% CI)p value0 MM480.4(0.2 - 0.7)0.0020.7(0.3 - 2.0)0.4991-2 MM / GvHD only350.5(0.3 - 0.9)0.0140.6(0.3 - 1.3)0.1981-2 MM / Rejection only231.5(0.9 - 2.4)0.1362.3(1.2 - 4.6)0.0131 Bidirectional MM249Reference GroupReference Group2 Bidirectional MM4151.1(0.9 - 1.4)0.1730.8(0.5 - 1.0)0.1002 MM / Mixed Direction1011.2(0.9 - 1.4)0.2401.0(0.6 - 1.6)0.947This study demonstrates that direction of HLA MM affects CB transplant outcome. CB units with GVHD only MM had outcomes similar to those of fully matched (6/6) grafts and, according to published reports in children with leukemia, possibly superior to 8/8 allele level bone marrow grafts from unrelated donors. CB units with rejection only MM were associated with poor engraftment and, in pts with hematological malignancies, with increased relapse risk. Assignment of HLA MM direction should be included in CB unit selection algorithms. For pts lacking fully matched grafts, selection of CB units with GVHD only MM will increase the probability of an optimal outcome. Disclosures:No relevant conflicts of interest to declare.

HLA Matching in Cord Blood Transplantion: Clinical Outcome and Implications for Cord Blood Unit Selection and Inventory Size and Ethnic Composition.

Background: Engraftment and survival in cord blood transplantation is affected by total nucleated cell (TNC) dose and HLA match grade. Thus, patients need assess to more cord blood units (CBUs) to provide for better matches and higher cell dose.Purpose: To examine the effect of HLA match grade and direction of mistmatch on outcome of cord blood transplantation with the aim to improve match algorithms and cord blood unit selection strategies. To apply the match algorithms in an empirical analysis of the chance of finding a CBU match by match grade, taking into account inventory size and donor ethnic background.Materials and Methods: Engraftment, GvHD, relapse, TRM and overall survival was evaluated in 1511 recipients of single CBU from the NYBC National Cord Blood Program transplanted through June 2005 (data available on 91% of eligible patients). The empirical chance of finding a full or 1 antigen mismatch (HLA-A, B at intermediate level and DRB1 at high resolution ) CBU was assessed for 14,378 patients on an inventory 25,917 CBUs from ethnically diverse donors (16.5% African-American, 17.0% Hispanic, 6.6% Asian, 50.4% Caucasian and 9.6% mixed).Results: HLA match grade correlated with engraftment, GvHD, relapse, TRM and overall survival, independent of the effect of TNC dose and other contributing factors. TNC dose/kg patient body weight (range 0.7 to >10.0 x 10^7/kg) did not affect outcome in fully matched CBU grafts. A two-fold increase in TNC dose, on average, was required to overcome differences in TRM and survival for 2 antigen mismatched grafts compared to 1 mismatch. Unidirectional mismatches in GvHD direction only (CBU homozygous at the mismatched loci) provided engraftment, TRM and survival rates that were the same as fully matched grafts, also with no apparent relationship to TNC dose. Patients with leukemia given CBU grafts with a GvHD only ismatch had a relapse rate that was the same at that of fully matched CBUs, whereas those with rejection only mismatches had a significantly higher relpase rate. In the empirical analysis of the chance of finding a match, including mismatch direction, 10.6% of patients could find a full match in an ethnically diverse CBU inventory. Including CBUs with 1 or 2 antigen mismatches only in the GvHD direction more than doubled the chance of finding a "good" match. The chance of finding a match or a CBU with 1 antigen mismatch correlated with patient ethnicity (patients had the best chance of finding a good match within their own ethnic group). African-American patients were the least likely of any group to find a suitable CBU (more than 5-fold less likely than Caucasions to find a full match), in part, because of their smaller numbers in the inventory and, in part, because of their greater HLA diversity. Increasing inventory size increased the chance of finding a full or 1 antigen matched CBU for all ethnic groups, but the improvement diminished progressively.Conclusions: HLA match level, including direction of mismatches, was associated with success of CBU transplantation. As with marrow donor registries, improvement in the probability of matching requires a progressively larger inventory size and depends on the donor ethnic diversity. Quantitatively larger number of donors are required for ethnic minority patients. Thus, the US National Cord Blood Inventory (planned for 150,000 new, high quality CBUs) should be enriched with ethnical diverse donors in order to meet the needs of ethnic minority patients who lack an HLA identical sibling donor.

