Growth Factor Binding Protein-3 Gene Research Articles

Identification and characterization of the putative retinoblastoma control element of the rat insulin-like growth factor binding protein-2 gene

The authors previously identified a silencer of the rat IGFBP-2 gene. Sequence examination of the silencer has revealed that it contains the target sequence for the pRb (retinoblastoma) tumour suppressor gene, referred to as the retinoblastoma control element (RCE) which is frequently found in the regulatory element of cellular oncogenes and growth factors. The presence of RCE suggests that the IGFBP-2 gene may be regulated by the pRb tumour suppressor gene. An in vitro gel retardation assay has shown that the putative RCEs from the IGFBP-2 gene are complexed with multiple nuclear factors from the rat liver BRL-3A cells. These DNA–protein complexes were not detected with the nuclear extracts from the cells that were growth arrested at the G1/S border of the cell cycle by high cell density. Using specific antibodies, Sp1 was shown to be one of the components for the multiple DNA–protein complex while pRb does not appear to be directly involved in the formation of the complex.

Dual regulation of insulin-like growth factor binding protein-1 levels by insulin and cortisol during fasting.

Insulin-like growth factor (IGF) binding protein-1 (IGFBP-1) gene transcription is known to be inhibited by insulin in vivo and in vitro. Levels of IGFBP-1 typically rise during fasting but also rise after acute hypoglycemia, including that induced by insulin, through an unknown mechanism that may involve counterregulatory hormones such as cortisol. To study the regulation of IGFBP-1 secretion during fasting, we measured IGFBP-1, insulin, cortisol, GH, and glucose during the course of standardized fasting studies in a total of 21 children. The fasting studies lasted 13-32 h and were terminated for a whole-blood glucose concentration of less than 50 mg/dL (2.8 mmol). Of the children studied, 9 children had no disorder, 8 had ketotic hypoglycemia, 2 had isolated GH deficiency, and 2 had fatty acid oxidation disorders. During fasting, IGFBP-1 rose above the mean baseline levels of 28+/-5 ng/mL to a mean level+/-SEM of 336+/-59 ng/mL at the time of hypoglycemia (P=0.001). IGFBP-1 was strongly associated with serum insulin and cortisol levels over the entire course of fasting (P < 0.0001)). The interaction of the 2 hormones across time was also strongly significant (P < 0.0001). There was no statistically significant association between IGFBP-1 and GH or glucose. At the time of hypoglycemia, insulin levels were suppressed to 1.7 microU/mL or less, and there was no correlation between IGFBP-1 levels at the end of fasting and final insulin level. In contrast, cortisol levels correlated with IGFBP-1 in the final hypoglycemic sample (r=0.56, P < 0.01). Partial correlation analysis revealed that the relationship between IGFBP-1 and cortisol was unchanged when the data was controlled for insulin levels. These data show that insulin and cortisol both regulate IGFBP-1 secretion during fasting; the effects of insulin and cortisol are strong during the course of fasting. Significant hypoglycemia stimulates a further rise in IGFBP-1, which seems to be regulated, in part, by cortisol. The cortisol-induced rise in IGFBP-1 during fasting and during hypoglycemia potentially serves to prevent the hypoglycemic effects of free IGFs.

Protein Kinase B/Akt Mediates Effects of Insulin on Hepatic Insulin-like Growth Factor-binding Protein-1 Gene Expression through a Conserved Insulin Response Sequence

