Guanidine Thiocyanate Research Articles

A simple and rapid DNA extraction method for Cyanobacteria and Monocots

The isolation of DNA from biological samples is a crucial step in the process of DNA-based molecular biological assays. In this study, we present a simple method to extract and purify genomic DNA from different sample types (standard cyanobacteria, cyanobacteria in water samples and leaves of bamboo plants) which would be suitable for any molecular analyses. In this method, cyanobacteria are lysed by three sequential freezing and heating followed by enzymatic treatment with lysozyme and proteinase K. The extraction and purification of DNA was achieved with the lysing and nuclease inactivating properties of the chaotropic agent guanidium isothiocyanate and the nucleic acid binding properties of silica particles. The DNA extraction method yielded high quality reproducible DNA. The technique described here is a rapid, robust and cost effective method suitable for the extraction of DNA from any source for routine molecular biological assays. Key Words: Boom’s method, guanidine thiocyanate, silica, Polymerase Chain Reaction (PCR) DOI: http://dx.doi.org/10.4038/cjsbs.v40i1.3407 CJSBS 2011; 40(1): 59-63

Expression of MIS Receptors in the Oocyte of Indian Major Carp, Cirrhinus mrigala

Introduction: Many actions of steroids are too rapid to be readily explained be the classical genomic mechanism of steroid action mediated by activation of nuclear steroid receptors. The receptors mediating these rapid steroid actions have been studied extensively in many laboratories over the past 30 years. The binding moieties with the characteristics of progestin membrane receptors have been demonstrated in fish and amphibian oocytes and some other vertebrate tissues. Maturation-inducing steroid (MIS) receptors are potential intermediaries in meiotic maturation of oocytes. 17α,20β-dihydroxy-4pregnen-3-one (17α,20β-DHP) has been identified as the MIS in many teleosts, and induces oocytes to enter into final meiotic maturation leading to ovulation. The MIS receptors are membrane progestin receptors (mPR) and are responsible to mediate rapid non-genomic progestin action. The mPRs are mainly consisting of three forms such as mPRα, mPRβ and mPRγ. An attempt has been made to identify the receptors encoding gene in an Indian major carp, Cirrhinus mrigala. Methods: The immature and mature oocytes of C. mrigala were collected during the month of May (vitellogenic stage) and August (gravid stage) in RNA later, and total RNA was extracted using guanidine thiocyanate method. The extracted RNA was reverse transcribed to cDNA by MMuLV, RT-PCR kit (Medox). Specific primers (Sigma, USA) were constructed for mPRα, mPRβ and mPRγ and applied to catch the specific gene. The primers are mPRα sense ‘CTGTCCTGTACGGGCTG’, and antisense ‘CTCCTGCTTGTCTTCTAGATACGC’, mPRβ sense ‘ACTGGTTTCCCCGTCTACCT’, and antisense ‘GTACAGGACAGCCAGGCCAGGA’, mPRγ  sense ‘AACTCCTCGGATCCCAAAC’, and antisense ‘TGTGATAGCACAGCCGAGAC’. The PCR products were visualized by gel electrophoresis using ethidium bromide. The PCR amplified product was quantified and sequenced (Genei, India). Results and Discussion: The mPRα does not show any difference between the vitellogenic and gravid stage of oocytes (lane 1 and 2) and the mPRβ has the band intensity difference between the two stages (lane 3 and 4) whereas mPRγ could not be identified in the gravid stage (lane 6) in reference with the 100bp DNA marker (lane 7). The results confirm the possible expression of membrane progestin receptors mPRα and mPRβ in the matured oocytes and mPRγ gene expression in the mid vitellogenic stage of C. mrigala. This is the first demonstration of MIS receptor gene expression in the oocytes of C. mrigala. In previous studies Yukinori et al. [1] reported that in channel catfish mPRα transcripts gradually increased during oocyte growth, mPRβ varied slightly throughout the reproductive cycle whereas in zebrafish mPRβ level increased during the follicular development stage. In sea trout, Zhu et al. [2] reported that mPRα was expressed in the plasma membrane, mPRβ brain and oocyte, and mPRγ was expressed in the oocyte as well as kidney. The present result also suggests that the mPRγ is not playing any role in the final maturation, however mPRα and mPRβ transcription is seasonally varied with maturity of oocytes. The partially sequenced genes (mPRα-979bp, mPRβ-981bp and mPRγ-521bp) were used to construct phylograms which indicate that C. mrigala is closely related to Carassius auratus and Danio rerio in comparison with other teleosts.

