Glycophorin Research Articles

Characterization of GYP(B-A-B) hybrid glycophorins among Thai blood donors with Mia-positive phenotypes.

GYPA and GYPB genes encode the antigens of the MNS blood group system carried on glycophorin A (GPA) and glycophorin B (GPB), or on a hybrid molecule of GPA and GPB. GP hybrid variants are created through unequal crossing over and gene conversion, typically from the parent genes GYPA and GYPB. In the present study, we characterized the GYP(B-A-B) hybrid variants among Thai blood donors with Mia-positive phenotypes using PCR-based coupled to DNA sequencing techniques. Altogether, 1,020 samples from Thai blood donors were tested with anti-Mia by conventional tube technique (CTT). Polymerase chain reaction with sequence-specific primer (PCR-SSP) was initially used to differentiate normal GYPB, GYP*Vw and groups of GYP*Hut, GYP*Mur, GYP*Hop, GYP*Bun and GYP*HF alleles. Subsequently, GYP(B-A-B) hybrid variants were investigated using DNA sequencing. Among 1,020 blood donors, 127 (12.45%) were Mi(a+) phenotypes. The comparison Mia typing results between CTT and PCR-SSP were concordant. All Mi(a+) samples were positive with only group of GYP*Hut, GYP*Mur, GYP*Hop, GYP*Bun and GYP*HF alleles by PCR-SSP. Regarding the sequencing results, 115/1,020 (11.27%) donors carried the GYP*Mur, of which 111/1,020 (10.88%) were GYP*Mur/GYPB heterozygotes and the other 4/1,020 (0.39%) donors were GYP*Mur/GYP*Mur homozygotes. The remaining 12 donors included different GYP*Bun-like alleles; 11 of them (1.08%) were GYP*Thai/GYPB heterozygotes, and one (0.10%) was GYP*Thai II/GYPB heterozygotes. With 5.83% (119/2,040) of the total hybrid alleles, GYP*Mur was the predominant allele. The GYP*HF, GYP*Bun, GYP*Hop and GYP*Kip alleles were not observed in this study. Regarding the hybrid GP variants, a consensus of observed prevalent GYP*Mur and GYP*Bun-like alleles, respectively, was identified in the Thai population. The introduction of our strategy has allowed us to identify the zygosity for GYP hybrid variants, particularly GYP(B-A-B) hybrid genes, when antisera are unavailable and lacking adequate phenotypic features to determine GP variants.

Dantu Blood Group Erythrocytes Form Large Plasmodium falciparum Rosettes Less Commonly.

Dantu erythrocytes, which express a hybrid glycophorin B/A protein, are protective against severe malaria. Recent studies have shown that Dantu impairs Plasmodium falciparum invasion by increasing erythrocyte membrane tension, but its effects on pathological host-parasite adhesion interactions such as rosetting, the binding of uninfected erythrocytes to P. falciparum-infected erythrocytes, have not been investigated previously. The expression of several putative host rosetting receptors-including glycophorin A (GYPA), glycophorin C (GYPC), complement receptor 1 (CR1), and band 3, which complexes with GYPA to form the Wrightb blood group antigen-are altered on Dantu erythrocytes. Here, we compare receptor expression, and rosetting at both 1 hour and 48 hours after mixing with mature trophozoite-stage Kenyan laboratory-adapted P. falciparum strain 11019 parasites in Dantu and non-Dantu erythrocytes. Dantu erythrocytes showed lower staining for GYPA and CR1, and greater staining for band 3, as observed previously, whereas Wrightb and GYPC staining did not vary significantly. No significant between-genotype differences in rosetting were seen after 1 hour, but the percentage of large rosettes was significantly less in both Dantu heterozygous (mean, 16.4%; standard error of the mean [SEM], 3.2) and homozygous donors (mean, 15.4%; SEM, 1.4) compared with non-Dantu erythrocytes (mean, 32.9%; SEM, 7.1; one-way analysis of variance, P = 0.025) after 48 hours. We also found positive correlations between erythrocyte mean corpuscular volume (MCV), the percentage of large rosettes (Spearman's rs = 0.5970, P = 0.0043), and mean rosette size (rs = 0.5206, P = 0.0155). Impaired rosetting resulting from altered erythrocyte membrane receptor expression and reduced MCV might add to the protective effect of Dantu against severe malaria.

Free-energy landscapes of transmembrane homodimers by bias-exchange adaptively biased molecular dynamics

Membrane proteins play essential roles in various biological functions within the cell. One of the most common functional regulations involves the dimerization of two single-pass transmembrane (TM) helices. Glycophorin A (GpA) and amyloid precursor protein (APP) form TM homodimers in the membrane, which have been investigated both experimentally and computationally. The homodimer structures are well characterized using only four collective variables (CVs) when each TM helix is stable. The CVs are the interhelical distance, the crossing angle, and the Crick angles for two TM helices. However, conformational sampling with multi-dimensional replica-exchange umbrella sampling (REUS) requires too many replicas to sample all the CVs for exploring the conformational landscapes. Here, we show that the bias-exchange adaptively biased molecular dynamics (BE-ABMD) with the four CVs effectively explores the free-energy landscapes of the TM helix dimers of GpA, wild-type APP and its mutants in the IMM1 implicit membrane. Compared to the original ABMD, the bias-exchange algorithm in BE-ABMD can provide a more rapidly converged conformational landscape. The BE-ABMD simulations could also reveal TM packing interfaces of the membrane proteins and the dependence of the free-energy landscapes on the membrane thickness. This approach is valuable for numerous other applications, including those involving explicit solvent and a lipid bilayer in all-atom force fields or Martini coarse-grained models, and enhances our understanding of protein-protein interactions in biological membranes.