Insulin regulates the expression of multiple hepatic genes through a conserved insulin response sequence (IRS) (CAAAAC/TAA) by an as yet undetermined mechanism. Protein kinase B/Akt (PKB/Akt), a member of the PKA/PKC serine/threonine kinase family, functions downstream from phosphatidylinositol 3'-kinase (PI3K) in mediating effects of insulin on glucose transport and glycogen synthesis. We asked whether PKB/Akt mediates sequence-specific effects of insulin on hepatic gene expression using the model of the insulin-like growth factor binding protein-1 (IGFBP-1) promoter. Insulin lowers IGFBP-1 mRNA levels, inhibits IGFBP-1 promoter activity, and activates PKB/Akt in HepG2 hepatoma cells through a PI3K-dependent, rapamycin-insensitive mechanism. Constitutively active PI3K and PKB/Akt are each sufficient to mediate effects of insulin on the IGFBP-1 promoter in a nonadditive fashion. Dominant negative K179 PKB/Akt disrupts the ability of insulin and PI3K to activate PKB/Akt and to inhibit promoter activity. The IGFBP-1 promoter contains two IRSs each of which is sufficient to mediate sequence-specific effects of insulin, PI3K, and PKB/Akt on promoter activity. Highly related IRSs from the phosphoenolpyruvate carboxykinase and apolipoprotein CIII genes also are effective in this setting. These results indicate that PKB/Akt functions downstream from PI3K in mediating sequence-specific effects of insulin on the expression of IGFBP-1 and perhaps multiple hepatic genes through a conserved IRS.

Hepatocyte nuclear factor 1 and the glucocorticoid receptor synergistically activate transcription of the rat insulin-like growth factor binding protein-1 gene.

The insulin-like growth factor (IGF) binding proteins (IGFBPs) are a family of proteins that bind IGF-I and IGF-II and modulate their biological activities. IGFBP-1 is distinctive among the IGFBPs in its rapid regulation in response to metabolic and hormonal changes. The synthetic glucocorticoid, dexamethasone, increases IGFBP-1 mRNA abundance and gene transcription in rat liver and in H4-II-E rat hepatoma cells. A glucocorticoid response element (GRE) located at nucleotide (nt) -91/-77 is required for dexamethasone to stimulate rat IGFBP-1 promoter activity in transient transfection assays in H4-II-E cells. In addition to the GRE, three accessory regulatory sites [a putative hepatocyte nuclear factor-1 (HNF-1) site (nt -62/-50), an insulin-response element (nt -108/-99), and an upstream site (nt -252/-236)] are involved in dexamethasone stimulation under some, but not all, circumstances. The present study begins to address the mechanism by which transcription factors bound to the putative HNF-1 site act synergistically with the glucocorticoid receptor (GR) bound to the GRE. In gel shift assays, HNF-1alpha and HNF-1beta in H4-II-E extracts bind to the palindromic HNF-1 site. Both half-sites are required. Overexpression of HNF-1beta enhances dexamethasone-stimulated promoter activity. Both the HNF-1 site and the GRE must be intact for stimulation to occur. By contrast, overexpression of HNF-1alpha does not enhance dexamethasone-stimulated promoter activity, although, as also observed with overexpression of HNF-1beta, it inhibits basal promoter activity. Thus, the synergistic effects of HNF-1beta and the GR on dexamethasone-stimulated promoter activity require that they are bound to the HNF-1 site and the GRE, respectively, and may involve protein-protein interactions between the transcription factors, or between them and the basal transcription machinery or a steroid receptor coactivator. Synergy between the ubiquitously expressed GR and HNF-1, which is developmentally regulated and expressed in a limited number of tissues, provides a possible mechanism for tissue- and development-specific regulation of glucocorticoid action.

Insulin-like Growth Factor Binding Protein Gene Expression in the Pregnant Rat Uterus and Placenta

