Green Leaf Lettuce Research Articles

Improved morphological and yield responses of green lettuce (Lactuca sativa L.) grown with seaweed extract as a hydroponic nutrient solution

Sargassum polycystum is among the seaweed species in the Philippines that are considered coastal waste after drifting on the shorelines. Although there has been a report on the potential of S. polycystum as a biostimulant for certain crops, its utilization as a hydroponic nutrient solution is not yet thoroughly analyzed. Thus, a study utilizes various ratios of S. polycystum seaweed extract (SE) mixed with commercial hydroponic nutrient solution (CHNS) to the growth and yield of green leaf lettuce grown under the Kratky method of hydroponic system. Treatments are 100% CHNS and percentage replacements of CHNS with SE (25%, 50%, and 75%, respectively). The result shows a 10.53% increase in lettuce plant height grown under 25% and 50% SE compared to 100% CHNS. A similar result is also observed in the lettuce leaf width (14.29%), leaf length (7.14%), and plant weight (22.41%). Regarding root length, replacing 50% SE resulted in longer root length (44.83%) and more leaves (10%) compared to lettuce plants grown under 100% CHNS. However, replacement of SE beyond 50% is detrimental to leaf length and comparable to all growth and yield parameters with 100% CHNS. Regarding the return on investment, 50% SE replacement has the highest return of 98.62% compared to 100% CHNS, with 49.87% only for a projected six cropping cycles. Hence, a 50% replacement of CHNS with SE from its recommended rate can be suggested for more profitable production of green leaf lettuce under a hydroponic system.

Luminescent Quantum Dot Films Increase the Radiation Capture and Yield of Lettuce and Sweet Basil Compared to a Traditional/Neutral-density Greenhouse Glazing

Utilizing quantum dot (QD) luminescent films as a greenhouse covering material is an innovative method of modifying the greenhouse light spectrum. The QD films convert a portion of high-energy ultraviolet and blue photons to lower-energy photons. Previous research has shown that the application of QD films in greenhouses led to improved crop yields of red lettuce and tomatoes. However, the underlying mechanism of the yield increases has not been fully explored. We quantified the effects of solar spectral shifts attributable to QD films on plant morphology, radiation capture, and, subsequently, crop yield. Green and red leaf lettuces and basil were grown in a greenhouse under four treatments: regular-concentration QD film (reg QD film); high-concentration QD film (high QD film); color-neutral polyethylene (PE) film; and control treatment without any films. Compared to the reg QD film, the high QD film converted a higher fraction of blue photons into longer-wavelength photons, resulting in enhanced leaf expansion, stem elongation, and shoot fresh weight of red lettuce and basil compared with those grown under the PE film without spectral modifications. No significant growth differences were observed between the control and high QD film treatments of red lettuce and basil despite a 23% reduction in the average daily light integral (DLI) under the high QD film treatment. Compared to that grown under the control treatment, green lettuce grown under the high QD film treatment had a similar total leaf area but reduced shoot biomass; this was likely associated with reductions in leaf thickness and chlorophyll content. In contrast, the red lettuce showed more pronounced leaf expansion and reduced leaf anthocyanin content under the high QD film, which likely helped to offset the reduction in DLI. Overall, our results indicated that modifying the solar spectrum with QD films as greenhouse covering material could result in improved crop radiation capture and yield in greenhouse production of lettuce and basil. However, the spectral shifts caused by the QD films may affect crop quality attributes, such as anthocyanin levels and the production of other beneficial secondary metabolites. This effect on crop quality should be carefully considered and requires further study.

Dependence of far-red light on red and green light at increasing growth of lettuce.

