Groups In Ethiopia Research Articles

Susanne Epple, ed., The state of status groups in Ethiopia: Minorities between marginalization and integration

Review

Factors Affecting the Household Saving Participations on ‘Equb’: A Study on the Three Major Towns of Wolaita Zone, Southern Ethiopia

Equb is a form of traditional cooperative or traditional self-help group in Ethiopia. Equb is a financial form of traditional cooperative formed voluntarily. It is a rotating saving and credit type association whose members make regular contributions to a revolving loan fund. This research study is aimed at examining factors affecting household participation on Equb, conducted on three major towns of Wolaita Zone i.e. Sodo, Boditi and Areka towns. The sample size is determined by using Taro Yemane’s simplified formula from the total household of 61499, sample size of 283. A causal cross sectional survey was conducted among all the household participants. The primary data was collected through structured questionnaire and selected by using systematic random sampling among households dwelling in Areka, Boditi and Sodo town. The data was analyzed by using STATA and both descriptive and inferential statistics were used. The multiple linear regression model was employed with household participation in Equb as the dependent variable. Th findings of the study shown that factors such as income, economic, social and psychological is significantly affecting the saving habit of urban households. In this case it is recommended that financial institutions, government and other stakeholders should support and work on awareness creation for those sectors. Keywords: Equb, Household, Participants, Savings, traditional cooperatives DOI : 10.7176/JPID/48-01

Factors influencing the practice of modern family planning methods among married women in Ethiopia: evidence from the2005 Ethiopian Demographic and Health Survey

AbstractBackground: Ethiopia is characterized by high fertility rate even when compared with many Sub- Saharan Africancountries. The practice of modern family planning (FP) methods is also low. Thus, exploring factors that determine thepractice of modern FP methods is vital in order to come up with strategies that alleviate the consequences of unmet need forFP.Objective: The objective of this study was to examine and determine factors that predict the practice of modern FP amongmarried women of reproductive age group in Ethiopia and illustrate aspects of data limitations and efforts on how to applymethods in providing estimations about selected determinants of contraceptive use.Method: The 2005 Ethiopian Demographic and Health Survey (EDHS) was the source of data. The survey had collectedreproductive health related data on 9066 married women. Univariate analysis was employed to identify the associationbetween the independent explanatory variables and the practice of modern FP methods; and multivariate logistic regressionanalysis was employed in predicting which factors determined contraceptive practice.Results: Univariate analysis of the independent explanatory variables including age of women, place of residence, number ofliving children, education and wealth index were found to be statistically significantly associated with the practice of modernFP methods. Multivariate logistic regression analysis has shown that place of residence, education level and wealth index tobe potential predictors of the practice of modern FP methods.Conclusion: Differences in fertility level and the practice of modern FP methods reflect differences in socio-economic statusand place of residence (Ethiopian Journal of Reproductive Health, 2012; 6(1): 4-13).Key words: family planning, modern methods, married women, practices, Ethiopia

Land rights and land grabbing in Oromia, Ethiopia

The land is not only a vital livelihood asset but also indispensable for the enjoyment of several human rights including the right to life, the right to food, the right to housing, the right to property, the right to development, and the right to self-determination. However, smallholder farmers and pastoralists do not have an adequate legislative protection as laws and practices facilitate arbitrary expropriations and land grabbing, which induce an economic marginalisation of most ethnic groups in Ethiopia. The Imperial regime (1930–1974) had imposed an oppressive land tenure system on the Oromo and other peoples of Ethiopia until the Derg regime (1974–1991) had introduced a public land tenure system. Land laws currently in force also do not sufficiently protect rights of rural land users. The Ethiopian Constitution of 1995 restricts the legislative power of the regional States on the utilisation of land and other natural resources and it excludes a right of economic self-determination of ethnic groups. Forced evictions occur based on flawed expropriation laws, which do not entitle farmers and pastoralists to a right to just compensation. In addition, the government of Ethiopia promotes urbanisation and private investments at the expense of the poor and vulnerable smallholders. This paper examines the Ethiopia’s law and practice pertinent to land rights with a particular emphasis on the Oromia Regional State. It explores seven ways in which the law and the practice legalise and institutionalise dispossession and economic marginalisation of the poor without a sufficient due process of law.