An Empirical Analysis of the Probability of Finding a Well Matched Cord Blood Unit: Implications for a National Cord Blood Inventory.

Study Objective: To estimate the probability of finding an HLA matched cord blood unit, taking into account ethnicity, and the required size of national inventory of cord blood units that would provide a 6/6 or 5/6 HLA-A, -B, -DRB1 match for 80% of US patients.Methods: The study was limited to patients and cord blood units in the NYBC inventory through October 1, 2004 that had HLA-A, -B and -DRB1 typing completed at low resolution for class I and high resolution for DRB1. Of 16,222 search requests, 10,007 patients had high resolution DRB1 typing and of 26,675 cord blood units in our bank, 20,773 are DRB1 typed, thus far, at high resolution. One-third of the inventory would provide ≥ 2.0 x 107 TNC for a 70 kg adult. The patients had relatively low frequencies of the common HLA haplotypes, suggesting a reduction because suitable matches were found among marrow donor registries. Patient ethnicity was similar to that of the US population while donors were more likely to include members of ethnic minorities (20% African-American, 21% Hispanic, 8% Asian), as expected (we collect cord blood in some maternity hospitals that serve a high proportion of non-Caucasoid expectant mothers). A simulated search was performed to find matches for all patients in the current inventory and repeated to find potential grafts with mismatches in the GvHD direction only (no rejection mismatch). Grafts with only GvHD mismatches have had outcomes similar to a 6/6 match (Blood 2003; 102: 478a).Results: All except 94 patients (0.9%) had one or more cord blood units that provided a 4/6 match or better, 61% had a 5/6 match and 9% a 6/6 match. The probability in finding well-matched units almost doubled when we included both 6/6 matches and units mismatched in the GvHD direction only. The chance of finding a 5/6 or 6/6 match varied with patient ethnicity and was lowest for African-Americans (44% and 1.7%, respectively), despite the relatively high proportion of African-American donors to the inventory. As expected, patients were more likely to find a suitable match within their own ethnic group. When the inventory search was restricted in size (randomly selected units) to 5,000, 10,000, 15,000 and the full inventory of 20,773 units, the chance of finding a 5/6 or 6/6 match increased (36%, 48%, 55% and 61%, respectively) demonstrating a progressively diminishing improvement in match success.Conclusions: These empirical comparisons indicate that most patients can find a suitably matched cord blood unit, defined as either a 5/6 or 6/6 HLA match, within our relatively small inventory of cord blood units. The probability of finding a match being highest in the patient's own ethnic group underscores the need to enrich cord blood inventories with cord blood units donated by ethnic minorities. A projection based on these analyses suggest that 55–60,000 units would provide a 5/6 or 6/6 match for 80% of patients assuming that the ethnic distribution of donors and patients is maintained. However, cord blood units must provide a cell dose ≥ 2.0 x 107 TNC/Kg for single unit transplants. Thus, some 155–170,000 cord blood units may be required to also provide 70 Kg adults with ≥ 80% chance of finding a suitable match with an adequate cell dose. Inventory requirements might decrease if, for example, transplants with well matched units or two unit transplants lessen the cell dose limits, as preliminary data now suggests.

CD1a Is a Dimorphic Antigen-Presenting Protein That May Be Mismatched without Increasing the Risk of Graft Versus Host Disease.