While the insulin-like growth factor (IGF) system plays a fundamental role in regulating embryonic and placental growth, the specific contributions of the six IGF binding proteins (IGFBPs 1–6) to these processes are not well understood. We here focus on IGFBP expression in the extraembryonic environment, which both supports and constrains embryonic growth, and have usedin situhybridization to determine sites of IGFBP mRNA synthesis in the pregnant rat uterus and placenta. We find that all IGFBPs are expressed in distinct, changing patterns in the uterine endometrium, at the decidual boundary, in the decidual vasculature, and in the myometrium during pregnancy. Within the endometrium, the most prominent change is that expression of IGFBP-1 begins in some, but not all, endometrial glands prior to implantation and then expands to include all secretory epithelia shortly after implantation. During the period of rapid decidual proliferation that follows implantation, IGFBP-3, -4, and -5 transcripts are all detected in a laminar array at the boundary between the decidua and the nondecidualized endometrium. In the decidual vasculature at Day (d) 8.0, both IGFBP-3 and IGFBP-4 mRNAs are detected in dilating blood vessels, with BP-3 most prominent in the antimesometrial plexus and BP-4 primarily at the mesometrial pole. Later (d11.5), all decidual vessels express high levels of IGFBP-3 and lower levels of IGFBP-4 mRNAs. Finally, changes in expression of several IGFBPs also occur within the myometrium during pregnancy. For example, IGFBP-2 is expressed in the inner circular layer shortly after implantation, and expression increases through late gestation. In contrast, IGFBP-5 hybridization occurs over both myometrial layers before implantation, but decreases in intensity and spatial distribution as pregnancy proceeds. Finally, and most strikingly, IGFBP-6 expression, barely detectable in the d7.0 myometrium, gradually increases until it is very strongly transcribed during the placental stages. Taken together, these observations suggest multiple roles for IGFBPs in supporting implantation, regulating the extent of decidualization, modulating local levels of vascular IGFs, and regulating uterine muscular growth.

Identification of an Insulin-responsive Element in the Rat Insulin-like Growth Factor-binding Protein-3 Gene

The hepatic expression and serum levels of insulin-like growth factor-binding protein-3 (IGFBP-3) are decreased in insulin-dependent and insulin-resistant diabetes. Insulin increases hepatic IGFBP-3 expression by enhancing gene transcription. This report identifies sequences within the IGFBP-3 promoter that are necessary and sufficient for the response to insulin in hepatic nonparenchymal cells. By transient transfection, we mapped the insulin response element to the -1150 to -1124 base pair (bp) region of the rat IGFBP-3 promoter. Three tandem repeats of the -1150 to -1117 bp region conferred insulin responses in a heterologous promoter. Gel shift analyses revealed a 3-fold increase in DNA-protein complex formation with nuclear extracts obtained from insulin-stimulated nonparenchymal cells compared with cells incubated without insulin and revealed 3-4-fold decrease in complex formation with nuclear extracts obtained from the livers of streptozotocin-diabetic rats compared with control rats. Mutational analysis of this 34-bp region showed a core sequence of 10 bp (-1148 to -1139) that is critical for interaction with insulin-induced trans-acting factors. Southwestern blotting revealed a approximately 90-kDa protein that was increased 2-3-fold by the addition of insulin. Thus, we have identified cis-acting DNA sequences that are responsible for regulation of IGFBP-3 transcription by insulin and essential for binding of insulin-responsive nuclear factors.

Distal Sp3 binding sites in the hIGBP-1 gene promoter suppress transcriptional repression in decidualized human endometrial stromal cells: identification of a novel Sp3 form in decidual cells.