An ancestral human genetic variant linked to an ancient disease: A novel association of FMO2 polymorphisms with tuberculosis (TB) in Ethiopian populations provides new insight into the differential ethno-geographic distribution of FMO2*1.

The human FMO2 (flavin-containing monooxygenase 2) gene has been shown to be involved in innate immunity against microbial infections, including tuberculosis (TB), via the modulation of oxidative stress levels. It has also been found to possess a curious loss-of-function mutation (FMO2*1/FMO2*2) that demonstrates a distinctive differentiation in expression, function and ethno-geographic distribution. However, despite evidences of ethnic-specific genetic associations in the inflammatory profile of TB, no studies were done to investigate whether these patterns of variations correlate with evidences for the involvement of FMO2 in antimicrobial immune responses and ethnic differences in the distribution of FMO2 polymorphisms except for some pharmacogenetic data that suggest a potentially deleterious role for the functional variant (FMO2*1). This genetic epidemiological study was designed to investigate whether there is an association between FMO2 polymorphisms and TB, an ancient malady that remains a modern global health concern, in a sub-Saharan Africa setting where there is not only a relatively high co-prevalence of the disease and the ancestral FMO2*1 variant but also where both Mycobcaterium and Homo sapiens are considered to have originated and co-evolved. Blood samples and TB related clinical data were collected from ascertained TB cases and unrelated household controls (n = 292) from 3 different ethnic groups in Ethiopia. Latent Mtb infection was determined using Quantiferon to develop reliable TB progression phenotypes. We sequenced exonic regions of FMO2.We identified for the first time an association between FMO2 and TB both at the SNP and haplotype level. Two novel SNPs achieved a study-wide significance [chr1:171181877(A), p = 3.15E-07, OR = 4.644 and chr1:171165749(T), p = 3.32E-06, OR = 6.825] while multiple SNPs (22) showed nominal signals. The pattern of association suggested a protective effect of FMO2 against both active and latent TB with distinct genetic variants underlying the TB-progression pathway. The results were robust for population stratification. Haplotype-based tests confirmed the SNP-based results with a single haplotype bearing the ancestral-and-functional FMO2*1 "C" allele ("AGCTCTACAATCCCCTCGTTGCGC") explaining the overall association (haplotype-specific-p = 0.000103). Strikingly, not only was FMO2*1 nominally associated with reduced risk to "Active TB" (p = 0.0118, OR = 0.496) but it also does not co-segregate with the 5'-3' flanking top high-TB-risk alleles. The study provides an evidence for the existence of an evolutionary adaptation to an ancient disease based on an ancestral genetic variant acting in a haplotypic framework in Ethiopian populations.

English

The study investigated the practice of ethnic federal system along with ethnic rights to self-determination and associated conflicts in the context of Southern Regional state of Ethiopia. This study is a qualitative research that employed both primary and secondary sources. The federal system is based on the constitutional conviction that ethnic groups in Ethiopia have the right to self-determination up to secession. By using ethnicity as an instrument to establish the constituent units, ethnic entitlement and political representations, the federal system has uniquely formalized politics of ethnicity in Ethiopia. Practically, the federal system in Ethiopia faces anomalous asymmetries both within the four ethno-parties that formed the Ruling party and constituent units. Despite rhetorically committing to multi–party politics and democracy, the political regime in power is markedly intolerant of political pluralism. The ‘making and remaking’ of the regions and local ethnic political parties in Southern Ethiopia has led to conglomeration of 56 ethnic groups into a single region. Instead of ethnic right to self-determination in accordance with the constitutional principles, the ruling party has gradually put efforts into administrative integration of diverse ethnic groups. This is one of the underlying causes for ethnic autonomy conflicts in the region. It is time for the ruling party to accept the consequences of the constitutional choices, to protect the constitutionally declared principle of federalism, to respect ethnic right to self–governance in Ethiopia beyond ideological and political motives. Key words: Ethnic federal system, the right to self-determination, making and remaking, ethnic autonomy conflicts, southern regional state and party politics.