A Rigorous Framework for Calculating Protein-Protein Binding Affinities in Membranes.

Calculating the binding free energy of integral transmembrane (TM) proteins is crucial for understanding the mechanisms by which they recognize one another and reversibly associate. The glycophorin A (GpA) homodimer, composed of two α-helical segments, has long served as a model system for studying TM protein reversible association. The present work establishes a methodological framework for calculating the binding affinity of the GpA homodimer in the heterogeneous environment of a membrane. Our investigation carefully considered a variety of protocols, including the appropriate choice of the force field, rigorous standardization reflecting the experimental conditions, sampling algorithm, anisotropic environment, and collective variables, to accurately describe GpA dimerization via molecular dynamics-based approaches. Specifically, two strategies were explored: (i) an unrestrained potential mean force (PMF) calculation, which merely enhances sampling along the separation of the two binding partners without any restraint, and (ii) a so-called "geometrical route", whereby the α-helices are progressively separated with imposed restraints on their orientational, positional, and conformational degrees of freedom to accelerate convergence. Our simulations reveal that the simplified, unrestrained PMF approach is inadequate for the description of GpA dimerization. Instead, the geometrical route, tailored specifically to GpA in a membrane environment, yields excellent agreement with experimental data within a reasonable computational time. A dimerization free energy of -10.7 kcal/mol is obtained, in fairly good agreement with available experimental data. The geometrical route further helps elucidate how environmental forces drive association before helical interactions stabilize it. Our simulations also brought to light a distinct, long-lived spatial arrangement that potentially serves as an intermediate state during dimer formation. The methodological advances in the generalized geometrical route provide a powerful tool for accurate and efficient binding-affinity calculations of intricate TM protein complexes in inhomogeneous environments.

NXPE2 Is the Target of Ter-119 When Complexed with Gypa in Mice

Background: Red blood cells (RBCs) have a complex biology that allows regulation of metabolism, cellular rigidity, ion exchange, pH, and molecular communication with the vasculature. A central regulator of these biologies are macrocomplexes of integral membrane proteins that are both linked to cytoskeletal proteins and also differentially bind to metabolic enzymes based upon oxygenation status of the RBC. RBC surface staining, co-immunoprecipitation, and cross-linking proteomic approaches have generated a model of the macrocomplex encompassing Band 3, Rh, RhAG, CD47, glycophorin A, glycophorin B, and LW. TER-119 is a monoclonal antibody with exquisite specificity for the erythroid lineage in mice. However, the molecular target of TER-119 has remained unknown. TER-119 immunoprecipitates 4 specific protein bands, two of which are glycophorin A (GYPA) monomers or homodimers respectively; however, TER-119 is non-reactive to GYPA when assayed through Western blots and flow cytometry with erythroid cell lines expressing GYPA. These data led the originators of TER-119 to conclude it binds to a GYPA associated protein, but not GYPA itself. In contrast, others have concluded that TER-119 binds GYPA directly, and have inferred GYPA biology based upon TER-119 reactivity. Methods: TER-119 reactivity with peripheral blood RBCs from mice or from transfected HEK cells was determined by flow cytometry. Mice were genotyped using a dense array of 143,000 markers. Quantitative trait loci (QTL) analysis was carried out using TER-119 staining as a trait. cDNA for the open reading frames of the variants of interest in candidate genes or GYPA were cloned into eukaryotic expression vectors drive by the CMV promoter. HEK cells were transfected with expression vectors, in combination with a GFP expression plasmid. Cells were stained with TER-119 48 hours post transfection and analyzed by flow cytometry, gating on GFP positive cells to isolate the transfected population. Hematopoietic lineage expression of mRNA was obtained from the BloodSpot database. Results: The Diversity Outbred mice (DO mice) are an outbred population descended from 8 parental strains (A/J, C57BL/6J, 129S1/SvlmJ, NOD/ShiLtJ, NZO/HILtJ, CAST/EiJ, PWK/PhJ, and WSB/EiJ). While analyzing RBC biology phenotypes in DO mice, using TER-119 as a marker of RBCs, we serendipitously observed TER-119 non-reactivity in peripheral blood of 5 out of 550 DO mice. QTL analysis using TER-119 reactivity as a trait identified a highly significant QTL (genome-wide adjusted p-value <1.11e-16) driven by alleles specific to WSB/EiJ mice. Analysis of each of the parental strains confirmed that only peripheral blood from WSB/EiJ mice was non-reactive with TER-119. The QTL region contained 4 genes with missense mutations specific to the WSB/EiJ strain (HTR3a, HTR3b, NXPE2, and NXPE4). TER-119 was weakly reactive with HEK cells transfected with NXPE2 (but not the other genes). However, TER-119 became strongly reactive with HEK cells co-transfected with NXPE2 and GYPA (but not the other genes co-transfected with GYPA). There is no GYPA coding variation present in 8 DO parental strains. NXPE2 mRNA is highly expressed in the murine erythroid lineage with lower expression in B cells and granulocytes. Discussion: These data demonstrate that TER-119 reactivity is conferred by co-expression of NXPE2 and GYPA. NXPE2 is a single pass transmembrane protein and the weak reactivity of TER-119 with NXPE2 alone suggests that TER-119 recognizes an epitope on NXPE2 that is allosterically enhanced by complexing with GYPA. However, other binding scenarios cannot be ruled out. These data are important for three reasons. First, they identify NXPE2 as a hitherto unrecognized surface protein specific to the erythroid lineage in mice. Second, they raise the possibility that the models of the macrocomplex are incomplete. Third, these findings may allow re-interpretation of existing data that assumed TER-119 recognized GYPA. Additional studies are required to determine what function (if any) NXPE2 plays in erythropoiesis in mice and whether this function translates to human NXPE2 or a homologous gene.