On behalf of Eurobank MembersCD1a is a lipid antigen-presenting protein related to MHC class I that is frequently but incorrectly said to be non-polymorphic. There are two alleles in humans that differ by two linked amino acid substitutions, I13T and W51C in the alpha-1 domain. Substitution of threonine and cysteine in the minor allele may modify the structure of the antigen-binding groove and influence antigen specificity and T cell recognition. The CD1a gene on chromosome 1 may be mismatched in MHC identical sibling transplants, but the effect of this on GVHD is unknown. We hypothesized that CD1a might act as a tissue antigen and that GVHD would increase in recipients who possessed an allele unknown to the donor.163 recipient-donor sibling pairs transplanted with full and reduced intensity conditioning but without T depletion were identified from a database of all sequential transplants performed in Newcastle from Nov 1984 to Sept 2004 and in collaborating Eurobank centres from Nov 1997 to Sept 2004. DNA was amplified by PCR primers 5′: CCTGGAAACAAAATCTGGTC and 3′: GGGTACTTAACGTCAAACTT producing a 209 bp fragment, encompassing the C to G substitution at nucleotide 738 (W51C). This was analysed by SSCP and RFLP using the Hae III site 737–741.The overall allele frequency was: allele 1 (I13; W51): 0.07; allele 2 (T13; C51): 0.93. 148 pairs were matched at CD1a (2,2 into 2,2 or 1,2 into 1,2) and 15 were unmatched in the GVHD direction (2,2 into 1,2). There were no significant differences between the cohorts in age, gender mismatch, conditioning or transplant center. 5 year projected survival was 57% months in the matched cohort and 59% months in the unmatched (p=0.10 Kaplan-Meier). 43/148 (29%) matched transplants received cyclosporin alone GVHD prophylaxis compared with 9/15 (60%) of unmatched transplants (p=0.01; Fisher's exact test). The incidence and severity of GVHD was similar in both matched and unmatched cohorts: grade I–IV: 81% and 87% respectively (p=0.59); II–IV: 61% and 62% (p=0.48); III–IV: 22% and 20% (p=0.51; Fisher's exact test). The use of less GVHD prophylaxis in the unmatched group strengthens a negative result and as predicted, no increase in risk due to mismatching was revealed after correction for GVHD prophylaxis and other variables by binomial logistic regression.CD1a is an antigen-presenting molecule important in host defense. It is dimorphic in humans with a minor allele found in 16% of individuals and mismatched in the GVHD direction in 9% of HLA-identical sibling allogeneic transplants. Although amino acid substitution may alter the antigen specificity of the two isoforms of CD1a, mismatching does not increase the risk of GVHD and therefore CD1a does not appear to function as a tissue antigen in transplantation. This functional result supports recent structural analysis of the CD1a-TCR interaction showing that the glycolipid antigen makes little contribution to TCR binding, in contrast to the peptide antigens of conventional class I MHC molecules, which play an essential role in T cell recognition (Zajonc et al. Immunity 2005. 22: 209–19).

Impact of HLA Class I and Class II DNA High-Resolution HLA Typing on Outcome in Adult Unrelated Stem Cell Transplantation after In Vivo T-Cell Depletion with CAMPATH 1H: A Single Centre Experience in 100 Patients.