Intellectual Genocide in the making?: The Strong and Pervasive Evidence of Ethnic Inequalities in Ethiopia

Ethnic inequalities in all sectors of life in Ethiopia have increasingly become serious and pervasive. Access to higher education (including scholarship grants) and most sought after disciplines appear to be disproportionally distributed along the multitude of ethnic groups in the country. In this paper I argue that intellectual genocide is in the making in three different forms: (1) systematic discrimination against certain groups with regard to educational opportunities, higher education, and scholarship grants; (2) brain drain — the movement of intellectuals and young skilled Ethiopians that has increased under the Tigrean People’s Liberation Fronts (TPLF) regime. Some observers say that Ethiopia has become a substantial net exporter of academic talent, a so-called brain drain; (3) cultural genocide, the action of the system which has the aim or effect of dispossessing the people of their lands, territories or resources, cultural values, language, and historical/religious relics and heritages. The philosophical foundation/methodology that undergirds this study is critical theory with elements of poststructuralism and post colonialism. The strategies used to collate and collect data is meta-analysis (data synthesis), some form of discourse analysis, personal accounts, and a limited amount of sociological introspection. There are a number of reasons or mechanisms that lead from ethnicity to violence. My evidence shows that there are already some patterns and discourses that might precipitate or crystallize the mechanisms in Ethiopia. The study shows that it is high time to stop the madness and redress the chronic and pervasive disparities within and between groups. It is an imperative that we focus on our similarities and common destiny. “The fight is never about grapes or lettuce. It is always about people.” It is about Ethiopian people. It is just unacceptable to seek self-aggrandizement for ourselves—or for our specific ethnic group, and increase power and influence to draw attention to own importance—and forget about progress and prosperity for the multitudes of ethnic groups in Ethiopia. Our ambitions must be broad enough to include the aspirations and needs of others, for their sakes and for our own.

Prevalence of Pregnancy Termination and Its Associated Factors Among Women of Reproductive Age Group in Ethiopia Using 2011 Ethiopian Demography and Health Survey, 2016

Background: Worldwide 20 million unsafe abortions took place each year as a result of unintended pregnancies, with 95% of these performed in developing countries. Ethiopia ranks fifth in the number of maternal deaths in the world and about two third of these deaths are due to unsafe abortions. The aim of this study was to determine the prevalence of pregnancy termination and associated factors among women of reproductive age group in Ethiopia using 2011 Ethiopian Demography and Health Survey. Methods: A secondary data was used to determine the prevalence of pregnancy termination and associated factors among women of reproductive age group in Ethiopia. Women in the age group of 15-49 years who had terminated pregnancy five years preceding the survey were included. The data were cleaned, coded and analyzed using Stata version 12. Multiple logistic regressions were used to identify factors associated with termination of pregnancy. Presence of confounders and interaction effects was investigated by computing relative changes on ß coefficients at a cutoff point 15%. Results: The prevalence of termination of pregnancy was 9% among reproductive age group women in Ethiopia. Maternal media exposure (AOR=1.24, 95% CI: 1.06, 1.43), age of women (AOR=3.05, 95% CI: 2.36, 4.05), contraceptive non-user (AOR=1.43, 95% CI: 1.22, 1.67) and occupational status of the husband (AOR=1.77, 95% CI: 1.29, 2.42) were positively associated factors with termination of pregnancy. Conclusion: Considerable proportion of women practiced termination of pregnancy. Maternal mass media exposure, contraceptive use, women occupation, marital status, age of women and husband occupation were the main factors for pregnancy termination. Emphasis needs to be given on access to family planning, mass media exposure, health education on consequences of early marriage and creating job opportunities.