Despite being outside of the traditionally defined photosynthetically active radiation (PAR) waveband (400-700 nm), far-red (FR; 700-799 nm) light can increase photosynthesis and induce shade-avoidance responses, which increases light interception and thus, whole-plant growth. However, it is unclear how the promotion of growth from FR light depends on PAR wavebands and specifically how the substitution of red light (600-699 nm) with green light (500-599 nm) influences the efficacy of FR light on increasing shoot biomass accumulation. To determine this, we grew red- and green-leaf lettuce (Lactuca sativa) at a fixed total photon flux density (PFD) with 12 different fractions of red, green, and FR light and the same PFD of blue (400-499 nm) light. We postulated that decreasing the red:FR by substituting FR light for green light, red light, or both would increase shoot fresh mass (FM) until a fraction beyond which growth (but not leaf area) would begin to decrease. Indeed, the substitution of red with FR light increased the leaf area of both cultivars, but FM was greatest under an FR fraction [FR/(R+FR)] of approximately 0.25. Under the greatest FR PFD, FM was similar to lettuce grown without FR light, despite having greater leaf surface area for light interception. Green light had less of an effect on leaf expansion and FM than FR light, and plant diameter and leaf area of red-leaf 'Rouxai' were the greatest when green light fully replaced red light at the highest FR PFD. We conclude that under a modest light intensity and blue PFD, a spectrum that includes up to 25% of far-red photons can increase leaf area and biomass accumulation. While leaf area may continue to increase at higher far-red fractions, fresh mass does not, and plant quality begins to deteriorate.

Vegetation Indices for Early Grey Mould Detection in Lettuce Grown under Different Lighting Conditions.

Early detection of pathogenic fungi in controlled environment areas can prevent major food production losses. Grey mould caused by Botrytis cinerea is often detected as an infection on lettuce. This paper explores the use of vegetation indices for early detection and monitoring of grey mould on lettuce under different lighting conditions in controlled environment chambers. The aim was focused on the potential of using vegetation indices for the early detection of grey mould and on evaluating their changes during disease development in lettuce grown under different lighting conditions. The experiment took place in controlled environment chambers, where day/night temperatures were 21 ± 2/17 ± 2 °C, a 16 h photoperiod was established, and relative humidity was 70 ± 10% under different lighting conditions: high-pressure sodium (HPS) and light-emitting diode (LED) lamps. Lettuces were inoculated by 7-day-old fungus Botrytis cinerea isolate at the BBCH 21. As a control, non-inoculated lettuces were grown under HPS and LEDs (non-inoculated). Then, the following were evaluated: Anthocyanin Reflectance Index 2 (ARI2); Carotenoid Reflectance Index 2 (CRI2); Structure Intensive Pigment Index (SIPI); Flavanol Reflectance Index (FRI); Greenness (G); Greenness 2 (G2); Redness (R); Blue (B); Blue Green Index 2 (BGI2); Browning Index 2 (BRI2); Lichtenthaler Index 1 (LIC1); Pigment Specific Simple Ratio (PSSRa and PSSRb); Gitelson and Merzlyak (GM1 and GM2); Zarco Tejada-Miller Index (ZMI); Normalized Difference Vegetation Index (NDVI); Simple Ratio (SR); Red-Eye Vegetation Stress Index (RVSI); Photochemical Reflectance Index (PRI); Photochemical Reflectance Index 515 (PRI515); Water Band Index (WBI); specific disease index for individual study (fD); Healthy Index (HI); Plant Senescence Reflectance (PSRI); Vogelmann Red Edge Index (VREI1); Red Edge Normalized Difference Vegetation Index (RENDVI); and Modified Red Edge Simple Ratio (MRESRI). Our results showed that the PSRI and fD vegetation indices significantly detected grey mould on lettuce grown under both lighting systems (HPS and LEDs) the day after inoculation. The results conclusively affirmed that NDVI, PSRI, HI, fD, WBI, RVSI, PRI, PRI515, CRI2, SIPI, chlorophyll index PSSRb, and coloration index B were identified as the best indicators for Botrytis cinerea infection on green-leaf lettuce (Lactuca sativa L. cv Little Gem) at the early stage of inoculated lettuce's antioxidative response against grey mould with a significant increase in chlorophyll indices.

Fates of attached E. coli o157:h7 on intact leaf surfaces revealed leafy green susceptibility

Leafy greens, especially lettuce, are repeatedly linked to foodborne outbreaks. This paper studied the susceptibility of different leafy greens to human pathogens. Five commonly consumed leafy greens, including romaine lettuce, green-leaf lettuce, baby spinach, kale, and collard, were selected by their outbreak frequencies. The behavior of E. coli O157:H7 87-23 on intact leaf surfaces and in their lysates was investigated. Bacterial attachment was positively correlated with leaf surface roughness and affected by the epicuticular wax composition. At room temperature, E. coli O157:H7 had the best growth potentials on romaine and green-leaf lettuce surfaces. The bacterial growth was positively correlated with stomata size and affected by epicuticular wax compositions. At 37 °C, E. coli O157:H7 87-23 was largely inhibited by spinach and collard lysates, and it became undetectable in kale lysate after 24 h of incubation. Kale and collard lysates also delayed or partially inhibited the bacterial growth in TSB and lettuce lysate at 37 °C, and they sharply reduced the E. coli O157:H7 population on green leaf lettuce at 4 °C. In summary, the susceptibility of leafy greens to E. coli O157:H7 is determined by a produce-specific combination of physiochemical properties and temperature.