Detection of Poly(I): Poly(C12U), Mismatched Double-stranded RNA, by Rapid Solution Hybridization: Blood Values after Intravenous Infusion

A rapid solution hybridization technique has been developed for estimating blood concentrations of poly(I):poly(C12U), a high molecular weight bioactive double-stranded RNA. Samples were prepared by mixing 100 microL of blood with, 165 microL of 6 M guanidine thiocyanate (GuSCN) and 0.16 M EDTA pH 8.0, and freezing. Hybridizations were carried out with a [3H]poly(C) probe in 3 M GuSCN for 10 min at 37 degrees C. Ribonuclease-resistant hybrids were collected by precipitation with trichloroacetic acid and filtration. Validation studies demonstrated minor interassay variance; the assay was accurate in the range 0.1 to 10 ng poly(I):poly(C12U). Thirty-one blood samples from 15 patients were collected and prepared before and immediately after an average 35 min intravenous infusion of 40-500 mg poly(I):poly(C12U). Postadministration values averaged 48% (s.d. 23%) of the theoretical maximum (range 20-102%). These results confirm previous observations of rapid elimination kinetics of poly(I):poly(C12U) in patients.

Influence of electrolyte co-additives on the performance of dye-sensitized solar cells.

The presence of specific chemical additives in the redox electrolyte results in an efficient increase of the photovoltaic performance of dye-sensitized solar cells (DSCs). The most effective additives are 4-tert-butylpyridine (TBP), N-methylbenzimidazole (NMBI) and guanidinium thiocyanate (GuNCS) that are adsorbed onto the photoelectrode/electrolyte interface, thus shifting the semiconductor's conduction band edge and preventing recombination with triiodides. In a comparative work, we investigated in detail the action of TBP and NMBI additives in ionic liquid-based redox electrolytes with varying iodine concentrations, in order to extract the optimum additive/I2 ratio for each system. Different optimum additive/I2 ratios were determined for TBP and NMBI, despite the fact that both generally work in a similar way. Further addition of GuNCS in the optimized electrolytic media causes significant synergistic effects, the action of GuNCS being strongly influenced by the nature of the corresponding co-additive. Under the best operation conditions, power conversion efficiencies as high as 8% were obtained.

Efficient quantum dot-sensitized solar cell with polystyrene-modified TiO2 photoanode and with guanidine thiocyanate in its polysulfide electrolyte

Monodispersed polystyrene (PS, ca. 300nm) latex particles are incorporated into a TiO2 film. A polystyrene-modified TiO2 film (M-TiO2) with micro-cluster structure, containing micro/nano-composite pores is thus obtained after sintering. Cadmium sulfide (CdS) quantum dots (CdS-QDs) are accumulated over M-TiO2 and bare TiO2 films (B-TiO2) by successive ionic layer adsorption and reaction (SILAR); we designate these films as M-TiO2/CdS and B-TiO2/CdS, respectively. Influence of SILAR cycles used for depositing CdS on B-TiO2 and M-TiO2 films on the performance of the pertinent quantum dot-sensitized solar cells (QDSSCs) is studied. The QDSSC with 6 SILAR cycles of M-TiO2/CdS (M-TiO2/CdS6) exhibited a solar-to-electricity conversion efficiency (η) of 1.79%, while the cell with B-TiO2/CdS5 shows an η of 1.35%, under the illumination of one sun. Moreover, guanidine thiocyanate (GuSCN) is found to be a promising additive to the polysulfide electrolyte. The additive renders higher conversion efficiency (2.01%) to its QDSSC. Durability of the CdS-QDSSC is also tested. Scanning electron microscopy (SEM) is used to obtain the images of TiO2 films and energy-dispersive X-ray spectroscopy (EDX) is employed to study the stoichiometric ratios of M-TiO2/CdS and B-TiO2/CdS. Incident photon-to-current conversion efficiencies (IPCE) of the QDSSCs are obtained to confirm the JSC behaviors of the cells.

Synergistic Effect of N-Methylbenzimidazole and Guanidinium Thiocyanate on the Performance of Dye-Sensitized Solar Cells Based on Ionic Liquid Electrolytes

The effects of additives guanidinium thiocyanate (GSCN) and N-methylbenzimidazole (MBI) on the photovoltaic performance of dye-sensitized solar cells based on low-viscous, binary ionic liquid and o ...