Alpha hemolysin of E. coli induces hemolysis of human erythrocytes independently of toxin interaction with membrane proteins

Alpha hemolysin (HlyA) is a hemolytic and cytotoxic protein secreted by uropathogenic strains of E. coli. The role of glycophorins (GPs) as putative receptors for HlyA binding to red blood cells (RBCs) has been debated.Experiments using anti-GPA/GPB antibodies and a GPA-specific epitope nanobody to block HlyA-GP binding on hRBCs, showed no effect on hemolytic activity. Similarly, the hemolysis induced by HlyA remained unaffected when hRBCs from a GPAnull/GPBnull variant were used. Surface Plasmon Resonance experiments revealed similar values of the dissociation constant between GPA and either HlyA, ProHlyA (inactive protoxin), HlyAΔ914-936 (mutant of HlyA lacking the binding domain to GPA) or human serum albumin, indicating that the binding between the proteins and GPA is not specific.Although far Western blot followed by mass spectroscopy analyses suggested that HlyA interacts with Band 3 and spectrins, hemolytic experiments on spectrin-depleted hRBCs and spherocytes, indicated these proteins do not mediate the hemolytic process.Our results unequivocally demonstrate that neither glycophorins, nor Band 3 and spectrins mediate the cytotoxic activity of HlyA on hRBCs, thereby challenging the HlyA-receptor hypothesis. This finding holds significant relevance for the design of anti-toxin therapeutic strategies, particularly in light of the growing antibiotic resistance exhibited by bacteria.

Standard binding free-energy calculation of glycophorin a dimer in non-isotropic media sheds light on the transmembrane alpha-helices association mechanism.

The transmembrane (TM) protein domain recognition and association processes happening in lipid bilayers are pivotal for understanding membrane protein biogenesis. The most straightforward system to study the transmembrane protein binding mechanism is the glycophorin A (GpA) dimeric TM domain. The GpA is a glycoprotein ubiquitous to the human erythrocyte membrane, which forms a non-covalent dimer through the reversible association of its membrane-spanning domain sequences, creating a crossing angle between two alpha-helices. In our study, the membrane protein complex is primarily located in the phosphatidylcholine (POPC) lipid bilayer, surrounded by water. Applying a rigorous theoretical framework of the standard binding free-energy calculation that combines molecular dynamics and potential-of-mean-force calculations, the so-called “geometrical route”, we investigated this complex in non-isotropic media. Our analysis shows that at large separation distances, the helices are pushed together by the lipids, which triggers the interhelical interactions to occur. This observation is in agreement with the “two-stage” model of integral membrane protein folding. Additionally, we observed that the monomers, while reversibly associated, go through a meta-stable state, where the GpA alpha-helices form a different shape compared to the initial one. From the theoretical point of view, we suggest that for the membrane proteins in the non-isotropic environment, the standard binding free-energy estimation via the geometrical route should be analyzed from another perspective compared to those of protein-protein complexes in water media. We revised the separation PMF evaluation, assuming that the lipid bilayer forms a pseudo-cylindrical zone for the reversible separation of the dimer. The methodology employed herein successfully addresses the challenging transmembrane protein-protein binding problem while offering promising perspectives for the binding affinity characterization of different protein complexes in lipid bilayers.