Pre-Harvest UVB Irradiation Enhances the Phenolic and Flavonoid Content, and Antioxidant Activity of Green- and Red-Leaf Lettuce Cultivars

As a promising environmental protection technology, the application of ultraviolet B irradiation in vegetable production has been widely considered. However, the effect of UVB irradiation varies with different plant varieties. In this study, we investigated the effects of two UVB intensities (0.7, 1.4 W m−2) on the accumulation of phenolics and flavonoids, and antioxidant activity of green-leaf and red-leaf lettuce (Lactuca sativa L.) 7 days prior to harvest. The results indicated that short-term (within 2 days) UVB treatment could promote the increase in total chlorophyll content of red-leaf lettuce and green-leaf lettuce, which increased by 49.8% and 20.6% compared with day zero, respectively, and was beneficial to the synthesis of carotenoids of red-leaf lettuce. Extending UVB exposure time significantly decreased chlorophyll a/b value of green-leaf lettuce from 0.92 to 0.63, and simultaneously increased the accumulation of antioxidant substances such as flavonoids, which were increased by 90.0% and 183.4% compared with day zero for UVB-0.7 and UVB-1.4 treatments of red-leaf lettuce, 84.1% and 110.9% of green-leaf lettuce. In contrast, red-leaf lettuce had a higher accumulation level of secondary metabolites, faster scavenging rate of free radicals, and stronger ability to resist UVB stress. Our results suggest that supplementation of low-dose UVB radiance prior to harvest can improve the secondary metabolite content and antioxidant activity of the two kinds of lettuce. This research provided a theoretical basis for improving lettuce quality by pre-harvest UVB treatment in controlled environmental agriculture.

PHYTOCHEMICAL ANALYSIS, ANTIOXIDANT ACTIVITY AND FTIR SPECTROSCOPIC ANALYSIS OF RED LEAF LETTUCE AND GREEN LEAF LETTUCE (LACTUCA SATIVA L.)

This study was conducted to analyze the phytochemical compounds, the profile of infrared spectrophotometric, total phenolic contents (TPC) and antioxidant activity of ethanol extract of red leaf lettuce (RL) and green leaf lettuce (GL). RL and GL were extracted with 70 % ethanol using the maceration method for 3 days and re-maceration for 1 day. The secondary metabolites in ethanol extracts were evaluated by phytochemical analysis and profile spectra infrared. Estimation of TPC was conducted by the FolinCiocalteu methods. The antioxidant activity assay was conducted by ABTS and DPPH methods. The determination of TPC showed that the ethanol extract of RL was higher than the ethanol extract of GL. RL has stronger antioxidant activity than GL. The presence of hydroxyl group in the phenolics directly correlates with the antioxidant activity, so consumers could use them as natural antioxidants or to functionalize foods. This understanding is important for improving the safety and quality of leaf lettuce.

UV-A for Tailoring the Nutritional Value and Sensory Properties of Leafy Vegetables

This study aims to expand the artificial lighting potential of controlled environment cultivations systems by introducing UV-A (~315–400 nm) wavelengths into the traditional, visible spectrum lighting, seeking to improve the nutritional and sensory value of cultivated leafy vegetables. The experiment was conducted in a closed climate-controlled chamber, maintaining 21/17 °C day/night temperature, ~55% relative humidity, and a 16 h photo/thermo period. Several genotypes of leafy vegetables, red and green leaf lettuce cultivars, mustard, and kale were cultivated under 250 µmol m−2s−1 basal LED lighting, supplemented by 385 nm UV-A or 405 UV-A/violet wavelengths for 1.1 mW cm−2 for 12 h photoperiod for the whole cultivation cycle. The results show that UV-A/violet light impacts on leafy vegetable growth, free radical scavenging activity, sugar, and phytochemical (α tocopherol, α + β carotenes, epicatechin, rosmarinic and chicoric acid contents) are species-specific, and do not correlate with untrained consumer’s sensory evaluation scores. The 405 nm light is preferable for higher antioxidant and/or sensory properties of kale, mustard, and green leaf lettuces, but both UV-A wavelengths reduce growth parameters in red leaf lettuce.