Aim: Outcome of unrelated donor stem cell transplantation (SCT) is influenced by matching for HLA class I and II. We investigated the effects of HLA typing on acute and chronic graft-versus-host disease (aGvHD and cGvHD) and overall survival (OS) in adult patients/donors typed for HLA-A, B, Cw, DRB1, DPB1 at high resolution (HR) and low resolution (LR).Patients: 100 patients (pts.)(median age 32 y, 17 – 54) were treated with allogenic SCT for diseases: 55 Ph-positive chronic myeloid leukaemia in first chronic phase (CML CP1), 21 CML in advanced phase (CML AP) and 24 acute leukaemias (AL). Pre-transplant conditioning consisted in 98 pts of total body irradiation (TBI) and cyclophosphamide (91) or etoposide (7) and in 2 pts of cyclophosphamide and busulphan. In all pts. GvHD prophylaxis was provided by cyclosporin A and short-term methotrexate with in vivo T-cell depletion (TCD) by CAMPATH 1H (Anti CD52).Results: With LR typing 68 pts./donors were fully matched but 32 had class I (31) or class II (1) mismatches (MisM). HR typing revealed 9 pts with additional class I (7) or II (7) MisM, thus 59 pts./donors were fully matched. AGvHD grade III–IV occured in 11 pts (11%) whilst extensive cGvHD was seen in 12 pts (14% out of 83). There was no statistical difference in the occurrence of aGvHD or cGvHD between fully matched and mismatched pts./donors at LR or HR. The probability of transplant-related mortality (TRM) of the whole cohort was 15% at day 100 and 23% at day 180 and engraftment failure 1%. The 3-year survival probabilities were significantly different (p=0.004) for pts. with CML CP1 at 63% (good risk group) when compared with CML AP and AL at 23% (poor risk group). In multivariate analysis patients age, diagnosis group and negative CMV status of patient and donor were the only significant predictors for survival. In the entire group the full compatibility at LR or HR for class I or class II or for a single HLA antigen or the KIR ligand mismatch in the GvHD direction did not have an impact on survival. In contrast to the CML CP1 group (n=55) we found that in the poor risk group (n=45) a MisM at HR had a negative impact on survival (p=0.03) and a trend towards worse survival was found for patients with HLA B HR mismatch. Patients with more than one HR MisM had a worse survival when the combination of HLA B and HLA D MisM was present (p=0.008).Conclusion: In 100 pts. treated with unrelated SCT and in vivo TCD with CAMPATH 1H the HR typing did have an impact on survival only in the poor risk group but not in pts with CML CP1. Thus, T-cell depletion with in vivo CAMPATH 1H permits the use of mismatched unrelated donors in patients with CML CP. The overall rates for aGvHD and cGvHD were low compared to published data in non TCD SCT. Further investigations on larger cohorts are needed to elucidate the impact of HR typing in unrelated SCT and the significance of HR MisM at single HLA loci in transplants T-cell depleted with in vivo CAMPATH 1H.

Impact of Homozygous Deletion of UGT2B17 on Outcome of Allogeneic BMT.

We recently identified a human minor histocompatibility (H) antigen encoded by the UDP glycosyltransferase 2 family, polypeptide B17 (UGT2B17) gene. UGT2B17 is a metabolic enzyme that is highly expressed in liver and colon, and at low levels in hematopoietic cells. UGT2B17 conjugates exogenous and endogenous compounds including steroid hormones and facilitates their elimination. The immunogenicity of the UGT2B17 was due to differential expression of the protein in donor and recipient cells as a consequence of a homozygous deletion of the UGT2B17 gene in the recipient. Deletion of this gene in a subset of normal individuals suggested two mechanisms by which UGT2B17 could affect the outcome of allogeneic BMT. First, the expression of UGT2B17 in recipient but not donor cells could provide minor H antigens and increase GVHD. Second, the presence of UGT2B17 in the donor or recipient could affect the metabolism, function, or toxicity related to endogenous hormones or drugs administered with BMT. The purposes of this study were to determine the frequency of homozygous UGT2B17 deletion in healthy individuals and patients with hematological disease and whether a deficiency of UGT2B17 in donor and/or recipient affected the outcome of allogeneic BMT. A total of 435 recipients were selected from the patients who received unrelated BMT through the Japanese Marrow Donor Program between January 1993 and March 2000. Selection criteria were (1) matched at HLA-A, B, C and DRB1 genotypes, (2) unmanipulated marrow graft, (3) cyclosporine A or tacrolimus as GVHD prophylaxis, and (4) available DNA was stored. DNA from a total of 358 of the donors was also available. Homozygous deletion of the UGT2B17 gene determined by SSP-PCR was found in 320 (84.8%) of 377 donors and 358 (82.3%) of 435 patients (P=0.32, χ2 test). These frequencies of UGT2B17 deletion were substantially higher than the 11% observed in the Caucasian population in a previous study. A multivariate analysis (Cox proportional hazard model) showed no significant association between UGT2B17-mismatch in the GVHD direction and the incidence of acute GVHD (grade II-IV or III-IV), chronic GVHD, relapse, or survival. However, a deletion of UGT2B17 in the donor was a favorable factor for transplant-related mortality (TRM) (relative risk, 0.530; 95% CI, 0.334 to 0.841; P=0.007), survival (0.567; 0.387 to 0.831; P=0.036) and disease-free survival (DFS) (0.647; 0.443 to 0.945; P=0.024). We also analyzed these outcomes in the subset of patients with standard-risk malignant disease by the Kaplan-Meier method. TRM, survival, and DFS at eight years after transplantation were 23.7% for patients transplanted from a UGT2B17-deleted donor vs 52.9% for patients with a UGT2B17-positive donor (P=0.001); 68.3% vs 37.5% (P=0.0009); and 66.9% vs 37.5% (P=0.0009), respectively. These data suggest that the UGT2B17 enzyme in donor-derived blood cells may affect the metabolism of exogenously administered or endogenous molecules and adversely influence the outcome of unrelated BMT. Analysis in another patient population will be important to confirm our results.