Preparation and Structural Analysis of a Sialo-Oligosaccharide from Glycophorin in Carp Red Blood Cell (RBC) Membranes

Glycophorins (GPs) in the red blood cell (RBC) membranes of carp (Cyprinus carpio L.) exhibit bacteriostatic activity against various gram-negative and gram-positive bacteria. This antibacterial property is attributed to a sialo-oligosaccharide. For a structural analysis of this O-linked sialo-oligosaccharide, it is necessary to prepare and purify the oligosaccharide from carp GPs. To prepare sialo-oligosaccharides, RBC membrane proteins were solubilized, and anion exchange column chromatography was performed to obtain the GPs. The GP yield from carp RBC membranes was ca.100% as total sialic acid. Then, released oligosaccharides were obtained from GP preparation by β-elimination. Second, the resulting oligosaccharide fraction was separated into two sialo-oligosaccharide components (P-1 and P-2) using the same anion exchange column. The oligosaccharide preparations that contained high amounts of NaCl were desalted with an activated charcoal column combined with ammonium bicarbonate in acetonitrile as an eluent. Using NMR to analyse the structure of the antimicrobial P-1, we determined the alignment of each proton and C1 carbon. To determine the linkage sites, we performed GC-MS using the permethylated P-1. Lastly, we determined that the structure of P-1 was NeuGcα2→6 (Fucα1→4) (Glcα1→3) Galβ1→4GalNAc-ol.

Differential enzymatic deglycosylation reveals attachment of red cell B antigen onto the carbohydrate moiety of glycophorin A and glycophorin B.

Early studies indicate that red cell A and B antigens are attached primarily onto band 3 and GLUT1 on the erythrocyte membrane and little onto glycophorin A (GPA) and glycophorin B (GPB). But as GPA and band 3 form stable protein complexes and GPA is much more heavily glycosylated than band 3, this study re-examined the association between ABO antigens and GPA/GPB. Band 3/GPA-associated protein complexes were first immunoprecipitated, followed by differential enzymatic deglycosylation that removed sialic acids, N-glycans and O-glycans. Serological anti-A (BIRMA 1) and anti-B IgM (GAMA 110) could be used for western blot (WB); however, only the anti-B IgM showed significant reactivity for the immunoprecipitates isolated by anti-band 3. The expression of the B antigen in un-deglycosylated and differentially deglycosylated band 3 immunoprecipitates was thus compared. Besides attachment to band 3, red cell B antigen expressed substantially on GPA monomer and homodimer, GPA*GPB heterodimer, and GPB monomer and dimer via attachments through the N- and O-glycans. Immunoprecipitation (IP), as a means of protein separation and concentration, was used in combination with a WB to differentiate glycosylation on different proteins and oligomers. This study implemented differential enzymatic deglycosylation during IP of the band 3 complexes. This combined approach allowed separate identification of the B antigen on GPA/GPB monomer and dimer and GPA*GPB heterodimer, and band 3 on the WB and verified non-trivial expression of the B antigen on GPA and GPB on the erythrocyte surface.

A novel GYP(B-A-B) hybrid in a blood donor identified by a phenotyping discrepancy with different anti-s reagents.

MNS is a complex blood group system whose antigens are carried on glycophorin A (GPA), glycophorin B (GPB) and hybrid glycophorin molecules. These hybrid proteins are the results of gene recombination events at the GYPA/GYPB loci. One of the larger groups of hybrid proteins in this system are the GP(B-A-B) hybrid proteins, which often arise through gene recombination events in and around exon 3/intron 3 of GYPA, and pseudoexon 3 of GYPB.1 Different low-prevalence antigens are expressed on the hybrids depending on the point of crossover, and the presence of such a hybrid is often detected by aberrant expression of S and/or s antigens.2 We present the investigation of samples from a blood donor who had been genotyped on the HEA BeadChip array (Immucor, GA) as GYPB*03/03 but whose RBCs phenotyped S+ s+ . Extended phenotyping for S/s was performed by routine serological techniques with commercially available polyclonal and monoclonal reagent sera (See Figure 1A for manufacturers). Confirmatory allele-specific PCR (PCR-ASP) for the S/s polymorphism was performed as described previously on genomic DNA isolated from peripheral blood.3 GYPB exons 2–6 were specifically amplified using the primer pair GYP2-F and GYPB6-R (5′TATTGTACAGATGAGAAAACCAAGGCAC3′ and 5′GTGAGGCAGGAGAACAGGGAATTAG3′). The amplicon was purified and sequenced using the following internal GYPB-exon specific primers: exon 2: GPBX2S 5′CTATTTTATACAGAAATTGTGAG3′, GPBX2AS 5′CTAGAATTCCTCTGTAGTAAG3′; pseudoexon 3: GPBX3S 5′GGAGAATTTGTCTTTCATGATAC3′, GPB1963R 5′CAACATATGCTCTTCTGTTTTAAG3′; exon 4: GYPB42F 5′ATTTCTCATCCATGAATACG3′, GYPB43R 5′GCTTGGCCTCCCAAAATTATA3′; exon 5: GPB4/5 5′CTGTCTTATTTTTCTATTGCTATG3′, GPBIVS5 5′CTGTTTCTCTTTTGAGTTTAACTG3′ (Eurofins Genomics, Ebersberg, Germany). GYPB exon 1 was not sequenced since the peptide sequence encoded is cleaved from the mature protein. Note that exon numbering includes pseudoexon 3 for comparison with previously described hybrids.2 Phenotyping for Mit antigen was performed using anti-Mit from our rare sera collection. Extended phenotyping confirmed the RBCs as S+ (results not shown); however, s typing was inconclusive since 4/8 anti-s reagents were nonreactive (Figure 1A). Strikingly, clone P3BER reacted 4+ with the donor RBCs while clone P3YAN3 was nonreactive. The RBCs were only weakly positive with 3 polyclonal anti-s. The result of PCR-ASP genotyping was GYPB*03/*04, consistent with an S+ s+ phenotype, and which contradicted the results of the original HEA BeadChip analysis. DNA sequence analysis revealed a novel hybrid sequence (Genbank number OP263737) that was shown to be an 104-bp insertion of GYPA into GYPB exon 4 with the downstream breakpoint in intron 4 (NC_000004.12(NM_002100.4):c.155_175 +83delins[NM_002099.6:c.251_271 + 83]; Figure 1B), such that GPB amino acid sequence 52VHRFTVP58 is replaced by the GPA sequence AHHFSEP (NP_002091.4:p.52_58delins[NP_002090.4:p.84_90]; Figure 1C). The insertion of GYPA-specific nucleotides explains the failure of the HEA BeadChip assay to predict the s antigen encoded by this allele. Further, it is not unusual for hybrid proteins to carry low-prevalence antigens. Review of the inserted GPA sequence suggested that the RBCs might be Mit + since a change of p.Arg54His underlies this low-prevalence GPB antigen.2 The donor's RBCs typed Mit+ with a single example of the antibody. We report a novel and unusual GYP(B-A-B) allele (provisionally named GYP*507) in which gene recombination has occurred within GYPB exon 4. While Thr48 defining the s antigen is still present, Arg54, which is thought to be important for s expression, is substituted by His54 and thus the epitope recognized by anti-s, clone P3YAN3 can be mapped to this region of GPB. The hybrid protein carries the Mit antigen. In contrast, the monoclonal anti-s P3BER has been shown previously to require Thr44 for reactivity, since this is absent from GP.Mur and GP.Bun hybrid proteins,4 and shows that these two monoclonal anti-s recognize different epitopes on GPB. The serological results showed that the expression of s antigen in this new hybrid is both qualitatively and quantitatively perturbed.2 We thank Judith Aeschlimann for providing the GYP2-F and GYPB6-R primer sequences. This work has been supported by the ALF program from the Swedish government and regional county councils (grant no. ALFSKANE-446521 to M.L.O.) to university healthcare in Region Skåne and at Lund University. The authors have disclosed no conflicts of interest.