Experimental non-invasive methodology to assess light-induced pigment changes in green and red leaf lettuce

Experimental non-invasive methodology to assess light-induced pigment changes in green and red leaf lettuce

Green Leaf, Red Leaf, and Romaine Lettuce Breeding Lines with Resistance to Leafminer, Corky Root, and Downy Mildew

Green Leaf, Red Leaf, and Romaine Lettuce Breeding Lines with Resistance to Leafminer, Corky Root, and Downy Mildew

Eficiência agronômica de compostos fermentados na fertilização de alfaces tipo americana e crespa em sistema orgânico

ABSTRACT This work aimed to evaluate the agronomic efficiency of fermented composts formulated with brewery waste (RC) with castor bean bran (FM) or Gliricidia sepium leaf bran (FG) in the fertilization of butterhead lettuce and green leaf lettuce grown in succession. The experimental design was in randomized blocks in a 2x5 factorial scheme, consisting of two fermented composts and five N doses (0, 50, 100, 200, and 400 kg/ha). The composts were formulated by combining 60 RC+40 FM and 60 RC+40 FG considering the % of dry matter after moisture correction. We verified that the phytotechnical performance of the butterhead lettuce, in relation to fertilization, is influenced by the applied dose; no difference regarding the composts was noticed, though. The doses of 272.2 and 248.71 kg/ha of N enabled the maximum yield of 78.01 and 87.79 t/ha, respectively, 60 RC+40 FM and 60 RC+40 FG. The fermented compost containing FM, in the range of the stipulated doses, showed a residual effect on the main phytotechnical traits of the green leaf lettuce, and the magnitude of the effect is directly proportional to the dose applied in the previous crop.

Secondary Metabolite Profile and Pharmacological Opportunities of Lettuce Plants following Selenium and Sulfur Enhancement.

Selenium (Se) is an essential trace nutrient for humans and animals owing to its role in redox regulation, thyroid hormone control factors, immunity, inflammatory reactions, brain activities, and carbohydrate regulation. It is also important to support muscle development, as well as for reproductive and cardiovascular well-being. Furthermore, sulfur is known to be a healing element, due to the remarkable function of specialized and secondary S-containing compounds. The scope of the current study was to determine the impact of Se and S enrichment on the secondary metabolite accumulation and antibacterial and NO inhibition activities in green and red leaf lettuce (V1 and V2, respectively). The plants were grown in a hydroponic system supplied with different S concentrations (S0: 0, S1: 1 mM and S2: 1.5 mM K2SO4) via the nutrient solution and foliar-applied varying levels of Se (0, 0.2 and 2.6 µM). Electrospray ionization-quadrupole time-of-flight mass spectrometry (ESI-QTOF/MS) combined with ultra-performance liquid chromatography (UPLC) was used to identify the secondary metabolites in green and red lettuce. The results indicated that extracts of the biofortified lettuce were not cytotoxic to Vero kidney cells at the highest concentration tested of 1 mg/mL. The ESI/MS of the tentatively identified metabolites showed that the response values of 5-O-caffeoylquinic acid, cyanidin 3-O-galactoside, quercetin 3-O-(6''-acetyl-glucoside) and quercetin 3-O-malonylglucoside were induced synergistically under higher Se and S levels in red lettuce plants. The acetone extract of red lettuce had antibacterial activity against Pseudomonas aeruginosa, with a minimum inhibitory concentration (MIC) of 0.156 and 0.625 μg/mL under S2/Se1 and S2/Se2 treatments, respectively. As with antibacterial activity, the acetone extract of green (V1) lettuce treated with adequate (S1) and higher S (S2) under Se-limiting conditions showed the ability to inhibit nitric oxide (NO) release from macrophages. NO production by macrophages was inhibited by 50% at respective concentrations of 106.1 ± 2.4 and 101.0 ± 0.6 μg/mL with no toxic effect on the cells, in response to S1 and S2, respectively, under Se-deficient conditions (Se0). Furthermore, the red cultivar (V2) exhibited the same effect as the green cultivar (V1) regarding NO inhibition, with IC50 = 113.0 ± 4.2 μg/mL, in response to S1/Se2 treatments. Collectively, the promising NO inhibitory effect and antibacterial activity of red lettuce under the above-mentioned conditions might be attributed to the production of flavonoid glycosides and phenylpropanoic acid esters under the same condition. To the best of our knowledge, this is the first report to show the novel approach of the NO inhibitory effect of Se and S enrichment in food crops, as an indicator for the potential of Se and S as natural anti-inflammatory agents.