Reproductive Health Service Utilization and Associated Factors Among Female Adolescents in Kachabirra District, South Ethiopia: A Community Based Cross Sectional Study

<i>Background:</i> Adolescent girls are at the highest risk of maternal mortality compared to women in their twenties. Reproductive health service utilization among adolescent females is lower when compared with other age groups in Ethiopia. <i>Objectives:</i> The study was aimed to assess the reproductive health service utilization and associated factors among female adolescents of kachabirra district. <i>Methods:</i> Community based cross sectional study was conducted in Kachebirra district. A total of 844 female adolescents participated from 8 randomly selected kebeles (the smallest administrative unit). A pretested structured interview was used. Bivariate and multivariate logistic regression analysis was carried out to assess the association. Statistical significance was declared by 95% confidence interval of odds ratio. <i>Results </i> 812 female adolescents with response rate of 96.2% participated in the study. In this study, 383 (47.2%, 95% CI: 43.7-50.6%) of the female adolescents utilized the reproductive health services. Female adolescent reproductive health service utilization was significantly associated with; living with both parents (AOR=9.63, 95% CI: 1.237-74.983), age 15-19 years (AOR=3.295, 95% CI: 1.411-7.696), excellent attitudes of health providers (AOR=3.816, 95% CI: 1.561-9.324) and adequate consultation time (AOR=2.450, 95% CI: 1.178-5.094). <i>Conclusions:</i> There is low level of female adolescent reproductive health service utilization. Age, living arrangement, attitude of reproductive health service providers and consultation time in the nearby health facilities were significantly associated with female adolescent reproductive health service utilization.

FOLKLORE: AN INSTRUMENT OF CONFLICT PREVENTION, TRANSFORMATION AND RESOLUTION IN THE ETHIOPIAN CONTEXT

The article assesses the role of folklore in the form of verbal, ritual and material objects as a means of customary dispute prevention, transformation and resolution in selected ethnic groups in Ethiopia. Samples of oral narratives in the form of proverbs, myths and legends from the Amhara, Tigray, Oromo and Issa linguistic groups are found to have cohesive functions that reiterate harmony among the respective communities and individuals prior to conflicts; conciliatory and mediatory functions during inter-ethnic and intra-ethnic or personal conflicts; and lastly, compensatory functions after conflicts. The familiarity of the content in the narratives and the beauty of the language of the mediators, usually the elders, transform the state of enmity into the state of tolerance and recompense. The pre-reconciliation, reconciliation and post-reconciliation rituals usually accompanied by animal sacrifice, as well as the venues of the rituals (usually river banks and under trees), create a local colour that foreground a feeling of exoneration, absolution, communalism as well as commitment to discontinue blood feuds. The material objects mostly used during the reconciliation rituals, such as Tabots, crosses and other relics of the Orthodox Church, Kalacha, boku, Chachu, Siniqee and Hanfala of the Oromo have a frightening effect on the people who want to redress damages by force. The widest usage of folkloric elements for conflict prevention, resolution and transformation is found to have a consoling and therapeutic effect on the material and psychological dimensions of conflict. On the other hand, it is suggested that concerned bodies should preserve and make use of such rich folkloric heritage that conform with the constitution of the country and international human right conventions.

Social determinants of HIV infection, hotspot areas and subpopulation groups in Ethiopia: evidence from the National Demographic and Health Survey in 2011

ObjectiveThis study identifies social determinants of HIV infection, hotspot areas and subpopulation groups in Ethiopia.DesignThe study used data from the 2011 Ethiopian Demographic and Health Survey (EDHS). Sample blood tests...