A Balance between Transmembrane-Mediated ER/Golgi Retention and Forward Trafficking Signals in Glycophorin-Anion Exchanger-1 Interaction.

Anion exchanger-1 (AE1) is the main erythroid Cl-/HCO3- transporter that supports CO2 transport. Glycophorin A (GPA), a component of the AE1 complexes, facilitates AE1 expression and anion transport, but Glycophorin B (GPB) does not. Here, we dissected the structural components of GPA/GPB involved in glycophorin-AE1 trafficking by comparing them with three GPB variants-GPBhead (lacking the transmembrane domain [TMD]), GPBtail (mainly the TMD), and GP.Mur (glycophorin B-A-B hybrid). GPB-derived GP.Mur bears an O-glycopeptide that encompasses the R18 epitope, which is present in GPA but not GPB. By flow cytometry, AE1 expression in the control erythrocytes increased with the GPA-R18 expression; GYP.Mur+/+ erythrocytes bearing both GP.Mur and GPA expressed more R18 epitopes and more AE1 proteins. In contrast, heterologously expressed GPBtail and GPB were predominantly localized in the Golgi apparatus of HEK-293 cells, whereas GBhead was diffuse throughout the cytosol, suggesting that glycophorin transmembrane encoded an ER/Golgi retention signal. AE1 coexpression could reduce the ER/Golgi retention of GPB, but not of GPBtail or GPBhead. Thus, there are forward-trafficking and transmembrane-driven ER/Golgi retention signals encoded in the glycophorin sequences. How the balance between these opposite trafficking signals could affect glycophorin sorting into AE1 complexes and influence erythroid anion transport remains to be explored.

Effects of cholesterol and PIP2 on interactions between glycophorin A and Band 3 in lipid bilayers

In the erythrocyte membrane, the interactions between glycophorin A (GPA) and Band 3 are associated strongly with the biological function of the membrane and several blood disorders. In this work, using coarse-grained molecular-dynamics simulations, we systematically investigate the effects of cholesterol and phosphatidylinositol-4,5-bisphosphate (PIP2) on the interactions of GPA with Band 3 in the model erythrocyte membranes. We examine the dynamics of the interactions of GPA with Band 3 in different lipid bilayers on the microsecond time scale and calculate the binding free energy between GPA and Band 3. The results indicate that cholesterols thermodynamically favor the binding of GPA to Band 3 by increasing the thickness of the lipid bilayer and by producing an effective attraction between the proteins due to the depletion effect. Cholesterols also slow the kinetics of the binding of GPA to Band 3 by reducing the lateral mobility of the lipids and proteins and may influence the binding sites between the proteins. The anionic PIP2 lipids prefer binding to the surface of the proteins through electrostatic attraction between the PIP2 headgroup and the positively charged residues on the protein surface. Ions in the solvent facilitate PIP2 aggregation, which promotes the binding of GPA to Band 3.

Glycoproteomic and Phenotypic Elucidation of B4GALNT2 Expression Variants in the SID Histo-Blood Group System.