Mapping Quantitative Trait Loci for Lettuce Resistance to Verticillium dahliae Race 3, Plant Development, and Leaf Color Using an Ultra-High-Density Bin Map Constructed from F2 Progeny

Verticillium wilt is one of the most devastating soilborne diseases in lettuce, and the use of host resistance is the most optimal choice for its management. This study focused on identifying and mapping the genetic loci for resistance against Verticillium dahliae race 3 in a mapping population of 200 F2:3 families developed from a cross between moderately resistant red-leaf lettuce ‘Sentry’ and susceptible green-leaf lettuce ‘La Brillante’. The population was genotyped using the tunable genotyping-by-sequencing (tGBS) approach. An ultra-high-density genetic linkage map containing 34,838 single nucleotide polymorphism markers grouped into 1,734 bins was constructed using F2 progeny and a sliding window approach. Three quantitative trait loci (QTLs) for resistance to V. dahliae race 3 were located on linkage groups (LGs) LG 2 ( qVR3-2.1) and LG 4 ( qVR3-4.1 and qVR3-4.2). Each of these QTLs explained up to ∼10% of the total phenotypic variation for the trait. At each locus, the resistance alleles were derived from cultivar Sentry that is partially resistant to the pathogen. Additional loci resistant to the disease are expected in this population, and transgressive segregation indicates that some of those loci could originate from the susceptible cultivar La Brillante. In addition, two QTLs for plant development were identified on LG 2 ( qIPD-2.1) and LG 7 ( qIPD-7.1), although no relationship was detected between resistance in these genotypes and the rate of plant growth. A major effect of QTL for red leaf color was detected on LG 9 ( qRLC-9.1). Candidate genes linked to some of the QTLs for V. dahliae race 3 resistance, plant development, and leaf color were identified. The QTLs for resistance identified in Sentry could diversify the resistance gene pool and provide an alternative tool to manage a newly emerged V. dahliae race 3. [Formula: see text] Copyright © 2022 The Author(s). This is an open access article distributed under the CC BY-NC-ND 4.0 International license .

Effects of Supplemental UV-A LEDs on the Nutritional Quality of Lettuce: Accumulation of Protein and Other Essential Nutrients

Light plays an important role in influencing the nutritional quality of food crops, especially with regard to the health-promoting phytochemicals. However, its role in affecting the nutritional quality with regard to the essential nutrients is not well understood. In this study, the effects of preharvest UV-A treatment on the nutritional quality of lettuce (Lactuca sativa, cv. red-leaf ‘New Red Fire’ and green-leaf ‘Two Star’) in relation to the essential nutrients and health-promoting phytochemicals were explored. Lettuce plants were grown in a growth chamber and were subjected to supplemental UV-A LEDs (peak wavelength 375 nm) for a brief period (3–6 days) prior to harvest. UV-A LEDs were equipped with lenses to control the light dispersion. Many growth indices such as shoot fresh mass, leaf area, and leaf number were unaffected by supplemental UV-A in both varieties while shoot dry mass decreased in response to a 6-day UV-A treatment compared to the control. Leaf chlorophyll and carotenoid concentrations increased significantly in green-leaf lettuce after 3 or 6 days of UV-A treatment, but only after 3 days of UV-A treatment in red-leaf lettuce compared to the control. Leaf protein concentration increased significantly in both lettuce varieties along with a number of essential nutrients such as phosphorus, potassium, calcium, manganese, and sulfur in response to supplemental UV-A. Supplemental UV-A increased the accumulation of protein by approximately 48% in green-leaf lettuce and 31% in red-leaf lettuce compared to the control plants. Moreover, in addition to the above essential nutrients, green-leaf lettuce accumulated higher amounts of magnesium, copper, and zinc compared to the control plants, indicating that green-leaf lettuce was more responsive to preharvest supplemental UV-A treatment than red-leaf lettuce. However, the accumulation of total phenolic compounds and flavonoids in both varieties was lower under supplemental UV-A. Furthermore, the use of LED lenses did not have a consistent impact on most of the plant responses studied. Overall, the results indicate that a brief preharvest exposure of both red- and green-leaf lettuce varieties to UV-A increased their nutritional quality by enhancing the accumulation of protein and other major essential nutrients.