Improved method for simultaneous isolation of proteins and nucleic acids

Guanidinium thiocyanate–phenol–chloroform extraction (GTPC extraction) is widely used in molecular biology for isolating DNA, RNA, and proteins. Protein isolation by commercially available GTPC solutions is time consuming and the resulting pellets are only incompletely soluble. In this study ethanol–bromochloropropane–water was used for precipitation of proteins from the phenol–ethanol phase after GTPC extraction of RNA and DNA. The precipitated proteins can be readily dissolved in 4% SDS for subsequent analysis. This technique allows a fast (30 min) and efficient (with a protein recovery of up to 95%) extraction of proteins for the study of transcriptional and posttranscriptional events from the same sample.

Conformational analysis and design of cross‐strand disulfides in antiparallel β‐sheets

Cross-strand disulfides bridge two cysteines in a registered pair of antiparallel β-strands. A nonredundant data set comprising 5025 polypeptides containing 2311 disulfides was used to study cross-strand disulfides. Seventy-six cross-strand disulfides were found of which 75 and 1 occurred at non-hydrogen-bonded (NHB) and hydrogen-bonded (HB) registered pairs, respectively. Conformational analysis and modeling studies demonstrated that disulfide formation at HB pairs necessarily requires an extremely rare and positive χ¹ value for at least one of the cysteine residues. Disulfides at HB positions also have more unfavorable steric repulsion with the main chain. Thirteen pairs of disulfides were introduced in NHB and HB pairs in four model proteins: leucine binding protein (LBP), leucine, isoleucine, valine binding protein (LIVBP), maltose binding protein (MBP), and Top7. All mutants LIVBP T247C V331C showed disulfide formation either on purification, or on treatment with oxidants. Protein stability in both oxidized and reduced states of all mutants was measured. Relative to wild type, LBP and MBP mutants were destabilized with respect to chemical denaturation, although the sole exposed NHB LBP mutant showed an increase of 3.1°C in T(m). All Top7 mutants were characterized for stability through guanidinium thiocyanate chemical denaturation. Both exposed and two of the three buried NHB mutants were appreciably stabilized. All four HB Top7 mutants were destabilized (ΔΔG⁰ = -3.3 to -6.7 kcal/mol). The data demonstrate that introduction of cross-strand disulfides at exposed NHB pairs is a robust method of improving protein stability. All four exposed Top7 disulfide mutants showed mild redox activity.

Evaluation of Extraction Methods for Efficient Detection of Enteric Viruses in Pork Meat Products

We report an in-house protocol for extraction and purification of nucleic acids of enteric viruses, which gives more consistent results than representative commercial methods. The protocol uses 4 M guanidine thiocyanate, 0.5% N-lauroylsarcosine sodium salt, and 25 mM sodium citrate pH 7.0 supplemented with 0.14 M β-mercaptoethanol for lysis of virus particles. The addition of TRIzol followed by chloroform-based separation of the aqueous phase is used to purify nucleic acids from the lysate. RNA precipitation is performed using lithium chloride. This protocol was compared with QIAGEN’s RNeasy Kit and bioMerieux’s NucliSens method, by evaluating the ability of each to detect enteric viruses in a complex food matrix. Three different pork products, i.e., cooked ham, liver, and Spanish fermented sausage (“chorizo”) were artificially contaminated with decreasing numbers of murine norovirus 1 and human adenovirus 2. The extracted and purified viral nucleic acids were detected by real-time polymerase chain reaction (PCR) assays. Whereas the two commercial extraction methods did not facilitate robust results (quantification was only possible with some viruses and/or some matrices), when coupled with the in-house protocol the linearity and the efficiency of the quantitative reverse transcription-PCR (qRT-PCR) assays were close to 1 in all the food matrices, independent of the virus. Scalability of the in-house method was evaluated by analysis of 1 and 2.5 g of spiked pig liver samples, and quantification was possible on 1 g samples contaminated with any of the two model viruses. Therefore, the in-house protocol facilitates robust qRT-PCR-based quantitative detection of viruses in pork products, and is moreover relatively cheap and simple to perform.