Rewriting Oromo History in the North: Diasporic Discourse about National Identity and Democracy in Ethiopia

This article analyzes the way the Oromo intellectuals living in diaspora have reflected on and positioned themselves in the ethno-political conflict and related debate between the dominant Amharic- and Tigrinya-speaking “Abyssinian” groups and the descendants of the various Oromo groups, which were conquered by the former during the nineteenth century. Even though they are the largest ethnic group in Ethiopia, a large part of the Oromo perceive themselves as discriminated against and exploited by the groups holding political power, and many have fled the country. In the debate, the Oromo diaspora has had an important role. Theoretically, the article takes off from the concept of “orientational frame” launched by Kevin Gillan, which is developed further with support from postcolonial theory, particularly Arjun Appadurai’s discussion about “ideoscapes.” A key research question is whether diaspora intellectuals are what Homi Bhabha calls “strategic intellectuals” who provide resources for postcolonial discourse and practice that surpass the traditional claims to representation and objectivity made by the dominant discourse. Can they come up with an alternative space that does not merely revise or invert the dualities, but reconsiders the ideological bases of division and difference? The article is based on twenty-two individual interviews with members of the Ethiopian diaspora in the Nordic countries and representatives of academic institutions and non-governmental organizations in Ethiopia, participant observation in three ethnic identity-based culture and history workshops organized in Europe, and selected research papers and books published by key members of the diaspora.

Ethnic Federalism: A Means for Managing or a Triggering Factor for Ethnic Conflicts in Ethiopia

Being one of the most diverse nations in the world, Ethiopia is not an exception to be free from ethnic conflicts due to its weak political structures and mal governance. The existing ethnic federal arrangement of EPRDF is devised with the aim to accommodate the interests of distinct ethnic groups in Ethiopia. Meanwhile, it is still subject to criticisms. Hence, this study questions whether the contemporary ethnic federalism in Ethiopia enables to manage ethnic conflicts or exacerbates them due to its theoretical and empirical applicability. The study is entirely based on secondary sources of data that were interpreted using a mix of interpretivism and constructivism to guide the qualitative method of research. The findings of the study revealed that ethnic federal model of Ethiopia, which solely or majorly formed on the basis of ethno-linguistic lines in most, but not all situations exacerbate and/or generate and transform ethnic conflicts from national into lower structural levels. Thus, a mixed federal system that guarantees ethnic groups self-governance with high inducements for integration and inter-ethnic collaboration is a suggestive solution to move federalism forward in Ethiopia.

Sexual Risk Behaviors and its Associated Factors among Undergraduate Students in Madda Walabu University, Southeast Ethiopia: A Facilitybased Cross Sectional Study

Background: Although the number of higher learning institutions increase in number and size in Ethiopia, the HIV risk perception and behaviors among undergraduate students have become an indispensible part of the national HIV prevention and control program. These undergraduate students are particularly vulnerable to HIV/AIDS due to their age group which constitutes the peak period for sexual activity, inclination towards sexual networking and consequent risk of HIV infection of African university students, this study was conducted to examine the sexual risk behaviors of this group in Ethiopia. Objective: To assess the prevalence of sexual risk behaviors and associated factors in undergraduate students, of Madda Walabu University. Methods: An Institution-based cross-sectional study design was conducted and a self-administered questionnaire was used to collect information on socio- demographic and sexual risk behavior characteristics among 634 randomly selected students in Madda Walabu University, Ethiopia in February, 2014. Data was checked for their completeness, entered in to Epi info data version 3.1, and export to SPSS version 21 for data analysis. Descriptive analysis was used to determine the prevalence. Multivariate logistic regressions models were used to derive adjusted odds ratios (OR) and 95% confidence interval (95% CI) and p-value of less than 0.05 considered as significant. The results were presented in a narrative forms, tables and graphs. Results: More than half 330 (54.6%); 95% CI (50.6 to 58.6) students reported, were involved in sexual risk behaviors. 4th year students were nearly nine times more likely as compared to first year students (AOR=9.5; 95% CI 2.5-36.3) and accepting to have premarital sex nearly two & half times more likely as compared to non-accepting premarital sex (AOR=2.58; 95% CI 1.26-5.27) were associated with having inconsistent condom use. And also a multiple logistic regression model examined, males respondents were nearly three times more likely as compared to females (AOR=2.80; 95% CI 1.35-5.80) and ever drunk alcohol three& half odd compared to abstainers (AOR=3.62; 95% CI 2.02-6.53) were associated with having multiple sexual partners. Conclusion: A significant segment of undergraduate students had some form of sexual risk behaviours including having multiple sexual partners and inconsistent condom use. The predominant factors that were associated with sexual risk behaviours includes; male sex, more study of year, drinking alcohol and accepting premarital sex. Madda Walabu University need to; design programs with comprehensive education on sexual and reproductive health (SRH) issues such as safer sex and HIV/AIDS through ; strengthen behavioural change communications (BCC) on risk perception; life skill training, peer-education, availing services and working with stalk holders, NGOs, and the surrounding community and youth friendly health service to facilitates accessibility of services such as usage of condom, and provide information related to SRH.