Phytochemical Analysis and Antibacterial Potential of Tabon-tabon (Atuna racemosa Raf) Fruit Extract against E. Coli BIOTECH 1634

This study aimed to examine the phytochemical levels of crude “tabon-tabon” (Atuna racemosa Raf.) fruit extracts subjected to air-drying, oven-drying, and freeze-drying. It also sought to validate the claims of previous literature on the fruit’s antimicrobial properties by using its aqueous extracts as an antibacterial wash for green ice leaf lettuce. Phytochemical analysis revealed significantly higher (p < 0.05) levels of alkaloids and tannins compared to coumarins, saponins, and terpenoids. The highest alkaloid content (16.25 ± 1%) was obtained using oven- drying, whereas the highest tannin content was obtained using freeze-drying (14.14 ± 1.13%). In vivo antibacterial assay against Escherichia coli was performed to test the aqueous extracts alongside 200 ppm chlorine solution and water for comparison. Artificially-inoculated lettuce samples were individually soaked in 15-mL solution at 2- and 5-min contact times. Bacterial load was determined at a 2-d interval for a period of 8 d. Results of the microbiological analysis showed no significant interaction in the soaking time used. However, the treatments were independently found to have significant effects on Days 0, 4, and 6. The highest antibacterial effect in green ice lettuce was exhibited up to Day 6.

First Report of Impatiens Necrotic Spot Virus Infecting Lettuce in Arizona and Southern Desert Regions of California.

Impatiens necrotic spot virus (INSV; family Tospoviridae, genus Orthotospovirus) is a thrips-borne pathogen that infects a wide range of ornamental and vegetable crops. INSV was first reported in lettuce (Lactuca sativa) in the Salinas Valley of CA (Monterey County) in 2006 (Koike et al. 2008). Since then, the pathogen has continued to impact lettuce production in the region, causing severe economic losses with increasing incidence and severity in recent years. Tomato spotted wilt virus (TSWV), another tospovirus, also infects lettuce, but its occurrence is much less frequent than INSV (Kuo et al. 2014). While INSV has not been reported in the desert areas of CA and AZ, there are concerns that the virus could become established in this region. In early March 2021, symptoms resembling those caused by orthotospovirus infection were observed in several romaine and iceberg lettuce fields in the Yuma and Tacna regions of Yuma County, AZ. Symptoms included leaves that exhibited tan to dark brown necrotic spots, distorted leaf shapes, and stunted plant growth. Similar symptoms were also reported in romaine fields and one green leaf and iceberg lettuce field in the neighboring Imperial and Riverside Counties of CA. A total of 14 samples (5 from Tacna, 4 from Yuma, 4 from Imperial, 1 from Riverside) were tested using ImmunoStrips (Agdia, Elkhart, IN) for INSV and TSWV. Results confirmed the presence of INSV in 13 out of 14 samples, and the absence of INSV in one sample originating from Yuma. All 14 samples tested negative for TSWV. The 13 INSV positive samples were processed for RT-PCR validation. Total RNA was extracted from each sample using the RNeasy Plant Mini Kit (Qiagen, Valencia, CA). RT-PCR was performed with OneStep Ahead RT-PCR Kit (Qiagen) with primers to the N gene of INSV S RNA (Accession KF745140.1; INSV F = CCAAATACTACTTTAACCGCAAGT; INSV R = ACACCCAAGACACAGGATTT). All reactions generated a single amplicon at the correct size of 524 bp. One sample each from Yuma, Tacna, and Brawley (Imperial County), as well as a romaine lettuce sample collected from the Salinas Valley in March 2021, were sent for Sanger bi-directional sequencing (Eton Biosciences, San Diego, CA). Sequence analysis revealed that all three desert samples (Yuma, Tacna, and Brawley with Accessions OK340696, OK340697, OK340698, respectively) shared 100% sequence identity and 99.43% identity to the Salinas Valley 2021 sample (SV-L2, Accession OK340699). Additionally, all desert samples shared 99.24% sequence identity to the Salinas Valley lettuce isolate previously described in 2014 (SV-L1, Accession KF745140.1; Kuo et al. 2014), while the SV-L2 and SV-L1 sequences shared 99.43% identity. By the end of the season (April 2021) a total of 43 lettuce fields in Yuma County, AZ, and 9 fields in Imperial and Riverside Counties, CA were confirmed to have INSV infection using ImmunoStrips. Impacted fields included romaine, green leaf, red leaf, and head lettuce varieties, and both direct-seeded and transplanted lettuce, under conventional and organic management regimes. In AZ, INSV incidence in fields ranged between 0.2% and 33%, while in Imperial and Riverside Counties, CA, field incidence remained low at less than 0.1%. It is possible that INSV was introduced from the Salinas Valley of CA through the movement of infected lettuce transplants and/or thrips vectors. To our knowledge, this is the first report of INSV infecting lettuce in Arizona and the southern desert region of California.