The purpose of this study was to identify the nuclear components that account for a dramatic transcriptional induction of the human insulin-like growth factor binding protein-1 (IGFBP-1) gene in decidualized human endometrial stromal cells. The study focused on the functional analysis and binding characteristics of the two distal promoter regions, 132 bp -2.732 to -2.6 kb [C/al/Xbal, (CX) fragment] and 30 bp [-2830 to -2800 bp, Hincll/ Sphl [HS] fragment]. In the primary culture of endometrial stromal cells, we have examined the three cis-elements, I, II and III, in the 58-bp BsaHl/ Rsal (BR) fragment (a promoter fragment that resides in CX) previously identified in HEC-1B cells. When pBRPL (BR 5'-linked to -2600 to +68 bp IGFBP-1 promoter/chloramphenicol acetyl transferase gene) was transfected into cells, only cis-element II (-2660 to -2638 bp) mediated the activation, whereas I and III (-2675 to -2666 bp and -2637 to -2628 bp) were inactive in both unstimulated and hormone-stimulated endometrial stromal cells. Promoter activity derived from pCXPL was repressed in unstimulated cells. During decidualization of endometrial stromal cells, the repression was gradually diminished, which was mediated by cis-element I and III. The binding pattern of the BR fragment analyzed by electrophoretic mobility shift assay using nuclear extracts of decidual tissue or cells showed three major specific binding complexes, C1, C2, and C3, which were abolished by a complementary oligonucleotide of the Sp1-binding motif dose-dependently. Only two complexes, C2 and C3, were formed by nuclear extracts of unstimulated stromal cells. A binding study with mutated BR fragment showed that the binding sites of C1, C2, and C3 resided at cis-elements I and III. The Sp3 antibody abolished complexes C1, C2, and C3. The Sp1 and Sp4 antibodies, however, had little effect. The other distal promoter region, 30-bp HS fragment, which contains a core sequence homologous to the Sp1-binding motif, formed a complex with mobility similar to C1. It is transcriptionally active only in decidualized stromal cells. The binding protein of this complex recognized the Sp3 antibody. Immunoblot analysis of the nuclear extracts of stromal and decidual cells showed that Sp3 antibody identified 120-, 82-, and 80-kDa Sp3 proteins. An additional 28-kDa Sp3 protein was present only in the extract of decidual cells. These findings suggest that decidual Sp3 protein may be responsible, at least in part, for the transcriptional regulation in decidualized endometrial stromal cells.

Promoter-dependent and -independent Activation of Insulin-like Growth Factor Binding Protein-5 Gene Expression by Prostaglandin E2 in Primary Rat Osteoblasts

Insulin-like growth factor (IGF) action is mediated by high affinity cell surface IGF receptors and modulated by a family of secreted IGF binding proteins (IGFBPs). IGFBP-5, the most conserved of six IGFBPs characterized to date, uniquely potentiates the anabolic actions of IGF-I for skeletal cells. In osteoblasts, IGFBP-5 production is stimulated by prostaglandin E2 (PGE2), a local factor that mediates certain effects induced by parathyroid hormone, cytokines such as interleukin-1 and transforming growth factor-beta, and mechanical strain. In this study, we show that transcriptional and post-transcriptional events initiated by PGE2 collaborate to enhance IGFBP-5 gene expression in primary fetal rat osteoblast cultures. PGE2 treatment stimulated up to a 7-fold rise in steady-state levels of IGFBP-5 mRNA throughout 32 h of incubation. Analysis of nascent IGFBP-5 mRNA suggested that PGE2 had only a modest stimulatory effect on IGFBP-5 gene transcription, and transient transfection studies with IGFBP-5 promoter-reporter genes confirmed that PGE2 enhanced promoter activity by approximately 2-fold. Similar stimulatory effects were seen with forskolin. A DNA fragment with only 51 base pairs of the 5'-flanking sequence retained hormonal responsiveness, which may be mediated by a binding site for transcription factor AP-2 located at positions -44 to -36 in the proximal IGFBP-5 promoter. Incubation of osteoblasts with the mRNA transcriptional inhibitor 5,6-dichloro-1-beta-D-ribofuranosylbenzimidazole demonstrated that PGE2 enhanced IGFBP-5 mRNA stability by 2-fold, increasing the t1/2 from 9 to 18 h. The effects of PGE2 on steady-state IGFBP-5 transcripts were abrogated by preincubating cells with cycloheximide, indicating that the effects of PGE2 on both gene transcription and mRNA stability required ongoing protein synthesis. Therefore, both promoter-dependent and -independent pathways converge to enhance IGFBP-5 gene expression in response to PGE2 in osteoblasts.