Anthropometric data of Bahirdar Citys adult men for clothing design

The aim of this study is to establish anthropometric data for garment industries in Bahir Dar City for the design and manufacturing of clothing. Date were collected from nine Bahir Dar City tailors’ adult men measurement for shirt and trouser making. Totally, about 350 and 1000 measurements were collected for shirt and for trouser. Data purging process has been carried out before using it for developing standards. Data collected were analysed using percentile base for the 5th, 50th, and 95thpercentile. Based on the percentile, standard sizes for the two products were developed. Size charts are also established for both products. Visible difference has been observed on standards when compared with Italy and USA standards for the same measurements. This proved that further studies should be conducted in all regions and ethnic groups in Ethiopia for clothing design and beyond for other applications. Key words: Anthropometry, clothing design, tailor, Bahir Dar, Ethiopia.

Horizontal inequalities in children’s educational outcomes in Ethiopia

We go beyond previous studies of vertical inequality in Ethiopia, by investigating ethnic group-based, or horizontal, educational inequality. Currently, there are no known studies of differential schooling patterns across cultural groups in Ethiopia. The research draws on the Young Lives prospective longitudinal study of 929 children in later childhood. We investigate the extent to which ethnic group differences in schooling participation and progression can be explained by individual differences in socio-economic status. The findings show that poor educational participation and progression remain challenges for certain minority ethnic groups. Household wealth helps to explain the effect of ethnicity on educational outcomes. However, it cannot fully account for the ethnic gap. We conclude that conventional research, which emphasizes addressing individual differences in educational outcomes, or vertical inequalities, may downplay the role of cultural group-based inequalities in children's opportunities to learn.

Who survived? Ethiopia's regulatory crackdown on foreign-funded NGOs

ABSTRACTHow do public regulations shape the composition and behavior of non-governmental organizations (NGOs)? Because many NGOs advocate liberal causes, such as human rights, democracy, and gender equality, they upset the political status quo. At the same time, a large number of NGOs operating in the Global South rely on international funding. This sometimes disconnects from local publics and leads to the proliferation of sham or ‘briefcase’ NGOs. Seeking to rein in the politically inconvenient NGO sector, governments exploit the role of international funding and make the case for restricting the influence of NGOs that serve as foreign agents. To pursue this objective, states worldwide are enacting laws to restrict NGOs’ access to foreign funding. We examine this regulatory offensive through an Ethiopian case study, where recent legislation prohibits foreign-funded NGOs from working on politically sensitive issues. We find that most briefcase NGOs and local human rights groups in Ethiopia have disappeared, while survivors have either ‘rebranded’ or switched their work from proscribed areas. This research note highlights how governments can and do shape the population ecology of the non-governmental sector. Because NGOs seek legitimacy via their claims of grassroots support, a reliance on external funding makes them politically vulnerable. Any study of the NGO sector must include governments as the key component of NGOs’ institutional environment.

Magnitude and Reasons for Harmful Traditional Practices among Children Less Than 5 Years of Age in Axum Town, North Ethiopia, 2013.