Vegetable fermentations brined with low salt for reclaiming food waste.

Fermentation of eight vegetables was studied as an alternative for reclamation of surplus volumes. Fermentation performance was predicted by comparing the amounts of acid that could be produced from the intrinsic sugar content with that buffered by the fresh vegetable matrices prior to reaching an inhibitory pH for fermentative microbes (3.30). Native fermentations were brined with 345.0mM sodium chloride, 40.0mM calcium chloride, 6.0mM potassium sorbate, and vinegar to adjust the initial pH to 4.70. High-performance liquid chromatography analysis, pH, and carbon dioxide measurements and spiral plating on selective media were employed to monitor the progress of fermentations. The average colony counts for yeast and/or molds and Enterobacteriaceae declined to undetectable levels from 3.6± 1.5 log CFU/ml within 7 days of fermentation. The fermentation of sugars produced lactic, acetic, succinic, and/or malic acids, and ethanol. As predicted, the fermentation of vegetables with low sugar content, such as broccoli, green leaf lettuce, and green pea proceeded to completion. The fermentation of vegetables with a moderate sugar content, such as green bell pepper, red ripened tomato, and green bean were incomplete at pH 3.1± 0.2. The fermentation of high sugar vegetables including sweet potato and corn were expected and observed to be incomplete. It is concluded that the intrinsic sugar content and buffer capacity of surplus vegetables are relevant parameters in obtaining complete fermentations. PRACTICAL APPLICATION: Vegetables are the second most wasted commodity in the United States and a substantial constituent of the global food waste. Development of fermentation to reclaim surplus vegetables from farms, grocery stores, and farmer's markets offers opportunities to ameliorate economic losses and environmental impact and add value to waste. The research described here suggests that a fraction of vegetables could be fermented in cover brines while others, with high sugar content, need specialized handling. Evidently, optimization of vegetable fermentation with starter cultures and added buffers represent an opportunity to stimulate complete bioconversions useful for reclaiming surplus volumes.

Antimicrobial activities of virgin olive oils in vitro and on lettuce from pathogen-inoculated commercial quick salad bags