Activation of human insulin-like growth factor binding protein-1 gene promoter by a distal regulatory sequence in a human endometrial adenocarcinoma cell line

Activation of human insulin-like growth factor binding protein-1 gene promoter by a distal regulatory sequence in a human endometrial adenocarcinoma cell line

Activation of human insulin-like growth factor binding protein-1 gene promoter by a distal regulatory sequence in a human endometrial adenocarcinoma cell line.

Insulin-like growth factor-binding protein-1 (IG-FBP-1) is the major secretory protein of decidualized human endometrium. To understand IGFBP-1 gene regulation in human endometrium, we studied the IGFBP-1 gene promoter activity in human endometrial adenocarcinoma cell line HEC-1B. Previously, we have reported that a 105-base pair (bp) ClaI/RsaI fragment, from -2732 to -2628, of IGFBP-1 promoter enhances promoter activity by 10-fold in HEC-1B cells. In this study we have characterized the activation of IGFBP-1 promoter by this distal regulatory sequence. Transient transfection assays with deletion constructs demonstrated that the activating cis-elements were located in a 59-bp fragment, from -2686 to -2628, which enhanced promoter activity 50-fold. Transient transfections and gel mobility shift assays with oligo-directed mutants revealed three cis-elements within this 59-bp region: I) ATGGGTGGGA (-2675 to -2666), II) GCTGAGCAAGTGCACAACTATCC (-2660 to -2638), and III) AGGGCGGAGT (-2637 to -2628). In nuclear extracts of HEC-1B cells, at least two proteins bound to cis-element III, one of which was transcription factor Sp1 since antibody against Sp1 caused a supershift in a gel mobility shift assay. A protein with a molecular mass of approximately 100 kilodaltons bound to cis-element I as revealed by Southwestern blotting. An unidentified protein bound to cis-element II. Mutations in cis-element I, II, and III reduced promoter activity by 37%, 86%, and 88%, respectively, indicating that there was a synergistic function among these three cis-elements.(ABSTRACT TRUNCATED AT 250 WORDS)

Interleukin-1 induces insulin-like growth factor binding protein-3 gene expression and protein production by Leydig cells

Interleukin-1 (IL-1) is a potent inhibitor of Leydig cell function. IL-1 blocks human CG-induced cAMP and testosterone formation, as well as cytochrome P450 side-chain cleavage messenger RNA (mRNA) expression. IL-1 also decreases insulin-like growth factor-I (IGF-I) mRNA levels in Leydig cells. The effects of IGF-I are modified by IGF binding proteins (IGFBPs). In the present study, we evaluated the effects of IL-1 on IGFBP expression. Purified Leydig cells from adult rats were cultured with 0.1% heat-inactivated fetal bovine serum in Dulbecco's modified Eagles' medium/F12. Culture medium was changed to serum-free Dulbecco's modified Eagles' medium/F12 after 24 h and IL-1 beta (0.1-10 ng/ml) was added. Treatment of Leydig cells with IL-1 beta (10 ng/ml) for 2, 4, and 6 h resulted in a progressive induction of IGFBP-3 expression without affecting IGFBP-2 or IGFBP-4 mRNA levels. IL-1 beta in concentrations of 0.1, 1, and 10 ng/ml caused a 1.5-, 4-, and 6.5-fold induction of IGFBP-3 expression, respectively, whereas IGF-I mRNA levels were decreased in a dose-dependent manner. IL-1 beta increased the average transcription rate of IGFBP-3 by 3.3-fold. The t1/2 for IGFBP-3 mRNA was 2.07 h and was not affected by the treatment with IL-1 beta (2.21 h). The immunoblot of cell-conditioned media showed that the basal level of IGFBP-3 protein was low and IL-1 beta caused a dose-dependent increase in the production of IGFBP-3. These results indicate that IL-1 beta increases IGFBP-3 levels by increasing the rate of transcription rather than by changing the stability of IGFBP-3 mRNA. The addition of cycloheximide markedly inhibited IL-1 beta-induced IGFBP-3 mRNA levels. However, IL-1 beta was able to induce IGFBP-3 mRNA levels even in the presence of cycloheximide. This suggests that de novo protein synthesis may not be required for induction of IGFBP-3 mRNA by IL-1 beta. In conclusion, IL-1 beta inhibits IGF-I but increases IGFBP-3 expression in Leydig cells, and this may contribute to the inhibitory effects of IL-1 beta on Leydig cell steroidogenesis.