The Sda histo-blood group antigen (GalNAcβ1-4(NeuAcα2-3)Galβ-R) is implicated in various infections and constitutes a potential biomarker for colon cancer. Sd(a−) individuals (2–4% of Europeans) may produce anti-Sda, which can lead to incompatible blood transfusions, especially if donors with the high-expressing Sd(a++)/Cad phenotype are involved. We previously reported the association of B4GALNT2 mutations with Sd(a−), which established the SID blood-group system. The present study provides causal proof underpinning this correlation. Sd(a−) HEK293 cells were transfected with different B4GALNT2 constructs and evaluated by immunostaining and glycoproteomics. The predominant SIDnull candidate allele with rs7224888:T>C (p.Cys406Arg) abolished Sda synthesis, while this antigen was detectable as N- or O-glycans on glycoproteins following transfection of wildtype B4GALNT2. Surprisingly, two rare missense variants, rs148441237:A>G and rs61743617:C>T, found in a Sd(a−) compound heterozygote, gave results similar to wildtype. To elucidate on whether Sd(a++)/Cad also depends on B4GALNT2 alterations, this gene was sequenced in five individuals. No Cad-specific changes were identified, but a detailed erythroid Cad glycoprotein profile was obtained, especially for glycophorin-A (GLPA) O-glycosylation, equilibrative nucleoside transporter 1 (S29A1) O-glycosylation, and band 3 anion transport protein (B3AT) N-glycosylation. In conclusion, the p.Cys406Arg β4GalNAc-T2 variant causes Sda-deficiency in humans, while the enigmatic Cad phenotype remains unresolved, albeit further characterized.

Characterization of alternatively spliced transcript variants of glycophorin A and glycophorin B genes in Chinese blood donors.

The molecular basis of MNS blood group variants is not fully clear yet. In this study, we have characterized mRNA variants of GYPA and GYPB genes to reveal whether alternative RNA splicing may cause antigenic diversity of the MNS system. Total RNA was extracted from peripheral blood of Chinese blood donors and full-length cDNA products were generated. A nested polymerase chain reaction (PCR)-based method was established for fragment amplification and Sanger sequencing. Resulted full-length mRNA sequences were aligned with GYPA or GYPB genomic sequences respectively for exon identification. Amino acid (AA) sequences of GPA and GPB proteins were extrapolated and GYPA-EGFP, GYPB-EGFP fusion genes were generated to monitor subcellular distribution of the encoded glycophorin (GP) proteins. Totally 10 blood samples were analysed. GYPB mRNAs of all the subjects demonstrated frequent exon insertion or deletion whereas this kind of variation was only observed in 3 of 10 GYPA mRNA samples. None of the reported Miltenberger hybrids was detected in any of the mRNA samples. The alternative splicing resulted in changes of AA sequences in N-terminal domains where the MNS antigenic motifs resided; however, subcellular localizations of GP-EGFP fusion proteins showed that the above-mentioned AA changes did not affect cell surface distribution of the encoded GP proteins. Alternative RNA splicing may influence the antigenic features of GP proteins but not their cell surface distribution. Therefore, GYPA and GYPB mRNA characterization might be an invaluable supplement to serological phenotyping and DNA-based genotyping in MNS blood grouping.

Glycophorins and the MNS blood group system: a narrative review

: The MNS blood group system, International Society of Blood Transfusion (ISBT) 002, is second after the ABO system. GYPA and GYPB genes encode MNS blood group antigens carried on glycophorin A (GPA), glycophorin B (GPB), or on variant glycophorins. A third gene, GYPE, produce glycophorin E (GPE) but is not expressed. MNS antigens arise from several genetic mechanisms. Single nucleotide variants (SNVs) contribute to the diversity of the MNS system. A new antigen SUMI (MNS50), p.Thr31Pro on GPA has been described in the Japanese population. Unequal crossing-over and gene conversion are the mechanisms forming hybrid glycophorins, usually from parent genes GYPA and GYPB. GYPE also contributes to gene recombination previously only described with GYPA. Recently, however, GYPE was shown to recombine with GYPB to form a GYP(B-E-B) hybrid. A GYP(B-E-B) hybrid allele encodes a mature GP(E-B) molecule expressing a trypsin-resistant M antigen but no S/s. Another novel glycophorin GP.MOT has been described carrying Mia, Mur, MUT, and KIPP antigens. GP.MOT is encoded by a GYP(B-A) hybrid allele. Newly reported cases of haemolytic transfusion reaction (HTR) or haemolytic disease of the fetus and newborn (HDFN) due to antibodies to MNS antigens is a constant reminder of the clinical significance of the MNS system. In one HDFN case, anti-U and anti-D were detected in an Indian D–, S–s–U– mother. The S–s–U– phenotype is rare in Asians and Caucasians but it is more commonly found in the African populations. Several types of novel GYPB deletion alleles that drive the S–s–U– phenotype have been recently described. Two large GYPB deletion alleles, over 100 kb, were identified as the predominant alleles in the African population. The use of advanced DNA sequencing techniques and bioinformatic analysis has helped uncover these large gene-deletion variants. Molecular typing platforms used for MNS genotyping are also discussed in this review. In conclusion, this review considers currently recognised MNS antigens and variants, new hybrid alleles and GYPB gene deletion alleles as well as clinical case studies. These new discoveries contribute to our understanding of the complexity of the MNS system to guide decision-making in genetic analysis and transfusion medicine.