Virgin olive oil (VOO) provides an important source of healthy compounds. Its high concentrations of monounsaturated fatty acids and phenolic compounds contribute toward its nutritional, antioxidant, and antimicrobial properties. VOO is used in the preparation of many dishes worldwide and forms a staple of the Mediterranean diet; however, the antimicrobial activity of VOO in food matrices has been investigated very little to date. Considering this and the growing demand to reduce the use of synthetic antimicrobials and chemical food preservatives, especially in minimally processed foods, the aim of this work was to evaluate the antibacterial activity of VOOs obtained from 13 different Italian olive varieties. All olive varieties were harvested and processed in the same area (Oristano, Sardinia, Italy). The in vitro antimicrobial activities of the resulting VOOs were tested against: Listeria monocytogenes DSM 20600, Staphylococcus aureus DSM 20231, Escherichia coli DSM 30083, Salmonella bongori DSM13772, Lacticaseibacillus casei Shirota, Limosilactobacillus reuteri DSM 17938, Lacticaseibacillus casei RI4, and the yeast Candida albicans 3393. Orthogonal Projections to Latent Structures (OPLS) analysis showed a strong correlation between the content of certain phenolic compounds, the contact time of VOOs with the microbial cells, and the antimicrobial activity of the VOOs against the microorganisms tested. The VOOs showing the strongest antimicrobial activities (the Bosana and Sivigliana varieties) were then re-tested against L. monocytogenes DSM 20600 and S. bongori DSM 13772 in artificially contaminated commercial quick salad bags (QSB) of baby green leaf lettuces. The results show that antimicrobial activities of VOO depend on the target microbial species and the concentration of the inoculum. This study provides evidence supporting that VOOs with determinate polyphenols profiles might be used as antimicrobial ingredients in minimally processed foods to significantly reduce the presence of pathogenic bacteria.

Effects of Various High Tunnel Coverings on Color and Phenolic Compounds of Red and Green Leaf Lettuce (Lactuca Sativa)

Effects of Various High Tunnel Coverings on Color and Phenolic Compounds of Red and Green Leaf Lettuce (Lactuca Sativa)

Spectral Blocking of Solar Radiation in High Tunnels by Poly Covers: Its Impact on Nutritional Quality Regarding Essential Nutrients and Health-Promoting Phytochemicals in Lettuce and Tomato

Spectral characteristics of solar radiation have a major role in plant growth and development and the overall metabolism, including secondary metabolism, which is important for the accumulation of health-promoting phytochemicals in plants. The primary focus of this study was to determine the effect of spectral characteristics of solar radiation on the nutritional quality of lettuce (Lactuca sativa L., cv. red leaf ‘New Red Fire’ and green leaf ‘Two Star’ and tomato (Solanum lycopersicum L., cv. BHN-589) grown in high tunnels in relation to the accumulation of essential nutrients and phytochemicals. Solar spectrum received by crops was modified using photo-selective poly covers. Treatments included commonly used standard poly, luminescence poly (diffuse poly), clear poly, UV blocking poly, exposure of crops grown under the standard poly to full sun 2 weeks prior to harvest (akin to movable tunnel), and 55% shade cloth on the standard poly. All the poly covers and shade cloth reduced the PAR levels in the high tunnels, and the largest reduction was by the shade cloth, which reduced the solar PAR by approximately 48%. Clear poly allowed the maximum UV-A and UV-B radiation, while standard poly allowed only a small fraction of the solar UV-A and UV-B (between 15.8% and 16.2%). Clear poly, which allowed a higher percentage of solar UV-A (60.5%) and UV-B (65%) than other poly covers, increased the total phenolic concentration and the antioxidant capacity in red leaf lettuce. It also increased the accumulation of flavonoids, including quercetin-3-glucoside, luteolin-7-glucoside, and apigenin-3-glucoside in red leaf lettuce, compared to the standard poly. Brief exposure of crops grown in high tunnels to full sun prior to harvest produced the largest increase in the accumulation of quercetin-3-glucoside, and it also resulted in an increase in luteolin-7-glucoside and apigenin-3-glucoside in red leaf lettuce. Thus, clear poly and brief exposure of red leaf lettuce to the full sun, which can increase UV exposure to the plants, produced a positive impact on its nutritional quality. In contrast, shade cloth which allowed the lowest levels of solar PAR, UV-A and UV-B relative to the other poly covers had a negative impact on the accumulation of the phenolic compounds in red leaf lettuce. However, in green leaf lettuce, luminesce poly, clear poly, UV-block poly, and shade treatments increased the accumulation of many essential nutrients, including protein, magnesium, and sulfur in green leaf lettuce compared to the standard poly. Poly cover treatments including shade treatment did not affect the accumulation of either carotenoids (lutein, β-carotene, and lycopene) or essential nutrients in mature tomato fruits. The results show that clear poly cover can enhance the accumulation of many phenolic compounds in red leaf lettuce, as does the brief exposure of the crop to the full sun prior to harvest. Thus, UV radiation plays an important role in the accumulation of phenolic compounds in red leaf lettuce while the overall spectral quality of solar radiation has a significant influence on the accumulation of essential nutrients in green leaf lettuce.