Interleukin-1 induces insulin-like growth factor binding protein-3 gene expression and protein production by Leydig cells.

Interleukin-1 (IL-1) is a potent inhibitor of Leydig cell function. IL-1 blocks human CG-induced cAMP and testosterone formation, as well as cytochrome P450 side-chain cleavage messenger RNA (mRNA) expression. IL-1 also decreases insulin-like growth factor-I (IGF-I) mRNA levels in Leydig cells. The effects of IGF-I are modified by IGF binding proteins (IGFBPs). In the present study, we evaluated the effects of IL-1 on IGFBP expression. Purified Leydig cells from adult rats were cultured with 0.1% heat-inactivated fetal bovine serum in Dulbecco's modified Eagles' medium/F12. Culture medium was changed to serum-free Dulbecco's modified Eagles' medium/F12 after 24 h and IL-1 beta (0.1-10 ng/ml) was added. Treatment of Leydig cells with IL-1 beta (10 ng/ml) for 2, 4, and 6 h resulted in a progressive induction of IGFBP-3 expression without affecting IGFBP-2 or IGFBP-4 mRNA levels. IL-1 beta in concentrations of 0.1, 1, and 10 ng/ml caused a 1.5-, 4-, and 6.5-fold induction of IGFBP-3 expression, respectively, whereas IGF-I mRNA levels were decreased in a dose-dependent manner. IL-1 beta increased the average transcription rate of IGFBP-3 by 3.3-fold. The t1/2 for IGFBP-3 mRNA was 2.07 h and was not affected by the treatment with IL-1 beta (2.21 h). The immunoblot of cell-conditioned media showed that the basal level of IGFBP-3 protein was low and IL-1 beta caused a dose-dependent increase in the production of IGFBP-3. These results indicate that IL-1 beta increases IGFBP-3 levels by increasing the rate of transcription rather than by changing the stability of IGFBP-3 mRNA. The addition of cycloheximide markedly inhibited IL-1 beta-induced IGFBP-3 mRNA levels. However, IL-1 beta was able to induce IGFBP-3 mRNA levels even in the presence of cycloheximide. This suggests that de novo protein synthesis may not be required for induction of IGFBP-3 mRNA by IL-1 beta. In conclusion, IL-1 beta inhibits IGF-I but increases IGFBP-3 expression in Leydig cells, and this may contribute to the inhibitory effects of IL-1 beta on Leydig cell steroidogenesis.

Rapid activation of insulin-like growth factor binding protein-5 gene transcription during myoblast differentiation.

Insulin-like growth factor binding proteins (IGFBPs) comprise a family of secreted proteins that bind insulin-like growth factors-I and -II (IGF-I and -II) with high affinity and potentially modulate their biological effects. We have demonstrated previously that IGFBP-5, the most conserved of the six known IGFBPs, is expressed in muscle cells in the developing embryo and during the terminal differentiation of several myogenic cell lines. In this study we show that an IGF-I analog that binds minimally to IGFBPs potently enhances the differentiation of the stringently controlled inducible C2 myoblast (C2l) cell line and identify IGFBP-5 as the sole IGFBP secreted during C2l differentiation. We find that induction of IGFBP-5 mRNA and protein is coincident with the onset of myogenin gene expression and occurs secondary to the rapid activation of IGFBP-5 gene transcription. By transient gene transfer experiments we demonstrate that a 1004 base pair segment of the IGFBP-5 promoter is very active in directing expression of the reporter gene luciferase in C2l myoblasts. A promoter fragment containing only 156 nucleotides of 5'-flanking DNA retained more than 70% of maximal activity and mediated at least part of the differentiation-dependent rise in IGFBP-5 gene transcription. Within this active segment are several potential binding sites for muscle-enriched transcription factors. Our results show that induction of IGFBP-5 expression is an early event in the myogenic differentiation of the C2l cell line and suggest that one function of this IGFBP is to modulate IGF-induced differentiation. C2l cells are thus an excellent in vitro model for elucidating the developmental factors that control IGFBP-5 gene transcription and action in skeletal muscle.