Electrolyte Effects on Electron Transport and Recombination at ZnO Nanorods for Dye-Sensitized Solar Cells

Electrolyte effects on electron transport and recombination at ZnO nanorods (nd-ZnO) were studied by electrochemical impedance spectroscopy (EIS) in dye-sensitized solar cells (DSSCs). Different electrolyte systems were prepared by gradually adding tert-butylpyridine (TBP) and guanidinium thiocyanate (GuSCN) and replacing LiI with 1-butyl-3-methylimidazolium iodide (BMII). The introduction of TBP and GuSCN, and the replacement of LiI with BMII suppressed charge recombination at the nd-ZnO/electrolyte interface, increased electron lifetime (τn), improved electron transport, and reduced collection time (τd) on nd-ZnO. In addition, they improved the electron diffusion coefficient (Dn) and elongated the effective diffusion length (Ln). The electron transfer coefficient (β) at the ZnO/electrolyte interface was increased from 0.34 to 0.44, which was a good sign of improvement in fill factor (FF). In addition, the ohmic series resistance was reduced from 17.35 to 4.99 Ω·cm2 and the charge transfer resistance was decreased from 18.49 to 7.09 Ω·cm2 at the electrolyte/Pt interface. Nd-ZnO DSSCs using different electrolytes were tested and the improvement of open circuit voltage (Voc), short circuit current density (Jsc), fill factor (FF), and incident photon to electron conversion efficiency (IPCE) was in good agreement with the findings from the EIS data.

New Efficient Ruthenium Sensitizers with Unsymmetrical Indeno[1,2-b]thiophene or a Fused Dithiophene Ligand for Dye-Sensitized Solar Cells

Two novel ruthenium sensitizers containing unsymmetrical indeno[1,2-b]thiophene or a fused dithiophene unit in the ancillary ligand have been designed and synthesized. The photovoltaic performance of JK-188 using an electrolyte consisting of 0.6 M 1,2-dimethyl-3-propylimidazolium iodide, 0.05 M I(2), 0.1 M LiI, 0.05 M guanidinium thiocyanate, and 0.5 M tert-butylpyridine in acetonitrile revealed a short-circuit photocurrent density of 18.60 mA/cm(2), an open-circuit voltage of 0.72 V, and a fill factor of 0.71, yielding an overall conversion efficiency of 9.54%. The cell exhibits a remarkable stability under 1000 h of light soaking at 60 °C using a quasi-solid-state electrolyte consisting of 5 wt % poly(vinylidenefluoride-co-hexafluoropropylene), 0.6 M 1-propyl-2,3-dimethylimidazolium iodide, 0.5 M N-methylbenzimidazole, and 0.1 M I(2) in 3-methoxypropionitrile, retaining 97% of the initial efficiency (7.38%).

Impedance characterization of dye-sensitized solar cells in a tandem arrangement for hydrogen production by water splitting

The present work reports the photoelectrochemical characterization of a dye-sensitized solar cell (DSC) to assist water split in a photoelectrochemical (PEC) cell. Performance parameters were extracted from standard current–voltage characteristic ( I–V) and the charge transfer phenomena occurring at different interfaces of the DSC were evaluated by electrochemical impedance spectroscopy (EIS). The DSC comprised the N719 dye and a robust electrolyte (1-propyl-3-methylimidazolium iodide in guanidinium thiocyanate additive). At 1 sun illumination the DSC yielded a short-circuit photocurrent density of 14.9 mA cm −2, an open-circuit voltage of 0.797 V, a fill factor of 0.712 and an overall efficiency of 8.5%. Different PEC systems based on silicon-doped and undoped hematite photoelectrodes were considered. The required additional anodic bias necessary for actual water cleavage was supplied by two DSCs in series operating just under open-circuit voltage (1.56 V), allowing a conversion efficiency of about 1.12% for the silicon-doped hematite deposited by APCVD, 0.51% for the silicon-doped prepared by USP and 0.12% for the undoped hematite sample.

Long-term conservation of HCV RNA at 4 °C using a new RNA stabilizing solution

Protecting RNA from degradation, whilst maintaining its biological activity, is essential in molecular biology. However, RNA is very sensitive to degradation by ribonucleases, especially at temperatures above 0 °C. The stability of RNA was examined at 4 °C and −20 °C, in a new stabilizing solution consisting of a low-molarity mixture of chaotropic agents guanidinium and ammonium thiocyanate, a buffer for pH stabilization, phenol, and yeast RNA. Two substrates were tested for storage: RNA in human plasma positive for hepatitis C virus (HCV) and naked RNA (purified from HCV positive human plasma or transcribed in vitro). Stability was followed by viral load estimation, using an in-house competitive RT-PCR assay. Naked RNA purified from human plasma positive for HCV was stable at 4 °C for at least 24 months. An RNA standard transcribed in vitro was still viable after 36 months of storage at 4 °C. Human plasma dilutions positive for HCV were stable for at least 5 months in this solution when stored at 4 °C. It was concluded that the described stabilizing solution ensures long-term stability on naked RNA at 4 °C, and ideal for the storage of RNA controls and standards for molecular diagnosis, the solution may be used for preserving clinical samples prior to transport to a clinical laboratory.