High Resolution HLA Typing by Sequencing for HLA-A, B, C, DR, DQ in 115 Unrelated Cord Blood/Patient Pairs- Does It Improve Outcomes after Cord Blood-Transplantation?.

The CB Bank Düsseldorf has provided to date (July 2004) 224 CB units (216 unrelated and 8 related, 29% adults, 71% children) to transplant centers worldwide. Until now no correlation could be detected between the number of HLA-mismatches based on low resolution (LR) typing for HLA-A and-B and high resolution typing (HR) for DRB1 and the incidence of aGvHD as published previously by us and other groups. The lack of correlation between aGvHD occurrence and donor/recipient HLA diversity in patients given an unrelated CBT could be explained by the fact that some mismatches for HLA class I antigens (A, B and C) are not detected by LR typing. In order to determine the impact of HLA high resolution typing with outcomes, mainly aGvHD after UCBT we analysed DNA samples of 115 CB recipients (86 children; 29 adults; 66 male, 49 female; diagnosis ALL=43, AML=19, SecAL =1, MDS=5, CML=10, NHL=5, Hodgkin=1, AA=7, genetic and metabolic diseases= 24) and their unrelated CB grafts were HLA-typed for HLA-class I (A, B, C) and HLA-class II (DRB1 and DQB1) by sequencing. The transplant centers used their own protocols for GvHD prophylaxis, the most commonly used was the combination of CsA and steroids alone (60%), CsA alone (15%), or the combination with MTX (6%). 55 of 115 patients did not develop aGvHD (grade 0= 48%), 26 patients developed grade I (23%), 12 patients developed grade II (10%), 10 patients grade III (9%) and 12 patients grade IV (10%). When mismatches (MM) were analysed for HLA-A, B based on LR-typing and -DRB1 based on HR-typing in concordance with all published data so far, the following mismatch situation resulted: No MM (16 pairs, 13.9%), one MM (47 pairs, 40.9%), two MM (41 pairs, 35.7%), three MM (5 pairs, 4.3%), four MM (3 pairs, 2.6%). If the MM for A and B alleles detected by HR-typing were included, the situation was as follows: 0 MM (6 pairs, 5.2%), 1 MM (35 pairs, 30.4%), 2 MM (54 pairs, 47%), 3MM (14 pairs, 12.2%), 4 MM (5 pairs, 4.3%), 5 MM (1 pair, 0.9%). If analysing A, B, C, DR and DQ based on HR typing a high additional frequency of MM occurred: No MM (4 pairs, 3.5%), 1 MM (13 pairs, 11.3%), 2 MM (19 pairs, 16.5%), 3 MM (24 pairs, 20.9%), 4 MM (30 pairs, 26.1%), 5 MM (14 pairs, 12.2%), 6 MM (6 pairs, 5.2 %), 6 MM (6 pairs, 5.2%), 7 MM (3 pairs, 2.6%), 8 MM (2 pairs, 1.7%). There was no significant correlation between the number of MM (also analysed in GvHD or rejection direction) using high-resolution level for HLA-A, B and DRB1 as well as for HLA-A, B, C, DRB1 and DQB1 and the development of aGvHD grade III-IV. More interestingly, we have not found any significant correlation between numbers of MM with 2-year survival probability. Although the heterogeneity and number of patients analysed, it shows that the degree of mismatching is even higher than expected, also in comparison to unrelated BMT. It also shows that additional subtyping for HLA-A, B, C and DQ, not performed on a routine basis at present, does not improve the 2-year survival rate.