Rapid activation of insulin-like growth factor binding protein-5 gene transcription during myoblast differentiation

Rapid activation of insulin-like growth factor binding protein-5 gene transcription during myoblast differentiation

Cloning and characterization of the promoter for the rat insulin-like growth factor-binding protein-3 gene.

Insulin-like growth factor-binding protein-3 (IGFBP-3), the major IGFBP in the adult circulation, is produced by a wide range of cell and tissue types. IGFBP-3 appears to be regulated by transcriptional and/or posttranslational mechanisms in a species-, cell-, and development-specific manner. In vitro and in vivo studies suggest that a number of factors (e.g. cAMP, GH, insulin-like growth factor-I, epidermal growth factor, TSH, and FSH) can act as transcriptional regulators of IGFBP-3 in particular cell types. To address the mechanistic basis for these observations, we isolated the rat IGFBP-3 gene and began characterization and analysis of the hormonal regulation of its promoter. The rat IGFBP-3 gene is located within 2 adjacent EcoRI fragments spanning about 10 kilobases. Southern analysis indicated a single copy gene. A 1.18-kilobase fragment 5' to the translation initiation codon has been sequenced and showed 65% homology with the corresponding human IGFBP-3 sequence. The region between -100 and -1 bp relative to the transcription start site showed 85% homology. The transcription start site was 118 basepairs (bp) up-stream of the initiation codon, and a TATA box consensus was located 27 bp 5' to this CAP site. No CAAT box was present, but a CpG island was identified. Consensus sequences for a number of putative response elements (e.g. activating protein-2, insulin, TSH/insulin-like growth factor, and GH) were present within -700 bp of the CAP site. A series of 5'-truncated chloramphenicol acetyltransferase reporter constructs has been transfected into both COS-1 cells and the rat thyroid cell line FRTL-5. Both basal and hormonally responsive (TSH and phorbol ester) promoter activities have been localized within the first 472 bases of the promoter region. These data indicate that suitable transfected cell systems can be established in which additional investigations can be undertaken into the mechanisms of cell- and species-specific hormonal regulation of IGFBP-3 gene expression.

Cloning and characterization of the promoter for the rat insulin-like growth factor-binding protein-3 gene

Cloning and characterization of the promoter for the rat insulin-like growth factor-binding protein-3 gene

Dexamethasone stimulation of rat insulin-like growth factor binding protein-1 (IGFBP-1) promoter activity involves the interaction of multiple transcription factors

Using an improved procedure for transient transfection of H4-II-E rat hepatoma cells, we characterized the cis elements in the proximal promoter of the rat insulin-like growth factor binding protein-1 (rat IGFBP-1) gene that are required for basal (unstimulated) and dexamethasone-stimulated promoter activity. Three sites are required for optimal basal promoter activity: an AP-2 site (nt −286 to −293), the M4 region of the insulin response element (nt −108 to −99), and a hepatocyte nuclear factor-1 (HNF-1) site (nt −62 to −50). In addition to the glucocorticoid response element (nt −91 to −77), participation of two of three accessory sites is required for optimal stimulation by dexamethasone: the M4 and HNF-1 sites, and a third site located between nt −252 and −236. Further study will focus on how the interactions of tissue-specific and hormonally-responsive transcription factors are integrated.