USF and NF-E2 Cooperate to Regulate the Recruitment and Activity of RNA Polymerase II in the β-Globin Gene Locus

The human beta-globin gene is expressed at high levels in erythroid cells and regulated by proximal and distal cis-acting DNA elements, including promoter, enhancer, and a locus control region (LCR). Transcription complexes are recruited not only to the globin gene promoters but also to the LCR. Previous studies have implicated the ubiquitously expressed transcription factor USF and the tissue-restricted activator NF-E2 in the recruitment of transcription complexes to the beta-globin gene locus. Here we demonstrate that although USF is required for the efficient association of RNA polymerase II (Pol II) with immobilized LCR templates, USF and NF-E2 together regulate the association of Pol II with the adult beta-globin gene promoter. Recruitment of Pol II to the LCR occurs in undifferentiated murine erythroleukemia cells, but phosphorylation of LCR-associated Pol II at serine 5 of the C-terminal domain is mediated by erythroid differentiation and requires the activity of NF-E2. Furthermore, we provide evidence showing that USF interacts with NF-E2 in erythroid cells. The data provide mechanistic insight into how ubiquitous and tissue-restricted transcription factors cooperate to regulate the recruitment and activity of transcription complexes in a tissue-specific chromatin domain.

Comparison of nested PCR and real-time PCR for the detection of Toxoplasma gondii in biological samples from naturally infected cats

There are different protocols of molecular diagnosis methods available including DNA extraction methods to diagnose of Toxoplasma gondii, being necessary to perform comparative studies in biological samples. The aim of this study is to compare real-time PCR (rtPCR) and nested PCR (nPCR) to evaluate the detection of T. gondii in naturally infected cats. Biological samples of Toxoplasma-seropositive cats were assayed for detection of T. gondii DNA – extracted by both the lysis buffer and proteinase K (LB proteinase K) method and the acid guanidinium thiocyanate (GuSCN) method – using rtPCR and nPCR. T. gondii DNA was detected by nPCR in 43.6% and 40.8% of the samples from which it was extracted by the LB proteinase K and the GuSCN method, respectively. With rtPCR these figures fell significantly to 33.8% and 14.1%. Despite of nPCR showed higher sensitivity, the agreement observed between two PCRs was good; this agreement, however, was affected by the DNA extraction method used, LB proteinase K method showed better results.

Analysis of marine bivalve shellfish from the fish market in Santos city, São Paulo state, Brazil, for Toxoplasma gondii

The aim of this study was to determine if Toxoplasma gondii are present in oysters ( Crassostrea rhizophorae) and mussels ( Mytella guyanensis) under natural conditions using a bioassay in mice and molecular detection methods. We first compared two standard protocols for DNA extraction, phenol–chloroform (PC) and guanidine-thiocyanate (GT), for both molluscs. A total of 300 oysters and 300 mussels were then acquired from the fish market in Santos city, São Paulo state, Brazil, between March and August of 2008 and divided into 60 groups of 5 oysters and 20 groups of 15 mussels. To isolate the parasite, five mice were orally inoculated with sieved tissue homogenates from each group of oysters or mussels. For molecular detection of T. gondii, DNA from mussels was extracted using the PC method and DNA from oysters was extracted using the GT method. A nested-PCR (Polymerase Chain Reaction) based on the amplification of a 155 bp fragment from the B1 gene of T. gondii was then performed. Eleven PCR–RFLP (Restriction Fragment Length Polymorphism) markers, SAG1, SAG2, SAG3, BTUB, GRA6, c22-8, c29-2, L358, PK1, CS3 and Apico, were used to genotype positive samples. There was no isolation of the parasite by bioassay in mice. T. gondii was not detected in any of the groups of mussels by nested-PCR. DNA of T. gondii was apparently detected by nested-PCR in 2 groups of oysters (3.3%). Genotyping of these two positive samples was not successful. The results suggest that oysters of the species C. rhizophorae, the most common species from the coast of São Paulo, can filter and retain T. gondii oocysts from the marine environment. Ingestion of raw oysters as a potential transmission source of T. gondii to humans and marine mammals should be further investigated.