Background. In addition to beneficial traditional practices, there are around 140 harmful traditional practices affecting mothers and children in almost all ethnic groups of Ethiopia. Therefore this study might give a clue about their practice and associated factors. The objective of this study was to assess magnitude of harmful traditional practices among children less than 5 years of age in Axum Town, North Ethiopia. Methods. Community based cross-sectional study was conducted on 752 participants who were selected using multistage sampling. Simple random sampling method was used to select ketenas from all kebelles of Axum Town. After proportional allocation of sample size to eachketena, systematic random sampling method was used to get the study participants. Data was collected using interviewer administered questionnaire; it was entered and analyzed using SPSS version 16 and descriptive statistics was calculated. Results. Majority of the respondents (81.2%) were Orthodox, 78.2% of the mothers had no work, and majority of mothers had no formal education. Among the harmful traditional practices performed on children, uvula cutting alone was performed on 72.8% of children followed by milk teeth extraction and uvula cutting with eyebrow incision. Conclusion. The leading harmful traditional practice performed on children in this study was uvula cutting.

Prevalence and belief in the continuation of female genital cutting among high school girls: a cross - sectional study in Hadiya zone, Southern Ethiopia.

BackgroundFemale Genital Cutting is a cultural practice among many ethnic groups in Ethiopia that has affected many girls over the past centuries. Although the trend is slowly decreasing in Ethiopia, the magnitude is still very high as the procedure has no known benefit but has many consequences. The objective of this study was to assess the prevalence and belief in the continuation of FGC among High School Girls in Hadiya Zone.MethodsA cross-sectional quantitative survey was carried out among high school girls in Hadiya Zone from January to February 2011. A multi-staged cluster sampling method was used for sample selection. In total, 780 girls completed a self-administered questionnaire for this study. Statistical analysis was done using bivariate and multivariate logistic regression.ResultsOf 780 high school girls, 82.2% were circumcised at a mean age of 11(±2.3) years. Half of the total participants responded that FGC was being practiced in their village. About 60% of the circumcisions were performed by traditional circumcisers while health professionals had performed 30% of them. A few of the circumcised girls (9.4%) supported their status as a circumcised girl, but only 5% believe in the continuation of FGC. The odds of being cut was higher among girls whose fathers and mothers had educational status under high school level (AOR = 2.04; 95% CI: 1.25, 3.09) and (AOR = 1.84; 95% CI: 1.01, 3.38) respectively when compared to those whose parents had attended high school and above. The odds of believing in the continuation of FGC was 2.33(95% CI: 1.01, 5.33) times higher among those who responded that FGC was practiced in their areas.ConclusionWhile there is an urgent need to stop the practice of FGC in Hadiya Zone, cultural beliefs related to the hygiene of female genitalia and other social factors contribute to sustaining the practice. Local organizations in collaboration with religious institutions and community leaders should work together to engage in a process of change within the entire community by arranging awareness creation programmes on the harmfulness of the practice especially in the rural areas of the zone.

Health inequalities in Ethiopia: modeling inequalities in length of life within and between population groups.

Background and objectivesMost studies on health inequalities use average measures, but describing the distribution of health can also provide valuable knowledge. In this paper, we estimate and compare within-group and between-group inequalities in length of life for population groups in Ethiopia in 2000 and 2011.MethodsWe used data from the 2011 and 2000 Ethiopia Demographic and Health Survey and the Global Burden of Disease study 2010, and the MODMATCH modified logit life table system developed by the World Health Organization to model mortality rates, life expectancy, and length of life for Ethiopian population groups stratified by wealth quintiles, gender and residence. We then estimated and compared within-group and between-group inequality in length of life using the Gini index and absolute length of life inequality.ResultsLength of life inequality has decreased and life expectancy has increased for all population groups between 2000 and 2011. Length of life inequality within wealth quintiles is about three times larger than the between-group inequality of 9 years. Total length of life inequality in Ethiopia was 27.6 years in 2011.ConclusionLongevity has increased and the distribution of health in Ethiopia is more equal in 2011 than 2000, with length of life inequality reduced for all population groups. Still there is considerable potential for further improvement. In the Ethiopian context with a poor and highly rural population, inequality in length of life within wealth quintiles is considerably larger than between them. This suggests that other factors than wealth substantially contribute to total health inequality in Ethiopia and that identification and quantification of these factors will be important for identifying proper measures to further reduce length of life inequality.