Bone marrow transplantation from alternative donors for thalassemia: HLA-phenotypically identical relative and HLA-nonidentical sibling or parent transplants

Twenty-nine patients with thalassemia and a median age of 6 years (range 1.1–33 years) were given a BMT from an alternative donor. Six of the 29 donors were HLA-phenotypically identical and two were mismatched relatives, 13 were mismatched siblings and eight were mismatched parents. Six patients received no antigen (relatives), 15 patients one antigen, five patients two antigen and three patients three antigen disparate grafts. Twenty-three patients were in class 2 or class 3, whereas six patients were in class 1. Thirteen patients were given BUCY, nine patients BUCY plus ALG, six patients BUCY plus TBI or TLI and one patient BUCY with prior cytoreductive-immunosuppressive treatment as conditioning. As GVHD prophylaxis four patients received MTX, 22 CsA + MTX + methylprednisolone (MP) and three patients CsA + MP. Thirteen of 29 patients (44.8%) had sustained engraftment. The probability of graft failure or rejection was 55%. There were no significant differences between antigen disparities and graft failure. The incidence of grade II–IV acute GVHD was 47.3% and chronic GVHD was 37.5%. The incidence of acute GVHD was higher in patients receiving one or two antigen disparate in the GVHD direction grafts (vs no antigen) (P EQ 0.04; odds ratio 10.8; 95% CI 1.5–115). The probability of overall and event-free survival was 65% and 21%, respectively, with median follow-up of 7.5 years (range 0.6–17 years) for surviving patients. The degree of HLA disparity between patient and donor did not have a significant effect on survival. The incidence of nonhematologic toxicity was low. Transplant-related mortality was 34%. GVHD (acute or chronic) was a major contributing cause of death (50%) followed by infections (30%). We conclude that at present, due to high graft failure and GVHD rates, BMT from alternative donors should be restricted to patients who have poor life expectancies because they cannot receive adequate conventional treatment or because of alloimmunization to minor blood antigens. Bone Marrow Transplantation (2000) 25, 815–821.

Crucial role of the third and fourth hypervariable regions of HLA-DPB1 allelic sequences in the mixed lymphocyte reaction

Since HLA-DP mismatches are known to induce proliferative response in MLR I, we investigated the real impact of the different DP alleles and the possible role of one or several hypervariable regions of the DPB allelic sequences. Accordingly, we performed MLR I between HLA-A, B, DR, DQ, and Dw identical individuals DP oligotyped after DNA amplification. A total of 23 one-DP-mismatched healthy stimulator and responder cells displaying nine different DP specificities were thus evaluated in 52 MLRs I. This allowed us to analyze the impact of amino acid composition of each of the six hypervariable regions independently of the amino acid matching or mismatching in the five others. We show here that DP combinations sharing the same amino acid sequence in the third (C) and fourth (D) hypervariable regions are associated with a low proliferative response in vitro ( p < 0.01). These data imply that a perfect HLA-DP matching may not be requisite in selecting bone marrow donors. Indeed, the choice of donors may rely on determination of these particular mismatched HVRs between the DP alleles involved especially in GvHD direction. This policy including prospective DP oligotyping should be of great interest, especially when MLRs I are false negative or nonevaluable. It will enable a better definition of which DP mismatches are acceptable in BMT.