Autoantibodies to red blood cell surface Glycophorin A impact the activation poise of circulating leukocytes.

Both M and N alleles encode antigens on Glycophorin A (GPA), a red blood cell (RBC) surface sialoglycoprotein. Interaction between RBC GPA and leukocyte surface lectins may downregulate their activation. The current study investigates if RBC autoantibodies against GPA, such as auto-anti-M/N, prime an activated phenotype in peripheral blood leukocytes. Leukocyte activation was assessed in whole blood from patients with auto-anti-GPA (anti-M/N) and compared to those with allo-anti-M/N and healthy subjects. Control samples from healthy subjects with no antibodies incubated in vitro with either anti-GPA or anti-Rh were analyzed for neutrophil and monocyte surface activation marker expression, reactive oxygen species (ROS) content, and formation of aggregates with RBCs. Samples incubated with an IgG1 isotype antibody served as controls. Ex vivo, neutrophil CD66b and monocyte CD63 surface expression was increased in patients with auto-anti-M/N compared to those with allo anti-M/N (p=.1757; p=.0698) and to healthy subjects (p=.0186; p=.013). In vitro, neutrophil CD66b and monocyte CD63 surface expression was increased following incubation with anti-GPA compared to anti-Rh (p=.0003; p=.0328) and isotype control (p=.000; p=.0062). Intracellular ROS content increased in both neutrophils and monocytes incubated with anti-GPA compared to anti-Rh (p=.0012; p=.0693) and isotype control (p=.001; p=.0021). Percentage of neutrophil-RBC aggregates was decreased when incubated with anti-GPA compared to isotype control (p < .01). Neutrophils and monocytes in peripheral blood exposed to an antibody directed against GPA on RBC surfaces, such as M or N antigens, may be primed towards an activated phenotype.

Frequencies of glycophorin variants and alloantibodies against Hil and MINY antigens in Japanese.

Antigens of the MNS blood group system are expressed on the red blood cell (RBC) membrane on glycophorin A (GPA) and glycophorin B (GPB) or on hybrid molecules of GPA and GPB. This study investigated the distribution of glycophorin variants and alloantibodies against Hil and MINY among Japanese individuals. Mi(a+) or Hil+ RBCs were screened using an automated blood grouping machine (PK7300) with monoclonal anti-Mia or polyclonal anti-Hil. Glycophorin variants were defined by serology with monoclonal antibodies against Mia , Vw, MUT and Mur, and polyclonal antibodies against Hil, MINY and Hop + Nob (KIPP). The glycophorin variants were further confirmed by immunoblotting and Sanger sequencing. Alloanti-Hil and alloanti-MINY in the plasma were screened using GP.Hil RBCs in an antiglobulin test. The specificity of anti-Hil or anti-MINY was assessed using GP.Hil (Hil+MINY+) and GP.JL (Hil-MINY+) RBCs. The GP.HF, GP.Mur, GP.Hut, GP.Vw, GP.Kip and GP.Bun frequencies in 1005594 individuals were 0·0357%, 0·0256%, 0·0181%, 0·0017%, 0·0009% and 0·0007%, respectively. GP.Hil was found in as four of the 13546 individuals (0·0295%). Of 137370 donors, 10 had anti-Hil (0·0073%) and three had anti-MINY (0·0022%). Glycophorin variants were relatively rare in Japanese individuals, with the major variants being GP.HF (0·0357%), GP.Hil (0·0295%) and GP.Mur (0·0256%). Only one example of anti-MINY was previously reported, but we found three more in this study.

Comprehensive transcriptome analysis of erythroid differentiation potential of olive leaf in haematopoietic stem cells.

Anaemia is one of the leading causes of disability in young adults and is associated with increased morbidity and mortality in elderly. With a global target to reduce the disease burden of anaemia, recent researches focus on novel compounds with the ability to induce erythropoiesis and regulate iron homeostasis. We aimed to explore the biological events and potential polypharmacological effects of water‐extracted olive leaf (WOL) on human bone marrow–derived haematopoietic stem cells (hHSCs) using a comprehensive gene expression analysis. HPLC analysis identifies six bioactive polyphenols in the WOL. Treatment with WOL for 12 days regulated gene expressions related to erythroid differentiation, oxygen homeostasis, iron homeostasis, haem metabolism and Hb biosynthesis in hHSCs. Functional clustering analysis reveals several major functions of WOL such as ribosomal biogenesis and mitochondrial translation machinery, glycolytic process, ATP biosynthesis and immune response. Additionally, the colonies of both primitive and mature erythroid progenitors, CFU‐E and BFU‐E, were significantly increased in WOL‐treated hHSCs. The expressions of erythroid markers, CD47, glycophorin A (GYPA), and transferrin receptor (TFRC) and adult Hb subunits‐HBA and HBB were also confirmed in immunofluorescent staining and flow cytometer analysis in WOL‐treated hHSCs. It is well known that induction of lineage‐specific differentiation, as well as the maturation of early haematopoietic precursors into fully mature erythrocytes, involves multiple simultaneous biological events and complex signalling networks. In this regard, our genome‐wide transcriptome profiling with microarray study on WOL‐treated hHSCs provides general insights into the multitarget prophylactic and/or therapeutic potential of WOL in anaemia and other haematological disorders.