Mutant of Moloney murine leukemia virus reverse transcriptase exhibits higher resistance to common RT-qPCR inhibitors

Inhibitor resistance of several commercial Moloney murine leukemia virus reverse transcriptase (MMLV RT) enzymes was investigated. IC 50 values were determined for potential RNA contaminants, including guanidine thiocyanate, ethanol, formamide, ethylenediaminetetraacetic acid (EDTA), and plant-related acidic polysaccharides. Sensitivity (as judged by MMLV RT IC 50 values) was directly correlated to the outcome of “mock” reverse transcription-quantitative polymerase chain reaction (RT-qPCR) assays carried out with exogenous inhibitors. MMLV RT enzymes lacking RNase H activity were shown to be more sensitive to RT-qPCR inhibitors. In contrast, a thermal-resistant MMLV RT pentuple mutant (E69K/E302R/W313F/L435G/N454K) showed higher tolerance to these substances than the wild type. Increased resistance was also noted in RT-qPCR comparisons employing crude cell lysates.

Enhancing the performance of dye-sensitized solar cells by incorporating nanomica in gel electrolytes

Gel-type dye-sensitized solar cells (DSSCs) were fabricated with 5.0 wt% polyvinyidene fluoride-co-hexafluoro propylene (PVDF-HFP) in methoxy propionitrile (MPN) as gel polymer electrolyte (GPE), 1-butyl-3-methylimidazolium iodide (BMII)/iodine (I 2) as redox couple, 4-tertiary butyl pyridine (TBP) and guanidine thiocyanate as additives. The incorporation of alkyl-modified nanomica (AMNM) in the PVDF-HFP gel electrolytes caused the reduction of crystallization of PVDF-HFP, which was confirmed by X-ray diffraction (XRD) analysis. The short-circuit current density ( J SC) of the cell increased due to the decrease of diffusion resistance, as judged by the electrochemical impedance spectra (EIS) analysis, while the open-circuit voltage ( V OC) remained almost the same. As the loading of AMNM in the PVDF-HFP gel electrolyte was increased to 3.0 wt%, the J SC and power conversion efficiency ( η) of the cells increased from 8.3 to 13.6 mA/cm 2 and 3.5% to 5.7%, respectively. However, the J SC decreased as the loading of AMNM exceeded 3.0 wt%. At higher AMNM loadings, nanomica acted as a barrier interface between the electrolyte and the dye molecules to hinder electron transfer, and thus reducing the cell’s photocurrent density. Furthermore, the DSSCs fabricated by dispersing polymethyl methacrylate (PMMA) microspheres in the TiO 2 electrode with the GPE containing 3.0 wt% AMNM improved the η to 6.70%. The TiO 2 films would exhibit larger porosity by blending with PMMA, leading the penetration of GPEs into the porous TiO 2 easier, thus improving the contact between the dye-adsorbed TiO 2 surfaces and the GPEs, as characterized by EIS. Moreover, the η of gel-type DSSCs with a 25 μm thickness of surlyn reached 7.96% as compared with 6.70% for the DSSCs with a 60 μm surlyn.

Photoelectrochemical Effects of Guanidinium Thiocyanate on Dye-Sensitized Solar Cell Performance and Stability

In this study, we investigated the photoelectrochemical effect of guanidinium thiocyanate (GuSCN) in the base electrolyte composed of 1-methylbenzimidazole (0.45 M) and 3-methoxypropionitrile on th...

Pharmacological inhibition of ABCA1 degradation increases HDL biogenesis and exhibits antiatherogenesis

Expression of ABCA1 is regulated by transcription of the gene and calpain-mediated proteolytic degradation, and inhibition ABCA1 degradation results in increased ABCA1 and HDL biogenesis in vitro. We examined whether this approach could be a potential antiatherogenic treatment. Although probucol inhibits both the activity and degradation of ABCA1, its oxidized products, spiroquinone and diphenoquinone, reduce degradation of ABCA1 without inhibiting its activity or altering transcription of the ABCA1 gene. Accordingly, both compounds enhanced apolipoprotein A-I/ABCA1-dependent generation of HDL in vitro, and increased hepatic ABCA1 and plasma HDL without increasing antioxidant activity in plasma when given to rabbits. Both compounds also decreased vascular lipid deposition in cholesterol-fed rabbits. We therefore conclude that stabilization of ABCA1 against calpain-mediated degradation is a novel and potentially important strategy to increase HDL formation and prevent atherosclerosis. Spiroquinone and diphenoquinone are potential seeds for development of such drugs.