Multiple proteins bind the insulin response element in the human IGFBP-1 promoter

An insulin response element (IRE) has been identified ∼100 base pairs (bp) 5′ to the transcription start site of the human insulin-like growth factor binding protein-1 (hIGFBP-1) gene. This cis element appears crucial to the multihormonal regulation of hIGFBP-1 expression in liver, since (i) an intact IRE is required for maximal stimulation of hIGFBP-1 promoter activity by dexamethasone, and (ii) the IRE confers activity. Further progress in understanding how the IRE confers insulin and glucocorticoid effects requires identification of transcription factors confering effects of these hormones. D-site binding protein (DBP), and members of the hepatic nuclear factor 3 (HNF 3) and high mobility group I/Y (HMG I/Y) protein families, each known to bind DNA elements similar in sequence to the IRE, were tested for IRE binding. DBP, HMGI and HNF 3β each protected the hIGFBP-1 IRE from DN AseI digestion. Additional studies are required to establish whether binding of any of these proteins to the IRE is important to the regulation of hIGFBP-1 expression by insulin and/or glucocorticoids.

Activation of the human IGFBP-1 gene promoter by progestin and relaxin in primary culture of human endometrial stromal cells

We have studied the activity for the insulin-like growth factor binding protein-1 (IGFBP-1) gene promoter in human endometrial stromal cells by transient transfection. The promoter activity derived from p3.6CAT or p3.6Luc (3400 bp IGFBP-1 promoter 5' to the reporter gene chloramphenicol acetyltransferase or luciferase) was minimal in unstimulated cells. A time study over 13 days of culture showed that the promoter activity increased exponentially to >10 4 fold in cells treated with medroxyprogesterone acetate (MPA) and relaxin (RLX). Induction of the IGFBP-1 gene promoter activity by hormones was similar to the secretion pattern of IGFBP-1 in endometrial stromal cells. MPA alone caused a moderate induction, 3–40-fold increase over the control. Deletion analysis showed that two regions in the IGFBP-1 gene promoter were responsible for the activation of the IGFBP-1 gene. The basal promoter region, termed bpl-A (+68 bp to -1.205 kb), contains multiple sections of regulatory sequence including a cis-element CCAAT (-72 bp). A DNase I protection assay in the bp-1 A region revealed four distinct binding regions, one of which contained the CCAAT ☐ region. Another promoter region, termed bpl-B (-2.6 to -3.4kb), mediated 95% of the total promoter activity in endometrial stromal cells. The bpl-B region also contains multiple regulatory sequences. Mutation and DNase I protection assay suggest that Spl-like binding site at -2.63 kb was a regulatory site responsible for the activation of IGFBP-1 gene promoter.

Identification of a distal regulatory sequence of the human IGFBP-1 gene promoter and regulation by the progesterone receptor in a human endometrial adenocarcinoma cell line.

The activity of the insulin-like growth factor binding protein-1 (IGFBP-1) gene promoter was studied in the human endometrial adenocarcinoma cell line HEC-1B. Basal promoter activity was directed by the region +68 to -207 bp, similar to observations in the hepatoma HepG2 cell line. A distal regulatory sequence approximately -2.6 kb from the transcription initiation site strongly enhanced the activity of the IGFBP-1 gene promoter in HEC-1B cells, but not in HepG2 cells. Sequence analysis revealed that this active region resides in 105 bp between -2,628 to -2,732 bp (the Rsa I-Cla I fragment). This region contains many putative active motifs homologous to known cis elements. Additional deletion and mutation in the Rsa I-Cla I fragment showed that the activity was confined to a 58-bp DNA fragment. In cells treated with progestin and co-transfected with progesterone receptor vector hPR1, the CAT activity derived from constructs containing the Rsa I-Cla I fragment was reduced in a dose-dependent manner. The active DNA fragment also stimulated the activity of the heterologous TK/CAT promoter in HEC-1B cells, while the PR complex inhibited this activity by 50%. These observations indicate that most of the regulation of the IGFBP-1 gene in HEC-1B cells is derived from the distal promoter region confined to the Rsa I-Cla I fragment and that the same region mediates an inhibitory effect from the progesterone receptor.