Elevated somatic mutation and evidence of genomic instability in veterans with Gulf War illness

AimsGulf War illness (GWI) is thought to be associated with exposures experienced by soldiers deployed in the 1991 Gulf War. A major question is how these exposures continue to influence the health of these individuals three decades later. One potentially permanent effect of such exposures is the induction of genetic mutations. We investigated whether veterans with GWI exhibited persistently elevated levels of somatic mutation. Materials and methodsWe applied the blood-based glycophorin A (GPA) somatic mutation assay to a cohort of veterans diagnosed with GWI and a set of both concurrent and historic age-matched controls. This assay quantifies red blood cells with a phenotype consistent with loss of one allele at the genetic determinant for the MN blood group, the GPA gene. Key findingsAs a population, those affected with GWI exhibited an uninduced mutation frequency at the GPA locus that was effectively twice that observed in controls, a result that was statistically significant. This result was influenced by an increase in the incidence of individuals with aberrantly high mutation frequencies, seemingly higher than would be expected by dose extrapolation and consistent with the induction of localized genomic instability in the hematopoietic bone marrow stem cells. When these “outliers” were removed from consideration, the remaining affected population retained a significantly higher mean allele loss mutation frequency, suggesting that both dose-dependent bone marrow genotoxicity and induction of genomic instability are contributing to the elevation in mutation frequency in these affected veterans. SignificanceThis study provides evidence that manifestation of GWI is associated with increased cumulative exposure to agents capable of inducing persistent mutations in bone marrow stem cells. Whether these mutations are involved in the clinical aspects of the condition or are simply biomarkers of overall exposure has yet to be determined. The increased incidence of genomic instability suggests that this persistent mutation can have important delayed effects on cellular integrity.

Combinational Treatment of Imatinib and Allicin Synergistically Inhibits the Growth of BCR-ABL-Positive Leukemia and the Emergence of Drug-Resistant Cells

Imatinib mesylate (Gleevec, Glivec, STI571) is used as a first-line therapy for chronic myeloid leukemia (CML) to inhibit the tyrosine kinase activity of BCR-ABL. Although imatinib has greatly improved CML patient prognosis, imatinib-resistant cells often develop in about 30-40% of patients after treatment, causing major therapeutic failure. Several second and third generation tyrosine kinase inhibitors, such as dasatinib, nilotinib and ponatinib, have been developed, but none of them are able to completely block the development of drug-resistance. Therefore, new therapeutic approaches are in need to prevent or reduce the emergence of drug-resistant cells in the early stages of imatinib therapy.In this study, we show that the combinational treatment of allicin, an active component in garlic, and imatinib effectively blocks imatinib-resistance in K562 BCR-ABL-positive leukemia cells. Both imatinib and allicin had dose-dependent effects on cell viability during the first 3 days of treatment. However, the growth inhibitory effect did not last and resulted in re-growth of cells when treated with allicin alone (2 microgram/ml) or 200 nM of imatinib, which is close to the IC50 value in our K562 cells determined on day 3. In contrast, the combination of allicin with imatinib still inhibited cell growth by day 6. Wright-Giemsa stainings showed that the combinational treatment of imatinib and allicin also caused erythroid differentiation.To identify the molecular mechanisms of imatinib and allicin's actions, we analyzed RNA expression after single and combinational treatments with imatinib and allicin. The results demonstrated that both imatinib and allicin increased the expression of alpha -globin and gamma -globin. The expression of glycophorin A (GYPA), a marker of erythroid differentiation, was synergistically increased by the combinational treatment of imatinib and allicin. One of the notable changes we observed was a decrease of p21 (cyclin-dependent kinase inhibitor 1A; CDKN1A) expression when cells were treated with the IC50 dosage of imatinib. Surprisingly, when allicin was treated together with imatinib, the p21 decrease by imatinib was completely inhibited. Allicin alone did not increase p21, suggesting that allicin does not control p21 expression directly, but instead antagonizes the action of imatinib downregulating p21.More importantly, a long-term treatment of K562 cells with imatinib and allicin showed that allicin was able to completely block the emergence of imatinib-resistant cells in vitro. Viable cells started to grow again within 12 days when treated with imatinib or allicin alone. However, no resistant cells were observed after up to 40 days when cells were cultured with the combinational treatment.Taken together, the combinational treatment of imatinib and allicin has a synergistic effect on blocking leukemia cell expansion as they enhance erythroid differentiation and prevent cell cycle progression of residual resistant cells by attenuating the negative effects of imatinib on p21 expression. Our findings suggest that combining imatinib and allicin could be a potential therapeutic to prevent drug-resistance in BCR-ABL-positive leukemia. DisclosuresNo relevant conflicts of interest to declare.